diff --git a/.devcontainer/devcontainer.json b/.devcontainer/devcontainer.json
index ea27a584..4ecfbfe3 100644
--- a/.devcontainer/devcontainer.json
+++ b/.devcontainer/devcontainer.json
@@ -2,6 +2,7 @@
     "name": "nfcore",
     "image": "nfcore/gitpod:latest",
     "remoteUser": "gitpod",
+    "runArgs": ["--privileged"],
 
     // Configure tool-specific properties.
     "customizations": {
diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md
index 60ecfabd..320b2087 100644
--- a/.github/CONTRIBUTING.md
+++ b/.github/CONTRIBUTING.md
@@ -9,7 +9,9 @@ Please use the pre-filled template to save time.
 However, don't be put off by this template - other more general issues and suggestions are welcome!
 Contributions to the code are even more welcome ;)
 
-> If you need help using or modifying nf-core/viralrecon then the best place to ask is on the nf-core Slack [#viralrecon](https://nfcore.slack.com/channels/viralrecon) channel ([join our Slack here](https://nf-co.re/join/slack)).
+:::info
+If you need help using or modifying nf-core/viralrecon then the best place to ask is on the nf-core Slack [#viralrecon](https://nfcore.slack.com/channels/viralrecon) channel ([join our Slack here](https://nf-co.re/join/slack)).
+:::
 
 ## Contribution workflow
 
@@ -25,6 +27,9 @@ If you're not used to this workflow with git, you can start with some [docs from
 
 ## Tests
 
+You can optionally test your changes by running the pipeline locally. Then it is recommended to use the `debug` profile to
+receive warnings about process selectors and other debug info. Example: `nextflow run . -profile debug,test,docker --outdir <OUTDIR>`.
+
 When you create a pull request with changes, [GitHub Actions](https://github.com/features/actions) will run automatic tests.
 Typically, pull-requests are only fully reviewed when these tests are passing, though of course we can help out before then.
 
diff --git a/.github/PULL_REQUEST_TEMPLATE.md b/.github/PULL_REQUEST_TEMPLATE.md
index 812c9116..c7a4cea8 100644
--- a/.github/PULL_REQUEST_TEMPLATE.md
+++ b/.github/PULL_REQUEST_TEMPLATE.md
@@ -19,6 +19,7 @@ Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/vira
 - [ ] If necessary, also make a PR on the nf-core/viralrecon _branch_ on the [nf-core/test-datasets](https://github.com/nf-core/test-datasets) repository.
 - [ ] Make sure your code lints (`nf-core lint`).
 - [ ] Ensure the test suite passes (`nextflow run . -profile test,docker --outdir <OUTDIR>`).
+- [ ] Check for unexpected warnings in debug mode (`nextflow run . -profile debug,test,docker --outdir <OUTDIR>`).
 - [ ] Usage Documentation in `docs/usage.md` is updated.
 - [ ] Output Documentation in `docs/output.md` is updated.
 - [ ] `CHANGELOG.md` is updated.
diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml
index 3045862d..edae0526 100644
--- a/.github/workflows/ci.yml
+++ b/.github/workflows/ci.yml
@@ -28,7 +28,7 @@ jobs:
           - "latest-everything"
     steps:
       - name: Check out pipeline code
-        uses: actions/checkout@v3
+        uses: actions/checkout@v4
 
       - name: Install Nextflow
         uses: nf-core/setup-nextflow@v1
@@ -103,7 +103,7 @@ jobs:
           - "--min_barcode_reads 10000"
           - "--min_guppyplex_reads 10000"
           - "--artic_minion_caller medaka --sequencing_summary false --fast5_dir false"
-          - "--artic_minion_caller medaka --sequencing_summary false --fast5_dir false --artic_minion_medaka_model r941_min_high_g360"
+          - "--artic_minion_caller medaka --sequencing_summary false --fast5_dir false --artic_minion_medaka_model ./r941_min_high_g360_model.hdf5"
     steps:
       - name: Check out pipeline code
         uses: actions/checkout@v2
@@ -112,6 +112,9 @@ jobs:
         run: |
           wget -qO- get.nextflow.io | bash
           sudo mv nextflow /usr/local/bin/
+      - name: Download medaka model
+        run: |
+          wget https://github.com/nanoporetech/medaka/raw/master/medaka/data/r941_min_high_g360_model.hdf5
 
       - name: Run pipeline with minimal Nanopore data and various options
         run: |
diff --git a/.github/workflows/fix-linting.yml b/.github/workflows/fix-linting.yml
index d1e6e5de..86f39997 100644
--- a/.github/workflows/fix-linting.yml
+++ b/.github/workflows/fix-linting.yml
@@ -13,7 +13,7 @@ jobs:
     runs-on: ubuntu-latest
     steps:
       # Use the @nf-core-bot token to check out so we can push later
-      - uses: actions/checkout@v3
+      - uses: actions/checkout@v4
         with:
           token: ${{ secrets.nf_core_bot_auth_token }}
 
@@ -24,7 +24,7 @@ jobs:
         env:
           GITHUB_TOKEN: ${{ secrets.nf_core_bot_auth_token }}
 
-      - uses: actions/setup-node@v3
+      - uses: actions/setup-node@v4
 
       - name: Install Prettier
         run: npm install -g prettier @prettier/plugin-php
diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml
index 888cb4bc..905c58e4 100644
--- a/.github/workflows/linting.yml
+++ b/.github/workflows/linting.yml
@@ -14,9 +14,9 @@ jobs:
   EditorConfig:
     runs-on: ubuntu-latest
     steps:
-      - uses: actions/checkout@v3
+      - uses: actions/checkout@v4
 
-      - uses: actions/setup-node@v3
+      - uses: actions/setup-node@v4
 
       - name: Install editorconfig-checker
         run: npm install -g editorconfig-checker
@@ -27,9 +27,9 @@ jobs:
   Prettier:
     runs-on: ubuntu-latest
     steps:
-      - uses: actions/checkout@v3
+      - uses: actions/checkout@v4
 
-      - uses: actions/setup-node@v3
+      - uses: actions/setup-node@v4
 
       - name: Install Prettier
         run: npm install -g prettier
@@ -40,7 +40,7 @@ jobs:
   PythonBlack:
     runs-on: ubuntu-latest
     steps:
-      - uses: actions/checkout@v3
+      - uses: actions/checkout@v4
 
       - name: Check code lints with Black
         uses: psf/black@stable
@@ -71,14 +71,14 @@ jobs:
     runs-on: ubuntu-latest
     steps:
       - name: Check out pipeline code
-        uses: actions/checkout@v3
+        uses: actions/checkout@v4
 
       - name: Install Nextflow
         uses: nf-core/setup-nextflow@v1
 
       - uses: actions/setup-python@v4
         with:
-          python-version: "3.8"
+          python-version: "3.11"
           architecture: "x64"
 
       - name: Install dependencies
diff --git a/.github/workflows/release-announcements.yml b/.github/workflows/release-announcements.yml
new file mode 100644
index 00000000..6ad33927
--- /dev/null
+++ b/.github/workflows/release-announcements.yml
@@ -0,0 +1,68 @@
+name: release-announcements
+# Automatic release toot and tweet anouncements
+on:
+  release:
+    types: [published]
+  workflow_dispatch:
+
+jobs:
+  toot:
+    runs-on: ubuntu-latest
+    steps:
+      - uses: rzr/fediverse-action@master
+        with:
+          access-token: ${{ secrets.MASTODON_ACCESS_TOKEN }}
+          host: "mstdn.science" # custom host if not "mastodon.social" (default)
+          # GitHub event payload
+          # https://docs.github.com/en/developers/webhooks-and-events/webhooks/webhook-events-and-payloads#release
+          message: |
+            Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}!
+
+            Please see the changelog: ${{ github.event.release.html_url }}
+
+  send-tweet:
+    runs-on: ubuntu-latest
+
+    steps:
+      - uses: actions/setup-python@v4
+        with:
+          python-version: "3.10"
+      - name: Install dependencies
+        run: pip install tweepy==4.14.0
+      - name: Send tweet
+        shell: python
+        run: |
+          import os
+          import tweepy
+
+          client = tweepy.Client(
+              access_token=os.getenv("TWITTER_ACCESS_TOKEN"),
+              access_token_secret=os.getenv("TWITTER_ACCESS_TOKEN_SECRET"),
+              consumer_key=os.getenv("TWITTER_CONSUMER_KEY"),
+              consumer_secret=os.getenv("TWITTER_CONSUMER_SECRET"),
+          )
+          tweet = os.getenv("TWEET")
+          client.create_tweet(text=tweet)
+        env:
+          TWEET: |
+            Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}!
+
+            Please see the changelog: ${{ github.event.release.html_url }}
+          TWITTER_CONSUMER_KEY: ${{ secrets.TWITTER_CONSUMER_KEY }}
+          TWITTER_CONSUMER_SECRET: ${{ secrets.TWITTER_CONSUMER_SECRET }}
+          TWITTER_ACCESS_TOKEN: ${{ secrets.TWITTER_ACCESS_TOKEN }}
+          TWITTER_ACCESS_TOKEN_SECRET: ${{ secrets.TWITTER_ACCESS_TOKEN_SECRET }}
+
+  bsky-post:
+    runs-on: ubuntu-latest
+    steps:
+      - uses: zentered/bluesky-post-action@v0.0.2
+        with:
+          post: |
+            Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}!
+
+            Please see the changelog: ${{ github.event.release.html_url }}
+        env:
+          BSKY_IDENTIFIER: ${{ secrets.BSKY_IDENTIFIER }}
+          BSKY_PASSWORD: ${{ secrets.BSKY_PASSWORD }}
+          #
diff --git a/.gitpod.yml b/.gitpod.yml
index a49fe55f..3b2bb254 100644
--- a/.gitpod.yml
+++ b/.gitpod.yml
@@ -4,7 +4,9 @@ tasks:
     command: |
       pre-commit install --install-hooks
       nextflow self-update
-
+  - name: unset JAVA_TOOL_OPTIONS
+    command: |
+      unset JAVA_TOOL_OPTIONS
 vscode:
   extensions: # based on nf-core.nf-core-extensionpack
     - codezombiech.gitignore # Language support for .gitignore files
diff --git a/CHANGELOG.md b/CHANGELOG.md
index 0d3d42c0..005ef5ae 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -19,6 +19,7 @@ Thank you to everyone else that has contributed by reporting bugs, enhancements
 - [[#299](https://github.com/nf-core/viralrecon/issues/299)] - Add the freyja pipeline as a subworkflow
 - [[PR #387](https://github.com/nf-core/viralrecon/pull/387)] - Software closes gracefully when encountering an error
 - [[PR #395](https://github.com/nf-core/viralrecon/pull/395)] - Remove minia from default assemblers because it is unreliable
+- [[PR #393](https://github.com/nf-core/viralrecon/pull/393)] - Changed primer set to params
 - [[PR #401](https://github.com/nf-core/viralrecon/pull/401)] - Added option to add a custom annotation
 
 ### Parameters
diff --git a/CITATIONS.md b/CITATIONS.md
index b5a0436c..cc0ca9c7 100644
--- a/CITATIONS.md
+++ b/CITATIONS.md
@@ -50,7 +50,7 @@
 
 - [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/)
 
-  > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. Available online https://www.bioinformatics.babraham.ac.uk/projects/fastqc/.
+  > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/).
 
 - [iVar](https://www.ncbi.nlm.nih.gov/pubmed/30621750/)
 
diff --git a/CODE_OF_CONDUCT.md b/CODE_OF_CONDUCT.md
index f4fd052f..c089ec78 100755
--- a/CODE_OF_CONDUCT.md
+++ b/CODE_OF_CONDUCT.md
@@ -1,18 +1,20 @@
-# Code of Conduct at nf-core (v1.0)
+# Code of Conduct at nf-core (v1.4)
 
 ## Our Pledge
 
-In the interest of fostering an open, collaborative, and welcoming environment, we as contributors and maintainers of nf-core, pledge to making participation in our projects and community a harassment-free experience for everyone, regardless of:
+In the interest of fostering an open, collaborative, and welcoming environment, we as contributors and maintainers of nf-core pledge to making participation in our projects and community a harassment-free experience for everyone, regardless of:
 
 - Age
+- Ability
 - Body size
+- Caste
 - Familial status
 - Gender identity and expression
 - Geographical location
 - Level of experience
 - Nationality and national origins
 - Native language
-- Physical and neurological ability
+- Neurodiversity
 - Race or ethnicity
 - Religion
 - Sexual identity and orientation
@@ -22,80 +24,133 @@ Please note that the list above is alphabetised and is therefore not ranked in a
 
 ## Preamble
 
-> Note: This Code of Conduct (CoC) has been drafted by the nf-core Safety Officer and been edited after input from members of the nf-core team and others. "We", in this document, refers to the Safety Officer and members of the nf-core core team, both of whom are deemed to be members of the nf-core community and are therefore required to abide by this Code of Conduct. This document will amended periodically to keep it up-to-date, and in case of any dispute, the most current version will apply.
+:::note
+This Code of Conduct (CoC) has been drafted by Renuka Kudva, Cris Tuñí, and Michael Heuer, with input from the nf-core Core Team and Susanna Marquez from the nf-core community. "We", in this document, refers to the Safety Officers and members of the nf-core Core Team, both of whom are deemed to be members of the nf-core community and are therefore required to abide by this Code of Conduct. This document will be amended periodically to keep it up-to-date. In case of any dispute, the most current version will apply.
+:::
 
-An up-to-date list of members of the nf-core core team can be found [here](https://nf-co.re/about). Our current safety officer is Renuka Kudva.
+An up-to-date list of members of the nf-core core team can be found [here](https://nf-co.re/about).
+
+Our Safety Officers are Saba Nafees, Cris Tuñí, and Michael Heuer.
 
 nf-core is a young and growing community that welcomes contributions from anyone with a shared vision for [Open Science Policies](https://www.fosteropenscience.eu/taxonomy/term/8). Open science policies encompass inclusive behaviours and we strive to build and maintain a safe and inclusive environment for all individuals.
 
-We have therefore adopted this code of conduct (CoC), which we require all members of our community and attendees in nf-core events to adhere to in all our workspaces at all times. Workspaces include but are not limited to Slack, meetings on Zoom, Jitsi, YouTube live etc.
+We have therefore adopted this CoC, which we require all members of our community and attendees of nf-core events to adhere to in all our workspaces at all times. Workspaces include, but are not limited to, Slack, meetings on Zoom, gather.town, YouTube live etc.
 
-Our CoC will be strictly enforced and the nf-core team reserve the right to exclude participants who do not comply with our guidelines from our workspaces and future nf-core activities.
+Our CoC will be strictly enforced and the nf-core team reserves the right to exclude participants who do not comply with our guidelines from our workspaces and future nf-core activities.
 
-We ask all members of our community to help maintain a supportive and productive workspace and to avoid behaviours that can make individuals feel unsafe or unwelcome. Please help us maintain and uphold this CoC.
+We ask all members of our community to help maintain supportive and productive workspaces and to avoid behaviours that can make individuals feel unsafe or unwelcome. Please help us maintain and uphold this CoC.
 
-Questions, concerns or ideas on what we can include? Contact safety [at] nf-co [dot] re
+Questions, concerns, or ideas on what we can include? Contact members of the Safety Team on Slack or email safety [at] nf-co [dot] re.
 
 ## Our Responsibilities
 
-The safety officer is responsible for clarifying the standards of acceptable behavior and are expected to take appropriate and fair corrective action in response to any instances of unacceptable behaviour.
+Members of the Safety Team (the Safety Officers) are responsible for clarifying the standards of acceptable behavior and are expected to take appropriate and fair corrective action in response to any instances of unacceptable behaviour.
 
-The safety officer in consultation with the nf-core core team have the right and responsibility to remove, edit, or reject comments, commits, code, wiki edits, issues, and other contributions that are not aligned to this Code of Conduct, or to ban temporarily or permanently any contributor for other behaviors that they deem inappropriate, threatening, offensive, or harmful.
+The Safety Team, in consultation with the nf-core core team, have the right and responsibility to remove, edit, or reject comments, commits, code, wiki edits, issues, and other contributions that are not aligned to this CoC, or to ban temporarily or permanently any contributor for other behaviors that they deem inappropriate, threatening, offensive, or harmful.
 
-Members of the core team or the safety officer who violate the CoC will be required to recuse themselves pending investigation. They will not have access to any reports of the violations and be subject to the same actions as others in violation of the CoC.
+Members of the core team or the Safety Team who violate the CoC will be required to recuse themselves pending investigation. They will not have access to any reports of the violations and will be subject to the same actions as others in violation of the CoC.
 
-## When are where does this Code of Conduct apply?
+## When and where does this Code of Conduct apply?
 
-Participation in the nf-core community is contingent on following these guidelines in all our workspaces and events. This includes but is not limited to the following listed alphabetically and therefore in no order of preference:
+Participation in the nf-core community is contingent on following these guidelines in all our workspaces and events, such as hackathons, workshops, bytesize, and collaborative workspaces on gather.town. These guidelines include, but are not limited to, the following (listed alphabetically and therefore in no order of preference):
 
 - Communicating with an official project email address.
 - Communicating with community members within the nf-core Slack channel.
 - Participating in hackathons organised by nf-core (both online and in-person events).
-- Participating in collaborative work on GitHub, Google Suite, community calls, mentorship meetings, email correspondence.
-- Participating in workshops, training, and seminar series organised by nf-core (both online and in-person events). This applies to events hosted on web-based platforms such as Zoom, Jitsi, YouTube live etc.
+- Participating in collaborative work on GitHub, Google Suite, community calls, mentorship meetings, email correspondence, and on the nf-core gather.town workspace.
+- Participating in workshops, training, and seminar series organised by nf-core (both online and in-person events). This applies to events hosted on web-based platforms such as Zoom, gather.town, Jitsi, YouTube live etc.
 - Representing nf-core on social media. This includes both official and personal accounts.
 
 ## nf-core cares 😊
 
-nf-core's CoC and expectations of respectful behaviours for all participants (including organisers and the nf-core team) include but are not limited to the following (listed in alphabetical order):
+nf-core's CoC and expectations of respectful behaviours for all participants (including organisers and the nf-core team) include, but are not limited to, the following (listed in alphabetical order):
 
 - Ask for consent before sharing another community member’s personal information (including photographs) on social media.
 - Be respectful of differing viewpoints and experiences. We are all here to learn from one another and a difference in opinion can present a good learning opportunity.
-- Celebrate your accomplishments at events! (Get creative with your use of emojis 🎉 🥳 💯 🙌 !)
+- Celebrate your accomplishments! (Get creative with your use of emojis 🎉 🥳 💯 🙌 !)
 - Demonstrate empathy towards other community members. (We don’t all have the same amount of time to dedicate to nf-core. If tasks are pending, don’t hesitate to gently remind members of your team. If you are leading a task, ask for help if you feel overwhelmed.)
 - Engage with and enquire after others. (This is especially important given the geographically remote nature of the nf-core community, so let’s do this the best we can)
 - Focus on what is best for the team and the community. (When in doubt, ask)
-- Graciously accept constructive criticism, yet be unafraid to question, deliberate, and learn.
+- Accept feedback, yet be unafraid to question, deliberate, and learn.
 - Introduce yourself to members of the community. (We’ve all been outsiders and we know that talking to strangers can be hard for some, but remember we’re interested in getting to know you and your visions for open science!)
-- Show appreciation and **provide clear feedback**. (This is especially important because we don’t see each other in person and it can be harder to interpret subtleties. Also remember that not everyone understands a certain language to the same extent as you do, so **be clear in your communications to be kind.**)
+- Show appreciation and **provide clear feedback**. (This is especially important because we don’t see each other in person and it can be harder to interpret subtleties. Also remember that not everyone understands a certain language to the same extent as you do, so **be clear in your communication to be kind.**)
 - Take breaks when you feel like you need them.
-- Using welcoming and inclusive language. (Participants are encouraged to display their chosen pronouns on Zoom or in communication on Slack.)
+- Use welcoming and inclusive language. (Participants are encouraged to display their chosen pronouns on Zoom or in communication on Slack)
 
 ## nf-core frowns on 😕
 
-The following behaviours from any participants within the nf-core community (including the organisers) will be considered unacceptable under this code of conduct. Engaging or advocating for any of the following could result in expulsion from nf-core workspaces.
+The following behaviours from any participants within the nf-core community (including the organisers) will be considered unacceptable under this CoC. Engaging or advocating for any of the following could result in expulsion from nf-core workspaces:
 
 - Deliberate intimidation, stalking or following and sustained disruption of communication among participants of the community. This includes hijacking shared screens through actions such as using the annotate tool in conferencing software such as Zoom.
 - “Doxing” i.e. posting (or threatening to post) another person’s personal identifying information online.
 - Spamming or trolling of individuals on social media.
-- Use of sexual or discriminatory imagery, comments, or jokes and unwelcome sexual attention.
-- Verbal and text comments that reinforce social structures of domination related to gender, gender identity and expression, sexual orientation, ability, physical appearance, body size, race, age, religion or work experience.
+- Use of sexual or discriminatory imagery, comments, jokes, or unwelcome sexual attention.
+- Verbal and text comments that reinforce social structures of domination related to gender, gender identity and expression, sexual orientation, ability, physical appearance, body size, race, age, religion, or work experience.
 
 ### Online Trolling
 
-The majority of nf-core interactions and events are held online. Unfortunately, holding events online comes with the added issue of online trolling. This is unacceptable, reports of such behaviour will be taken very seriously, and perpetrators will be excluded from activities immediately.
+The majority of nf-core interactions and events are held online. Unfortunately, holding events online comes with the risk of online trolling. This is unacceptable — reports of such behaviour will be taken very seriously and perpetrators will be excluded from activities immediately.
 
-All community members are required to ask members of the group they are working within for explicit consent prior to taking screenshots of individuals during video calls.
+All community members are **required** to ask members of the group they are working with for explicit consent prior to taking screenshots of individuals during video calls.
 
-## Procedures for Reporting CoC violations
+## Procedures for reporting CoC violations
 
 If someone makes you feel uncomfortable through their behaviours or actions, report it as soon as possible.
 
-You can reach out to members of the [nf-core core team](https://nf-co.re/about) and they will forward your concerns to the safety officer(s).
+You can reach out to members of the Safety Team (Saba Nafees, Cris Tuñí, and Michael Heuer) on Slack. Alternatively, contact a member of the nf-core core team [nf-core core team](https://nf-co.re/about), and they will forward your concerns to the Safety Team.
+
+Issues directly concerning members of the Core Team or the Safety Team will be dealt with by other members of the core team and the safety manager — possible conflicts of interest will be taken into account. nf-core is also in discussions about having an ombudsperson and details will be shared in due course.
+
+All reports will be handled with the utmost discretion and confidentiality.
+
+You can also report any CoC violations to safety [at] nf-co [dot] re. In your email report, please do your best to include:
+
+- Your contact information.
+- Identifying information (e.g. names, nicknames, pseudonyms) of the participant who has violated the Code of Conduct.
+- The behaviour that was in violation and the circumstances surrounding the incident.
+- The approximate time of the behaviour (if different than the time the report was made).
+- Other people involved in the incident, if applicable.
+- If you believe the incident is ongoing.
+- If there is a publicly available record (e.g. mailing list record, a screenshot).
+- Any additional information.
+
+After you file a report, one or more members of our Safety Team will contact you to follow up on your report.
+
+## Who will read and handle reports
+
+All reports will be read and handled by the members of the Safety Team at nf-core.
+
+If members of the Safety Team are deemed to have a conflict of interest with a report, they will be required to recuse themselves as per our Code of Conduct and will not have access to any follow-ups.
+
+To keep this first report confidential from any of the Safety Team members, please submit your first report by direct messaging on Slack/direct email to any of the nf-core members you are comfortable disclosing the information to, and be explicit about which member(s) you do not consent to sharing the information with.
+
+## Reviewing reports
+
+After receiving the report, members of the Safety Team will review the incident report to determine whether immediate action is required, for example, whether there is immediate threat to participants’ safety.
+
+The Safety Team, in consultation with members of the nf-core core team, will assess the information to determine whether the report constitutes a Code of Conduct violation, for them to decide on a course of action.
+
+In the case of insufficient information, one or more members of the Safety Team may contact the reporter, the reportee, or any other attendees to obtain more information.
 
-Issues directly concerning members of the core team will be dealt with by other members of the core team and the safety manager, and possible conflicts of interest will be taken into account. nf-core is also in discussions about having an ombudsperson, and details will be shared in due course.
+Once additional information is gathered, the Safety Team will collectively review and decide on the best course of action to take, if any. The Safety Team reserves the right to not act on a report.
 
-All reports will be handled with utmost discretion and confidentially.
+## Confidentiality
+
+All reports, and any additional information included, are only shared with the team of safety officers (and possibly members of the core team, in case the safety officer is in violation of the CoC). We will respect confidentiality requests for the purpose of protecting victims of abuse.
+
+We will not name harassment victims, beyond discussions between the safety officer and members of the nf-core team, without the explicit consent of the individuals involved.
+
+## Enforcement
+
+Actions taken by the nf-core’s Safety Team may include, but are not limited to:
+
+- Asking anyone to stop a behaviour.
+- Asking anyone to leave the event and online spaces either temporarily, for the remainder of the event, or permanently.
+- Removing access to the gather.town and Slack, either temporarily or permanently.
+- Communicating to all participants to reinforce our expectations for conduct and remind what is unacceptable behaviour; this may be public for practical reasons.
+- Communicating to all participants that an incident has taken place and how we will act or have acted — this may be for the purpose of letting event participants know we are aware of and dealing with the incident.
+- Banning anyone from participating in nf-core-managed spaces, future events, and activities, either temporarily or permanently.
+- No action.
 
 ## Attribution and Acknowledgements
 
@@ -106,6 +161,22 @@ All reports will be handled with utmost discretion and confidentially.
 
 ## Changelog
 
-### v1.0 - March 12th, 2021
+### v1.4 - February 8th, 2022
+
+- Included a new member of the Safety Team. Corrected a typographical error in the text.
+
+### v1.3 - December 10th, 2021
+
+- Added a statement that the CoC applies to nf-core gather.town workspaces. Corrected typographical errors in the text.
+
+### v1.2 - November 12th, 2021
+
+- Removed information specific to reporting CoC violations at the Hackathon in October 2021.
+
+### v1.1 - October 14th, 2021
+
+- Updated with names of new Safety Officers and specific information for the hackathon in October 2021.
+
+### v1.0 - March 15th, 2021
 
 - Complete rewrite from original [Contributor Covenant](http://contributor-covenant.org/) CoC.
diff --git a/README.md b/README.md
index 68e42e20..46fbea6a 100644
--- a/README.md
+++ b/README.md
@@ -2,8 +2,8 @@
 
 [![GitHub Actions CI Status](https://github.com/nf-core/viralrecon/workflows/nf-core%20CI/badge.svg)](https://github.com/nf-core/viralrecon/actions?query=workflow%3A%22nf-core+CI%22)
 [![GitHub Actions Linting Status](https://github.com/nf-core/viralrecon/workflows/nf-core%20linting/badge.svg)](https://github.com/nf-core/viralrecon/actions?query=workflow%3A%22nf-core+linting%22)
-[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?logo=Amazon%20AWS)](https://nf-co.re/viralrecon/results)
-[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.3901628-1073c8)](https://doi.org/10.5281/zenodo.3901628)
+[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/viralrecon/results)
+[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.3901628-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.3901628)
 
 [![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A523.04.0-23aa62.svg)](https://www.nextflow.io/)
 [![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/)
@@ -85,7 +85,7 @@ A number of improvements were made to the pipeline recently, mainly with regard
 
 ## Usage
 
-> **Note**
+> [!NOTE]
 > If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how
 > to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline)
 > with `-profile test` before running the workflow on actual data.
@@ -138,6 +138,7 @@ nextflow run nf-core/viralrecon \
    --outdir <OUTDIR> \
    --platform nanopore \
    --genome 'MN908947.3' \
+   --primer_set 'artic' \
    --primer_set_version 3 \
    --fastq_dir fastq_pass/ \
    --fast5_dir fast5_pass/ \
@@ -145,9 +146,8 @@ nextflow run nf-core/viralrecon \
    -profile -profile <docker/singularity/.../institute>
 ```
 
-> **Warning:**
-> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those
-> provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_;
+> [!WARNING]
+> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_;
 > see [docs](https://nf-co.re/usage/configuration#custom-configuration-files).
 
 For more details and further functionality, please refer to the [usage documentation](https://nf-co.re/viralrecon/usage) and the [parameter documentation](https://nf-co.re/viralrecon/parameters).
diff --git a/assets/slackreport.json b/assets/slackreport.json
index 0301397d..8e3fa24d 100644
--- a/assets/slackreport.json
+++ b/assets/slackreport.json
@@ -3,7 +3,7 @@
         {
             "fallback": "Plain-text summary of the attachment.",
             "color": "<% if (success) { %>good<% } else { %>danger<%} %>",
-            "author_name": "nf-core/viralrecon v${version} - ${runName}",
+            "author_name": "nf-core/viralrecon ${version} - ${runName}",
             "author_icon": "https://www.nextflow.io/docs/latest/_static/favicon.ico",
             "text": "<% if (success) { %>Pipeline completed successfully!<% } else { %>Pipeline completed with errors<% } %>",
             "fields": [
diff --git a/conf/modules.config b/conf/modules.config
index 363e8e31..048ae623 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -38,6 +38,15 @@ process {
     }
 }
 
+    withName: 'MULTIQC' {
+        ext.args   = { params.multiqc_title ? "--title \"$params.multiqc_title\"" : '' }
+        publishDir = [
+            path: { "${params.outdir}/multiqc" },
+            mode: params.publish_dir_mode,
+            saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+        ]
+    }
+
 if (params.platform == 'nanopore') {
     includeConfig 'modules_nanopore.config'
 } else if (params.platform == 'illumina') {
diff --git a/conf/test_full_nanopore.config b/conf/test_full_nanopore.config
index ec041051..43fceae1 100644
--- a/conf/test_full_nanopore.config
+++ b/conf/test_full_nanopore.config
@@ -23,6 +23,7 @@ params {
 
     // Genome references
     genome             = 'MN908947.3'
+    primer_set         = 'artic'
     primer_set_version = 3
 
     // variant calling options
diff --git a/conf/test_nanopore.config b/conf/test_nanopore.config
index 0674e8ab..dfcc65c9 100644
--- a/conf/test_nanopore.config
+++ b/conf/test_nanopore.config
@@ -28,6 +28,7 @@ params {
 
     // Genome references
     genome             = 'MN908947.3'
+    primer_set         = 'artic'
     primer_set_version = 3
 
     // variant calling options
diff --git a/docs/output.md b/docs/output.md
index 0287e986..32f0bcda 100644
--- a/docs/output.md
+++ b/docs/output.md
@@ -964,6 +964,7 @@ A number of genome-specific files are generated by the pipeline because they are
   - Reports generated by Nextflow: `execution_report.html`, `execution_timeline.html`, `execution_trace.txt` and `pipeline_dag.dot`/`pipeline_dag.svg`.
   - Reports generated by the pipeline: `pipeline_report.html`, `pipeline_report.txt` and `software_versions.yml`. The `pipeline_report*` files will only be present if the `--email` / `--email_on_fail` parameter's are used when running the pipeline.
   - Reformatted samplesheet files used as input to the pipeline: `samplesheet.valid.csv`.
+  - Parameters used by the pipeline run: `params.json`.
 
 </details>
 
diff --git a/docs/usage.md b/docs/usage.md
index 60b3c31f..c5aacc24 100644
--- a/docs/usage.md
+++ b/docs/usage.md
@@ -18,11 +18,11 @@ You will need to create a samplesheet with information about the samples you wou
 --input '[path to samplesheet file]'
 ```
 
-The `sample` identifiers have to be the same when you have re-sequenced the same sample more than once (e.g. to increase sequencing depth). The pipeline will concatenate the raw reads before performing any downstream analysis.
+### Multiple runs of the same sample
 
-A final samplesheet file may look something like the one below. `SAMPLE_1` was sequenced twice in Illumina PE format, `SAMPLE_2` was sequenced once in Illumina SE format.
+The `sample` identifiers have to be the same when you have re-sequenced the same sample more than once e.g. to increase sequencing depth. The pipeline will concatenate the raw reads before performing any downstream analysis. Below is an example for the same sample sequenced across 3 lanes:
 
-```console
+```csv title="samplesheet.csv"
 sample,fastq_1,fastq_2
 SAMPLE_1,AEG588A1_S1_L002_R1_001.fastq.gz,AEG588A1_S1_L002_R2_001.fastq.gz
 SAMPLE_1,AEG588A1_S1_L003_R1_001.fastq.gz,AEG588A1_S1_L003_R2_001.fastq.gz
@@ -104,6 +104,7 @@ nextflow run nf-core/viralrecon \
     --outdir <OUTDIR> \
     --platform nanopore \
     --genome 'MN908947.3' \
+    --primer_set 'artic' \
     --primer_set_version 3 \
     --fastq_dir fastq_pass/ \
     --fast5_dir fast5_pass/ \
@@ -123,6 +124,7 @@ nextflow run nf-core/viralrecon \
     --outdir <OUTDIR> \
     --platform nanopore \
     --genome 'MN908947.3' \
+    --primer_set 'artic' \
     --primer_set_version 3 \
     --fastq_dir fastq_pass/ \
     --artic_minion_caller medaka \
@@ -199,7 +201,9 @@ If you wish to repeatedly use the same parameters for multiple runs, rather than
 
 Pipeline settings can be provided in a `yaml` or `json` file via `-params-file <file>`.
 
-> ⚠️ Do not use `-c <file>` to specify parameters as this will result in errors. Custom config files specified with `-c` must only be used for [tuning process resource specifications](https://nf-co.re/docs/usage/configuration#tuning-workflow-resources), other infrastructural tweaks (such as output directories), or module arguments (args).
+:::warning
+Do not use `-c <file>` to specify parameters as this will result in errors. Custom config files specified with `-c` must only be used for [tuning process resource specifications](https://nf-co.re/docs/usage/configuration#tuning-workflow-resources), other infrastructural tweaks (such as output directories), or module arguments (args).
+:::
 
 The above pipeline run specified with a params file in yaml format:
 
@@ -236,11 +240,15 @@ This version number will be logged in reports when you run the pipeline, so that
 
 To further assist in reproducbility, you can use share and re-use [parameter files](#running-the-pipeline) to repeat pipeline runs with the same settings without having to write out a command with every single parameter.
 
-> 💡 If you wish to share such profile (such as upload as supplementary material for academic publications), make sure to NOT include cluster specific paths to files, nor institutional specific profiles.
+:::tip
+If you wish to share such profile (such as upload as supplementary material for academic publications), make sure to NOT include cluster specific paths to files, nor institutional specific profiles.
+:::
 
 ## Core Nextflow arguments
 
-> **NB:** These options are part of Nextflow and use a _single_ hyphen (pipeline parameters use a double-hyphen).
+:::note
+These options are part of Nextflow and use a _single_ hyphen (pipeline parameters use a double-hyphen).
+:::
 
 ### `-profile`
 
@@ -248,7 +256,9 @@ Use this parameter to choose a configuration profile. Profiles can give configur
 
 Several generic profiles are bundled with the pipeline which instruct the pipeline to use software packaged using different methods (Docker, Singularity, Podman, Shifter, Charliecloud, Apptainer, Conda) - see below.
 
-> We highly recommend the use of Docker or Singularity containers for full pipeline reproducibility, however when this is not possible, Conda is also supported.
+:::info
+We highly recommend the use of Docker or Singularity containers for full pipeline reproducibility, however when this is not possible, Conda is also supported.
+:::
 
 The pipeline also dynamically loads configurations from [https://github.com/nf-core/configs](https://github.com/nf-core/configs) when it runs, making multiple config profiles for various institutional clusters available at run time. For more information and to see if your system is available in these configs please see the [nf-core/configs documentation](https://github.com/nf-core/configs#documentation).
 
diff --git a/lib/NfcoreTemplate.groovy b/lib/NfcoreTemplate.groovy
index 7a824e5b..2b5156b8 100755
--- a/lib/NfcoreTemplate.groovy
+++ b/lib/NfcoreTemplate.groovy
@@ -3,6 +3,8 @@
 //
 
 import org.yaml.snakeyaml.Yaml
+import groovy.json.JsonOutput
+import nextflow.extension.FilesEx
 
 class NfcoreTemplate {
 
@@ -158,12 +160,14 @@ class NfcoreTemplate {
             try {
                 if (params.plaintext_email) { throw GroovyException('Send plaintext e-mail, not HTML') }
                 // Try to send HTML e-mail using sendmail
+                def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html")
+                sendmail_tf.withWriter { w -> w << sendmail_html }
                 [ 'sendmail', '-t' ].execute() << sendmail_html
                 log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (sendmail)-"
             } catch (all) {
                 // Catch failures and try with plaintext
                 def mail_cmd = [ 'mail', '-s', subject, '--content-type=text/html', email_address ]
-                if ( mqc_report.size() <= max_multiqc_email_size.toBytes() ) {
+                if ( mqc_report != null && mqc_report.size() <= max_multiqc_email_size.toBytes() ) {
                     mail_cmd += [ '-A', mqc_report ]
                 }
                 mail_cmd.execute() << email_html
@@ -172,14 +176,16 @@ class NfcoreTemplate {
         }
 
         // Write summary e-mail HTML to a file
-        def output_d = new File("${params.outdir}/pipeline_info/")
-        if (!output_d.exists()) {
-            output_d.mkdirs()
-        }
-        def output_hf = new File(output_d, "pipeline_report.html")
+        def output_hf = new File(workflow.launchDir.toString(), ".pipeline_report.html")
         output_hf.withWriter { w -> w << email_html }
-        def output_tf = new File(output_d, "pipeline_report.txt")
+        FilesEx.copyTo(output_hf.toPath(), "${params.outdir}/pipeline_info/pipeline_report.html");
+        output_hf.delete()
+
+        // Write summary e-mail TXT to a file
+        def output_tf = new File(workflow.launchDir.toString(), ".pipeline_report.txt")
         output_tf.withWriter { w -> w << email_txt }
+        FilesEx.copyTo(output_tf.toPath(), "${params.outdir}/pipeline_info/pipeline_report.txt");
+        output_tf.delete()
     }
 
     //
@@ -240,6 +246,20 @@ class NfcoreTemplate {
         }
     }
 
+    //
+    // Dump pipeline parameters in a json file
+    //
+    public static void dump_parameters(workflow, params) {
+        def timestamp  = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss')
+        def filename   = "params_${timestamp}.json"
+        def temp_pf    = new File(workflow.launchDir.toString(), ".${filename}")
+        def jsonStr    = JsonOutput.toJson(params)
+        temp_pf.text   = JsonOutput.prettyPrint(jsonStr)
+
+        FilesEx.copyTo(temp_pf.toPath(), "${params.outdir}/pipeline_info/params_${timestamp}.json")
+        temp_pf.delete()
+    }
+
     //
     // Print pipeline summary on completion
     //
diff --git a/main.nf b/main.nf
index e51c832d..fd4468ef 100644
--- a/main.nf
+++ b/main.nf
@@ -23,7 +23,7 @@ if (params.platform == 'illumina' && params.protocol == 'amplicon') {
     primer_set         = params.primer_set
     primer_set_version = params.primer_set_version
 } else if (params.platform == 'nanopore') {
-    primer_set          = 'artic'
+    primer_set          = params.primer_set
     primer_set_version  = params.primer_set_version
     params.artic_scheme = WorkflowMain.getGenomeAttribute(params, 'scheme', log, primer_set, primer_set_version)
 }
diff --git a/modules.json b/modules.json
index e8e96aca..087c09c2 100644
--- a/modules.json
+++ b/modules.json
@@ -7,278 +7,277 @@
                 "nf-core": {
                     "abacas": {
                         "branch": "master",
-                        "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b",
+                        "git_sha": "3304b04f6022222e217bd17bc117f0babc8cbd6a",
                         "installed_by": ["modules"]
                     },
                     "artic/guppyplex": {
                         "branch": "master",
-                        "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "artic/minion": {
                         "branch": "master",
-                        "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "bandage/image": {
                         "branch": "master",
-                        "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "bcftools/consensus": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09",
                         "installed_by": ["modules"]
                     },
                     "bcftools/filter": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09",
                         "installed_by": ["modules"]
                     },
                     "bcftools/mpileup": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09",
                         "installed_by": ["modules"]
                     },
                     "bcftools/norm": {
                         "branch": "master",
-                        "git_sha": "bcad95fb35e567ad25840d3297c3e17eff211a3a",
+                        "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09",
                         "installed_by": ["modules"]
                     },
                     "bcftools/query": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09",
                         "installed_by": ["modules"]
                     },
                     "bcftools/sort": {
                         "branch": "master",
-                        "git_sha": "4a21e4cca35e72ec059abd67f790e0b192ce5d81",
+                        "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09",
                         "installed_by": ["modules"]
                     },
                     "bcftools/stats": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09",
                         "installed_by": ["modules"]
                     },
                     "bedtools/getfasta": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668",
                         "installed_by": ["modules"]
                     },
                     "bedtools/maskfasta": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668",
                         "installed_by": ["modules"]
                     },
                     "bedtools/merge": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668",
                         "installed_by": ["modules"]
                     },
                     "blast/blastn": {
                         "branch": "master",
-                        "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180",
+                        "git_sha": "f0d13ae7e1f9b24a705764f8673af859268d7077",
                         "installed_by": ["modules"]
                     },
                     "blast/makeblastdb": {
                         "branch": "master",
-                        "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "bowtie2/align": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "3c77ca9aac783e76c3614a06db3bfe4fef619bde",
                         "installed_by": ["fastq_align_bowtie2"]
                     },
                     "bowtie2/build": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "1fea64f5132a813ec97c1c6d3a74e0aee7142b6d",
                         "installed_by": ["modules"]
                     },
                     "cat/fastq": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "custom/dumpsoftwareversions": {
                         "branch": "master",
-                        "git_sha": "05c280924b6c768d484c7c443dad5e605c4ff4b4",
-                        "installed_by": ["modules"],
-                        "patch": "modules/nf-core/custom/dumpsoftwareversions/custom-dumpsoftwareversions.diff"
+                        "git_sha": "bba7e362e4afead70653f84d8700588ea28d0f9e",
+                        "installed_by": ["modules"]
                     },
                     "custom/getchromsizes": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "fastp": {
                         "branch": "master",
-                        "git_sha": "20a508676f40d0fd3f911ac595af91ec845704c4",
+                        "git_sha": "d086322563bdbb08c94bf15a7db58a39ccdb1520",
                         "installed_by": ["modules"]
                     },
                     "fastqc": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "65ad3e0b9a4099592e1102e92e10455dc661cf53",
                         "installed_by": ["modules"]
                     },
                     "freyja/boot": {
                         "branch": "master",
-                        "git_sha": "281c744ed84352c24697f0916c7744853ce83927",
+                        "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243",
                         "installed_by": ["bam_variant_demix_boot_freyja"]
                     },
                     "freyja/demix": {
                         "branch": "master",
-                        "git_sha": "4bb5cb441e89811385d18a90809ecf36c9daafd8",
+                        "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243",
                         "installed_by": ["bam_variant_demix_boot_freyja"]
                     },
                     "freyja/update": {
                         "branch": "master",
-                        "git_sha": "4bb5cb441e89811385d18a90809ecf36c9daafd8",
+                        "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243",
                         "installed_by": ["bam_variant_demix_boot_freyja"]
                     },
                     "freyja/variants": {
                         "branch": "master",
-                        "git_sha": "4bb5cb441e89811385d18a90809ecf36c9daafd8",
+                        "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243",
                         "installed_by": ["bam_variant_demix_boot_freyja"]
                     },
                     "gunzip": {
                         "branch": "master",
-                        "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "ivar/consensus": {
                         "branch": "master",
-                        "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "ivar/trim": {
                         "branch": "master",
-                        "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "ivar/variants": {
                         "branch": "master",
-                        "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "kraken2/kraken2": {
                         "branch": "master",
-                        "git_sha": "7c695e0147df1157413e06246d9b0094617d3e6b",
+                        "git_sha": "d6549f46c3c1c3fe3def110f3d18059a68a65cc6",
                         "installed_by": ["modules"]
                     },
                     "minia": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "mosdepth": {
                         "branch": "master",
-                        "git_sha": "def5f182583df0c20f43ec3d4355e8ebd341aaa9",
+                        "git_sha": "69e3eb17fb31b772b18f134d6e8f8b93ee980e65",
                         "installed_by": ["modules"]
                     },
                     "nanoplot": {
                         "branch": "master",
-                        "git_sha": "3822e04e49b6d89b7092feb3480d744cb5d9986b",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "nextclade/datasetget": {
                         "branch": "master",
-                        "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "nextclade/run": {
                         "branch": "master",
-                        "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "pangolin": {
                         "branch": "master",
-                        "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "picard/collectmultiplemetrics": {
                         "branch": "master",
-                        "git_sha": "75027bf77472b1f4fd2cdd7e46f83119dfb0f2c6",
+                        "git_sha": "20b0918591d4ba20047d7e13e5094bcceba81447",
                         "installed_by": ["modules"]
                     },
                     "picard/markduplicates": {
                         "branch": "master",
-                        "git_sha": "75027bf77472b1f4fd2cdd7e46f83119dfb0f2c6",
+                        "git_sha": "20b0918591d4ba20047d7e13e5094bcceba81447",
                         "installed_by": ["bam_markduplicates_picard"]
                     },
                     "plasmidid": {
                         "branch": "master",
-                        "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "pycoqc": {
                         "branch": "master",
-                        "git_sha": "cb8a5428685f490d0295563b1b0c3a239bbe1927",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "quast": {
                         "branch": "master",
-                        "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "samtools/flagstat": {
                         "branch": "master",
-                        "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b",
+                        "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
                         "installed_by": ["bam_stats_samtools"]
                     },
                     "samtools/idxstats": {
                         "branch": "master",
-                        "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b",
+                        "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
                         "installed_by": ["bam_stats_samtools"]
                     },
                     "samtools/index": {
                         "branch": "master",
-                        "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b",
+                        "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
                         "installed_by": ["bam_markduplicates_picard", "bam_sort_stats_samtools"]
                     },
                     "samtools/sort": {
                         "branch": "master",
-                        "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b",
+                        "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
                         "installed_by": ["bam_sort_stats_samtools"]
                     },
                     "samtools/stats": {
                         "branch": "master",
-                        "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b",
+                        "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
                         "installed_by": ["bam_stats_samtools"]
                     },
                     "samtools/view": {
                         "branch": "master",
-                        "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b",
+                        "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
                         "installed_by": ["modules"]
                     },
                     "spades": {
                         "branch": "master",
-                        "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "tabix/bgzip": {
                         "branch": "master",
-                        "git_sha": "90294980a903ecebd99ac31d8b6c66af48fa8259",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "tabix/tabix": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "unicycler": {
                         "branch": "master",
-                        "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "untar": {
                         "branch": "master",
-                        "git_sha": "cc1f997fab6d8fde5dc0e6e2a310814df5b53ce7",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     },
                     "vcflib/vcfuniq": {
                         "branch": "master",
-                        "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b",
+                        "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
                         "installed_by": ["modules"]
                     }
                 }
@@ -287,27 +286,27 @@
                 "nf-core": {
                     "bam_markduplicates_picard": {
                         "branch": "master",
-                        "git_sha": "dedc0e31087f3306101c38835d051bf49789445a",
+                        "git_sha": "eeb9d37c6c8b0ab864b8fe68aa6531c5b2beba01",
                         "installed_by": ["subworkflows"]
                     },
                     "bam_sort_stats_samtools": {
                         "branch": "master",
-                        "git_sha": "dedc0e31087f3306101c38835d051bf49789445a",
+                        "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
                         "installed_by": ["fastq_align_bowtie2"]
                     },
                     "bam_stats_samtools": {
                         "branch": "master",
-                        "git_sha": "dedc0e31087f3306101c38835d051bf49789445a",
+                        "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c",
                         "installed_by": ["bam_markduplicates_picard", "bam_sort_stats_samtools"]
                     },
                     "bam_variant_demix_boot_freyja": {
                         "branch": "master",
-                        "git_sha": "dedc0e31087f3306101c38835d051bf49789445a",
+                        "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f",
                         "installed_by": ["subworkflows"]
                     },
                     "fastq_align_bowtie2": {
                         "branch": "master",
-                        "git_sha": "dedc0e31087f3306101c38835d051bf49789445a",
+                        "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f",
                         "installed_by": ["subworkflows"]
                     }
                 }
diff --git a/modules/local/filter_blastn.nf b/modules/local/filter_blastn.nf
index 0328a037..a11a2d97 100644
--- a/modules/local/filter_blastn.nf
+++ b/modules/local/filter_blastn.nf
@@ -5,7 +5,7 @@ process FILTER_BLASTN {
     conda "conda-forge::sed=4.7"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/ubuntu:20.04' :
-        'ubuntu:20.04' }"
+        'nf-core/ubuntu:20.04' }"
 
     input:
     tuple val(meta), path(hits)
diff --git a/modules/local/rename_fasta_header.nf b/modules/local/rename_fasta_header.nf
index d42e5f11..1fc86a30 100644
--- a/modules/local/rename_fasta_header.nf
+++ b/modules/local/rename_fasta_header.nf
@@ -4,7 +4,7 @@ process RENAME_FASTA_HEADER {
     conda "conda-forge::sed=4.7"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/ubuntu:20.04' :
-        'ubuntu:20.04' }"
+        'nf-core/ubuntu:20.04' }"
 
     input:
     tuple val(meta), path(fasta)
diff --git a/modules/nf-core/abacas/environment.yml b/modules/nf-core/abacas/environment.yml
new file mode 100644
index 00000000..c1379190
--- /dev/null
+++ b/modules/nf-core/abacas/environment.yml
@@ -0,0 +1,7 @@
+name: abacas
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::abacas=1.3.1
diff --git a/modules/nf-core/abacas/main.nf b/modules/nf-core/abacas/main.nf
index beabc45b..d0b04415 100644
--- a/modules/nf-core/abacas/main.nf
+++ b/modules/nf-core/abacas/main.nf
@@ -2,10 +2,10 @@ process ABACAS {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::abacas=1.3.1"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/abacas:1.3.1--pl526_0' :
-        'quay.io/biocontainers/abacas:1.3.1--pl526_0' }"
+        'biocontainers/abacas:1.3.1--pl526_0' }"
 
     input:
     tuple val(meta), path(scaffold)
diff --git a/modules/nf-core/abacas/meta.yml b/modules/nf-core/abacas/meta.yml
index 3bab9b22..bef9868c 100644
--- a/modules/nf-core/abacas/meta.yml
+++ b/modules/nf-core/abacas/meta.yml
@@ -12,10 +12,8 @@ tools:
         contigs based on a reference sequence.
       homepage: http://abacas.sourceforge.net/documentation.html
       documentation: http://abacas.sourceforge.net/documentation.html
-
       doi: "10.1093/bioinformatics/btp347"
       licence: ["GPL v2-or-later"]
-
 input:
   - meta:
       type: map
@@ -30,7 +28,6 @@ input:
       type: file
       description: FASTA reference file
       pattern: "*.{fasta,fa}"
-
 output:
   - meta:
       type: map
@@ -38,7 +35,7 @@ output:
         Groovy Map containing sample information
         e.g. [ id:'test', single_end:false ]
   - results:
-      type: files
+      type: file
       description: |
         List containing abacas output files
         [ 'test.abacas.bin', 'test.abacas.fasta', 'test.abacas.gaps',
@@ -47,12 +44,13 @@ output:
         'test.abacas.tab', 'test.abacas.unused.contigs.out',
         'test.abacas.MULTIFASTA.fa' ]
       pattern: "*.{abacas}*"
-
   - versions:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
diff --git a/modules/nf-core/abacas/tests/main.nf.test b/modules/nf-core/abacas/tests/main.nf.test
new file mode 100644
index 00000000..86f056ed
--- /dev/null
+++ b/modules/nf-core/abacas/tests/main.nf.test
@@ -0,0 +1,46 @@
+nextflow_process {
+
+    name "Test Process ABACAS"
+    script "../main.nf"
+    process "ABACAS"
+    config "./nextflow.config"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "abacas"
+
+    test("sarscov2 [scaffolds_fasta] [genome_fasta]") {
+
+        when {
+            process {
+                """
+                input[0] = [ [ id:'test', single_end:false ], // meta map
+                             file(params.test_data['sarscov2']['illumina']['scaffolds_fasta'], checkIfExists: true)
+                           ]
+                input[1] = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out.results[0][1].findAll {
+                    file(it).name != "test.abacas.bin" &&
+                    file(it).name != "test.abacas.nucmer.delta" &&
+                    file(it).name != "test.abacas.unused.contigs.out" &&
+                    file(it).name != "test.abacas.nucmer.filtered.delta"  }).match()},
+                { assert file(process.out.results[0][1].find {
+                    file(it).name == "test.abacas.bin" }).exists() },
+                { assert file(process.out.results[0][1].find {
+                    file(it).name == "test.abacas.nucmer.delta" }).exists() },
+                { assert file(process.out.results[0][1].find {
+                    file(it).name == "test.abacas.unused.contigs.out" }).exists() },
+                { assert file(process.out.results[0][1].find {
+                    file(it).name == "test.abacas.nucmer.filtered.delta" }).exists() },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/abacas/tests/main.nf.test.snap b/modules/nf-core/abacas/tests/main.nf.test.snap
new file mode 100644
index 00000000..34d7ef68
--- /dev/null
+++ b/modules/nf-core/abacas/tests/main.nf.test.snap
@@ -0,0 +1,24 @@
+{
+    "sarscov2 [scaffolds_fasta] [genome_fasta]": {
+        "content": [
+            [
+                "test.abacas.MULTIFASTA.fa:md5,46c899ad70dcef8d14b5829fd8fbab82",
+                "test.abacas.crunch:md5,9a95358a9bd8ee97d1f2253d95623a17",
+                "test.abacas.fasta:md5,5e6c403d3850d52f6bde956fa2403b13",
+                "test.abacas.gaps:md5,5361af445b8d18a85c3af6527a97c89a",
+                "test.abacas.gaps.tab:md5,193024ec9e5a553573519b218eb06e29",
+                "test.abacas.nucmer.tiling:md5,0adaa0ce800d92c149a523d447148d95",
+                "test.abacas.tab:md5,a5b9b452516f519a4201ff809655ef69"
+            ]
+        ],
+        "timestamp": "2023-11-24T23:10:40.830744514"
+    },
+    "versions": {
+        "content": [
+            [
+                "versions.yml:md5,dac92f544d3e3ff9e5faae9b332dfab4"
+            ]
+        ],
+        "timestamp": "2023-11-24T23:35:57.275724471"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/abacas/tests/nextflow.config b/modules/nf-core/abacas/tests/nextflow.config
new file mode 100644
index 00000000..17296503
--- /dev/null
+++ b/modules/nf-core/abacas/tests/nextflow.config
@@ -0,0 +1,9 @@
+process {
+
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+
+    withName: ABACAS {
+        ext.args = '-m -p nucmer'
+    }
+
+}
diff --git a/modules/nf-core/abacas/tests/tags.yml b/modules/nf-core/abacas/tests/tags.yml
new file mode 100644
index 00000000..5751a360
--- /dev/null
+++ b/modules/nf-core/abacas/tests/tags.yml
@@ -0,0 +1,2 @@
+abacas:
+  - modules/nf-core/abacas/**
diff --git a/modules/nf-core/artic/guppyplex/environment.yml b/modules/nf-core/artic/guppyplex/environment.yml
new file mode 100644
index 00000000..19176850
--- /dev/null
+++ b/modules/nf-core/artic/guppyplex/environment.yml
@@ -0,0 +1,7 @@
+name: artic_guppyplex
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::artic=1.2.3
diff --git a/modules/nf-core/artic/guppyplex/main.nf b/modules/nf-core/artic/guppyplex/main.nf
index 9be33484..7259ef44 100644
--- a/modules/nf-core/artic/guppyplex/main.nf
+++ b/modules/nf-core/artic/guppyplex/main.nf
@@ -2,10 +2,10 @@ process ARTIC_GUPPYPLEX {
     tag "$meta.id"
     label 'process_high'
 
-    conda "bioconda::artic=1.2.3"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/artic:1.2.3--pyhdfd78af_0' :
-        'quay.io/biocontainers/artic:1.2.3--pyhdfd78af_0' }"
+        'biocontainers/artic:1.2.3--pyhdfd78af_0' }"
 
     input:
     tuple val(meta), path(fastq_dir)
diff --git a/modules/nf-core/artic/guppyplex/meta.yml b/modules/nf-core/artic/guppyplex/meta.yml
index e8edc8f3..80a1d999 100644
--- a/modules/nf-core/artic/guppyplex/meta.yml
+++ b/modules/nf-core/artic/guppyplex/meta.yml
@@ -10,9 +10,7 @@ tools:
       homepage: https://artic.readthedocs.io/en/latest/
       documentation: https://artic.readthedocs.io/en/latest/
       tool_dev_url: https://github.com/artic-network/fieldbioinformatics
-
       licence: ["MIT"]
-
 input:
   - meta:
       type: map
@@ -23,7 +21,6 @@ input:
       type: directory
       description: Directory containing the fastq files with demultiplexed reads
       pattern: "*"
-
 output:
   - meta:
       type: map
@@ -38,7 +35,9 @@ output:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
diff --git a/modules/nf-core/artic/minion/environment.yml b/modules/nf-core/artic/minion/environment.yml
new file mode 100644
index 00000000..5123f82c
--- /dev/null
+++ b/modules/nf-core/artic/minion/environment.yml
@@ -0,0 +1,7 @@
+name: artic_minion
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::artic=1.2.3
diff --git a/modules/nf-core/artic/minion/main.nf b/modules/nf-core/artic/minion/main.nf
index 429a107d..8559bd75 100644
--- a/modules/nf-core/artic/minion/main.nf
+++ b/modules/nf-core/artic/minion/main.nf
@@ -2,10 +2,10 @@ process ARTIC_MINION {
     tag "$meta.id"
     label 'process_high'
 
-    conda "bioconda::artic=1.2.3"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/artic:1.2.3--pyhdfd78af_0' :
-        'quay.io/biocontainers/artic:1.2.3--pyhdfd78af_0' }"
+        'biocontainers/artic:1.2.3--pyhdfd78af_0' }"
 
     input:
     tuple val(meta), path(fastq)
diff --git a/modules/nf-core/artic/minion/meta.yml b/modules/nf-core/artic/minion/meta.yml
index 8ccf8434..9092edd3 100644
--- a/modules/nf-core/artic/minion/meta.yml
+++ b/modules/nf-core/artic/minion/meta.yml
@@ -11,7 +11,6 @@ tools:
       homepage: https://artic.readthedocs.io/en/latest/
       documentation: https://artic.readthedocs.io/en/latest/
       tool_dev_url: https://github.com/artic-network/fieldbioinformatics
-
       licence: ["MIT"]
 input:
   - meta:
@@ -112,7 +111,9 @@ output:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
diff --git a/modules/nf-core/bandage/image/environment.yml b/modules/nf-core/bandage/image/environment.yml
new file mode 100644
index 00000000..61558105
--- /dev/null
+++ b/modules/nf-core/bandage/image/environment.yml
@@ -0,0 +1,7 @@
+name: bandage_image
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::bandage=0.8.1
diff --git a/modules/nf-core/bandage/image/main.nf b/modules/nf-core/bandage/image/main.nf
index e4da7336..f6801d0a 100644
--- a/modules/nf-core/bandage/image/main.nf
+++ b/modules/nf-core/bandage/image/main.nf
@@ -2,10 +2,10 @@ process BANDAGE_IMAGE {
     tag "${meta.id}"
     label 'process_low'
 
-    conda "bioconda::bandage=0.8.1"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/bandage:0.8.1--hc9558a2_2' :
-        'quay.io/biocontainers/bandage:0.8.1--hc9558a2_2' }"
+        'biocontainers/bandage:0.8.1--hc9558a2_2' }"
 
     input:
     tuple val(meta), path(gfa)
diff --git a/modules/nf-core/bandage/image/meta.yml b/modules/nf-core/bandage/image/meta.yml
index e68d8c98..94ce8a80 100644
--- a/modules/nf-core/bandage/image/meta.yml
+++ b/modules/nf-core/bandage/image/meta.yml
@@ -42,3 +42,5 @@ output:
       pattern: "versions.yml"
 authors:
   - "@heuermh"
+maintainers:
+  - "@heuermh"
diff --git a/modules/nf-core/bcftools/consensus/environment.yml b/modules/nf-core/bcftools/consensus/environment.yml
new file mode 100644
index 00000000..4217d8c1
--- /dev/null
+++ b/modules/nf-core/bcftools/consensus/environment.yml
@@ -0,0 +1,7 @@
+name: bcftools_consensus
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::bcftools=1.18
diff --git a/modules/nf-core/bcftools/consensus/main.nf b/modules/nf-core/bcftools/consensus/main.nf
index a32d94b1..9e167b9f 100644
--- a/modules/nf-core/bcftools/consensus/main.nf
+++ b/modules/nf-core/bcftools/consensus/main.nf
@@ -2,10 +2,10 @@ process BCFTOOLS_CONSENSUS {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::bcftools=1.16"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/bcftools:1.16--hfe4b78e_1':
-        'quay.io/biocontainers/bcftools:1.16--hfe4b78e_1' }"
+        'https://depot.galaxyproject.org/singularity/bcftools:1.18--h8b25389_0':
+        'biocontainers/bcftools:1.18--h8b25389_0' }"
 
     input:
     tuple val(meta), path(vcf), path(tbi), path(fasta)
diff --git a/modules/nf-core/bcftools/consensus/meta.yml b/modules/nf-core/bcftools/consensus/meta.yml
index 05a93a56..3b43c808 100644
--- a/modules/nf-core/bcftools/consensus/meta.yml
+++ b/modules/nf-core/bcftools/consensus/meta.yml
@@ -47,3 +47,6 @@ output:
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
diff --git a/modules/nf-core/bcftools/filter/environment.yml b/modules/nf-core/bcftools/filter/environment.yml
new file mode 100644
index 00000000..b2698757
--- /dev/null
+++ b/modules/nf-core/bcftools/filter/environment.yml
@@ -0,0 +1,7 @@
+name: bcftools_filter
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::bcftools=1.18
diff --git a/modules/nf-core/bcftools/filter/main.nf b/modules/nf-core/bcftools/filter/main.nf
index 4e02009d..1a40cb93 100644
--- a/modules/nf-core/bcftools/filter/main.nf
+++ b/modules/nf-core/bcftools/filter/main.nf
@@ -2,17 +2,17 @@ process BCFTOOLS_FILTER {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::bcftools=1.16"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/bcftools:1.16--hfe4b78e_1':
-        'quay.io/biocontainers/bcftools:1.16--hfe4b78e_1' }"
+        'https://depot.galaxyproject.org/singularity/bcftools:1.18--h8b25389_0':
+        'biocontainers/bcftools:1.18--h8b25389_0' }"
 
     input:
     tuple val(meta), path(vcf)
 
     output:
-    tuple val(meta), path("*.gz"), emit: vcf
-    path  "versions.yml"         , emit: versions
+    tuple val(meta), path("*.${extension}"), emit: vcf
+    path  "versions.yml"                   , emit: versions
 
     when:
     task.ext.when == null || task.ext.when
@@ -20,9 +20,19 @@ process BCFTOOLS_FILTER {
     script:
     def args = task.ext.args ?: ''
     def prefix = task.ext.prefix ?: "${meta.id}"
+
+    extension = args.contains("--output-type b") || args.contains("-Ob") ? "bcf.gz" :
+                    args.contains("--output-type u") || args.contains("-Ou") ? "bcf" :
+                    args.contains("--output-type z") || args.contains("-Oz") ? "vcf.gz" :
+                    args.contains("--output-type v") || args.contains("-Ov") ? "vcf" :
+                    "vcf"
+
+    if ("$vcf" == "${prefix}.${extension}") error "Input and output names are the same, set prefix in module configuration to disambiguate!"
+
     """
     bcftools filter \\
-        --output ${prefix}.vcf.gz \\
+        --output ${prefix}.${extension} \\
+        --threads ${task.cpus} \\
         $args \\
         $vcf
 
@@ -35,8 +45,16 @@ process BCFTOOLS_FILTER {
     stub:
     def prefix = task.ext.prefix ?: "${meta.id}"
 
+    extension = args.contains("--output-type b") || args.contains("-Ob") ? "bcf.gz" :
+                    args.contains("--output-type u") || args.contains("-Ou") ? "bcf" :
+                    args.contains("--output-type z") || args.contains("-Oz") ? "vcf.gz" :
+                    args.contains("--output-type v") || args.contains("-Ov") ? "vcf" :
+                    "vcf"
+
+    if ("$vcf" == "${prefix}.${extension}") error "Input and output names are the same, set prefix in module configuration to disambiguate!"
+
     """
-    touch ${prefix}.vcf.gz
+    touch ${prefix}.${extension}
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
diff --git a/modules/nf-core/bcftools/filter/meta.yml b/modules/nf-core/bcftools/filter/meta.yml
index 05a6d828..5b111fc3 100644
--- a/modules/nf-core/bcftools/filter/meta.yml
+++ b/modules/nf-core/bcftools/filter/meta.yml
@@ -39,3 +39,6 @@ output:
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
diff --git a/modules/nf-core/bcftools/mpileup/environment.yml b/modules/nf-core/bcftools/mpileup/environment.yml
new file mode 100644
index 00000000..114390be
--- /dev/null
+++ b/modules/nf-core/bcftools/mpileup/environment.yml
@@ -0,0 +1,7 @@
+name: bcftools_mpileup
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::bcftools=1.18
diff --git a/modules/nf-core/bcftools/mpileup/main.nf b/modules/nf-core/bcftools/mpileup/main.nf
index c9e42c4d..5e57644a 100644
--- a/modules/nf-core/bcftools/mpileup/main.nf
+++ b/modules/nf-core/bcftools/mpileup/main.nf
@@ -2,14 +2,14 @@ process BCFTOOLS_MPILEUP {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::bcftools=1.16"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/bcftools:1.16--hfe4b78e_1':
-        'quay.io/biocontainers/bcftools:1.16--hfe4b78e_1' }"
+        'https://depot.galaxyproject.org/singularity/bcftools:1.18--h8b25389_0':
+        'biocontainers/bcftools:1.18--h8b25389_0' }"
 
     input:
     tuple val(meta), path(bam), path(intervals)
-    path fasta
+    tuple val(meta2), path(fasta)
     val save_mpileup
 
     output:
diff --git a/modules/nf-core/bcftools/mpileup/meta.yml b/modules/nf-core/bcftools/mpileup/meta.yml
index 5619a6f5..65410ddd 100644
--- a/modules/nf-core/bcftools/mpileup/meta.yml
+++ b/modules/nf-core/bcftools/mpileup/meta.yml
@@ -25,6 +25,10 @@ input:
   - intervals:
       type: file
       description: Input intervals file. A file (commonly '.bed') containing regions to subset
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing information about the genome fasta, e.g. [ id: 'sarscov2' ]
   - fasta:
       type: file
       description: FASTA reference file
@@ -61,3 +65,6 @@ output:
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
diff --git a/modules/nf-core/bcftools/mpileup/tests/main.nf.test b/modules/nf-core/bcftools/mpileup/tests/main.nf.test
new file mode 100644
index 00000000..6478bbc2
--- /dev/null
+++ b/modules/nf-core/bcftools/mpileup/tests/main.nf.test
@@ -0,0 +1,116 @@
+nextflow_process {
+
+    name "Test Process BCFTOOLS_MPILEUP"
+    script "../main.nf"
+    process "BCFTOOLS_MPILEUP"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "bcftools"
+    tag "bcftools/mpileup"
+
+    config "./nextflow.config"
+
+    test("sarscov2 - [bam, []], fasta, false") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+                    []
+                ]
+                input[1] = [
+                    [ id:'sarscov2' ], // meta map
+                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                ]
+                input[2] = false
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    process.out.vcf,
+                    process.out.tbi,
+                    process.out.stats,
+                    process.out.mpileup,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - [bam, []], fasta, true") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+                    []
+                ]
+                input[1] = [
+                    [ id:'sarscov2' ], // meta map
+                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                ]
+                input[2] = true
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    process.out.vcf,
+                    process.out.tbi,
+                    process.out.stats,
+                    process.out.mpileup,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - [bam, bed], fasta, false") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+                    file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true)
+                ]
+                input[1] = [
+                    [ id:'sarscov2' ], // meta map
+                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                ]
+                input[2] = false
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    process.out.vcf,
+                    process.out.tbi,
+                    process.out.stats,
+                    process.out.mpileup,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/bcftools/mpileup/tests/main.nf.test.snap b/modules/nf-core/bcftools/mpileup/tests/main.nf.test.snap
new file mode 100644
index 00000000..ef80ab1b
--- /dev/null
+++ b/modules/nf-core/bcftools/mpileup/tests/main.nf.test.snap
@@ -0,0 +1,112 @@
+{
+    "sarscov2 - [bam, []], fasta, true": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "test.vcf.gz:md5,0f2f2c8488e97e7f13979380d5d3b6b5"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "test.vcf.gz.tbi:md5,34cb2eeb73f4d2b98218acecebd92704"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "test.bcftools_stats.txt:md5,a988fbcd2ea5d1ce30970dcb60a77ed7"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "test.mpileup.gz:md5,73b4a00398bddab2cd065b40d17ca4dc"
+                ]
+            ],
+            [
+                "versions.yml:md5,e09c59d941374bb293aadc36e2f29dbf"
+            ]
+        ],
+        "timestamp": "2023-11-29T14:11:54.549517279"
+    },
+    "sarscov2 - [bam, bed], fasta, false": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "test.vcf.gz:md5,687244dbf71d05b3b973ab08ecf05310"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "test.vcf.gz.tbi:md5,3785df15f3d7faf35f3ad70d167a50f7"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "test.bcftools_stats.txt:md5,f8c5ab149c4bf0e5f51c518346cb87b5"
+                ]
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,e09c59d941374bb293aadc36e2f29dbf"
+            ]
+        ],
+        "timestamp": "2023-11-29T14:12:00.865439661"
+    },
+    "sarscov2 - [bam, []], fasta, false": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "test.vcf.gz:md5,0f2f2c8488e97e7f13979380d5d3b6b5"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "test.vcf.gz.tbi:md5,34cb2eeb73f4d2b98218acecebd92704"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "test.bcftools_stats.txt:md5,a988fbcd2ea5d1ce30970dcb60a77ed7"
+                ]
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,e09c59d941374bb293aadc36e2f29dbf"
+            ]
+        ],
+        "timestamp": "2023-11-29T14:11:47.814900494"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/bcftools/mpileup/tests/nextflow.config b/modules/nf-core/bcftools/mpileup/tests/nextflow.config
new file mode 100644
index 00000000..a7ba19fe
--- /dev/null
+++ b/modules/nf-core/bcftools/mpileup/tests/nextflow.config
@@ -0,0 +1,4 @@
+process {
+    ext.args2 = '--no-version --ploidy 1 --multiallelic-caller'
+    ext.args3 = '--no-version'
+}
\ No newline at end of file
diff --git a/modules/nf-core/bcftools/mpileup/tests/tags.yml b/modules/nf-core/bcftools/mpileup/tests/tags.yml
new file mode 100644
index 00000000..07b91f98
--- /dev/null
+++ b/modules/nf-core/bcftools/mpileup/tests/tags.yml
@@ -0,0 +1,2 @@
+bcftools/mpileup:
+  - "modules/nf-core/bcftools/mpileup/**"
diff --git a/modules/nf-core/bcftools/norm/environment.yml b/modules/nf-core/bcftools/norm/environment.yml
new file mode 100644
index 00000000..fe80e4e7
--- /dev/null
+++ b/modules/nf-core/bcftools/norm/environment.yml
@@ -0,0 +1,7 @@
+name: bcftools_norm
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::bcftools=1.18
diff --git a/modules/nf-core/bcftools/norm/main.nf b/modules/nf-core/bcftools/norm/main.nf
index 90387d6c..47d3dab1 100644
--- a/modules/nf-core/bcftools/norm/main.nf
+++ b/modules/nf-core/bcftools/norm/main.nf
@@ -2,14 +2,14 @@ process BCFTOOLS_NORM {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::bcftools=1.16"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/bcftools:1.16--hfe4b78e_1':
-        'quay.io/biocontainers/bcftools:1.16--hfe4b78e_1' }"
+        'https://depot.galaxyproject.org/singularity/bcftools:1.18--h8b25389_0':
+        'biocontainers/bcftools:1.18--h8b25389_0' }"
 
     input:
     tuple val(meta), path(vcf), path(tbi)
-    path(fasta)
+    tuple val(meta2), path(fasta)
 
     output:
     tuple val(meta), path("*.{vcf,vcf.gz,bcf,bcf.gz}")  , emit: vcf
diff --git a/modules/nf-core/bcftools/norm/meta.yml b/modules/nf-core/bcftools/norm/meta.yml
index c3ea2c03..1f3e1b62 100644
--- a/modules/nf-core/bcftools/norm/meta.yml
+++ b/modules/nf-core/bcftools/norm/meta.yml
@@ -30,6 +30,11 @@ input:
       description: |
         An optional index of the VCF file (for when the VCF is compressed)
       pattern: "*.vcf.gz.tbi"
+  - meta2:
+      type: map
+      description: |
+        Groovy Map containing reference information
+        e.g. [ id:'genome' ]
   - fasta:
       type: file
       description: FASTA reference file
@@ -50,3 +55,7 @@ output:
       pattern: "versions.yml"
 authors:
   - "@abhi18av"
+  - "@ramprasadn"
+maintainers:
+  - "@abhi18av"
+  - "@ramprasadn"
diff --git a/modules/nf-core/bcftools/query/environment.yml b/modules/nf-core/bcftools/query/environment.yml
new file mode 100644
index 00000000..4f9661ca
--- /dev/null
+++ b/modules/nf-core/bcftools/query/environment.yml
@@ -0,0 +1,7 @@
+name: bcftools_query
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::bcftools=1.18
diff --git a/modules/nf-core/bcftools/query/main.nf b/modules/nf-core/bcftools/query/main.nf
index 5a917b3e..e9e73a6a 100644
--- a/modules/nf-core/bcftools/query/main.nf
+++ b/modules/nf-core/bcftools/query/main.nf
@@ -1,11 +1,11 @@
 process BCFTOOLS_QUERY {
     tag "$meta.id"
-    label 'process_medium'
+    label 'process_single'
 
-    conda "bioconda::bcftools=1.16"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/bcftools:1.16--hfe4b78e_1':
-        'quay.io/biocontainers/bcftools:1.16--hfe4b78e_1' }"
+        'https://depot.galaxyproject.org/singularity/bcftools:1.18--h8b25389_0':
+        'biocontainers/bcftools:1.18--h8b25389_0' }"
 
     input:
     tuple val(meta), path(vcf), path(tbi)
@@ -14,8 +14,8 @@ process BCFTOOLS_QUERY {
     path samples
 
     output:
-    tuple val(meta), path("*.txt"), emit: txt
-    path "versions.yml"           , emit: versions
+    tuple val(meta), path("*.${suffix}"), emit: output
+    path "versions.yml"                 , emit: versions
 
     when:
     task.ext.when == null || task.ext.when
@@ -23,17 +23,30 @@ process BCFTOOLS_QUERY {
     script:
     def args = task.ext.args ?: ''
     def prefix = task.ext.prefix ?: "${meta.id}"
+    suffix = task.ext.suffix ?: "txt"
     def regions_file = regions ? "--regions-file ${regions}" : ""
     def targets_file = targets ? "--targets-file ${targets}" : ""
     def samples_file =  samples ? "--samples-file ${samples}" : ""
     """
     bcftools query \\
-        --output ${prefix}.txt \\
         $regions_file \\
         $targets_file \\
         $samples_file \\
         $args \\
-        $vcf
+        $vcf \\
+        > ${prefix}.${suffix}
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        bcftools: \$(bcftools --version 2>&1 | head -n1 | sed 's/^.*bcftools //; s/ .*\$//')
+    END_VERSIONS
+    """
+
+    stub:
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    suffix = task.ext.suffix ?: "txt"
+    """
+    touch ${prefix}.${suffix} \\
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
diff --git a/modules/nf-core/bcftools/query/meta.yml b/modules/nf-core/bcftools/query/meta.yml
index fd4fd473..303ef610 100644
--- a/modules/nf-core/bcftools/query/meta.yml
+++ b/modules/nf-core/bcftools/query/meta.yml
@@ -48,10 +48,9 @@ output:
       description: |
         Groovy Map containing sample information
         e.g. [ id:'test', single_end:false ]
-  - txt:
+  - output:
       type: file
       description: BCFTools query output file
-      pattern: "*.txt"
   - versions:
       type: file
       description: File containing software versions
@@ -59,3 +58,6 @@ output:
 authors:
   - "@abhi18av"
   - "@drpatelh"
+maintainers:
+  - "@abhi18av"
+  - "@drpatelh"
diff --git a/modules/nf-core/bcftools/query/tests/main.nf.test b/modules/nf-core/bcftools/query/tests/main.nf.test
new file mode 100644
index 00000000..e9ea5a9d
--- /dev/null
+++ b/modules/nf-core/bcftools/query/tests/main.nf.test
@@ -0,0 +1,101 @@
+nextflow_process {
+
+    name "Test Process BCFTOOLS_QUERY"
+    script "../main.nf"
+    process "BCFTOOLS_QUERY"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "bcftools"
+    tag "bcftools/query"
+
+    config "./nextflow.config"
+
+    test("sarscov2 - [vcf, tbi], [], [], []") {
+
+        when {
+            process {
+                """
+                input[0] = [ 
+                    [ id:'out' ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
+                    file(params.test_data['sarscov2']['illumina']['test_vcf_gz_tbi'], checkIfExists: true)
+                ]
+                input[1] = []
+                input[2] = []
+                input[3] = []
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    process.out.output,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - [vcf, tbi], vcf, tsv, []") {
+
+        when {
+            process {
+                """
+                input[0] = [ 
+                    [ id:'out' ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
+                    file(params.test_data['sarscov2']['illumina']['test_vcf_gz_tbi'], checkIfExists: true)
+                ]
+                input[1] = file(params.test_data['sarscov2']['illumina']['test3_vcf_gz'], checkIfExists: true)
+                input[2] = file(params.test_data['sarscov2']['illumina']['test2_vcf_targets_tsv_gz'], checkIfExists: true)
+                input[3] = []
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    process.out.output,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - [vcf, tbi], [], [], [] - stub") {
+
+        when {
+            process {
+                """
+                input[0] = [ 
+                    [ id:'out' ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
+                    file(params.test_data['sarscov2']['illumina']['test_vcf_gz_tbi'], checkIfExists: true)
+                ]
+                input[1] = []
+                input[2] = []
+                input[3] = []
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.output[0][1]).name,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/bcftools/query/tests/main.nf.test.snap b/modules/nf-core/bcftools/query/tests/main.nf.test.snap
new file mode 100644
index 00000000..a19f2053
--- /dev/null
+++ b/modules/nf-core/bcftools/query/tests/main.nf.test.snap
@@ -0,0 +1,43 @@
+{
+    "sarscov2 - [vcf, tbi], vcf, tsv, []": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "out"
+                    },
+                    "out.txt:md5,75a6bd0084e2e1838cf7baba11b99d19"
+                ]
+            ],
+            [
+                "versions.yml:md5,b40206d5437ce4b044d15c47ddd93d8e"
+            ]
+        ],
+        "timestamp": "2023-11-29T14:21:05.191946862"
+    },
+    "sarscov2 - [vcf, tbi], [], [], [] - stub": {
+        "content": [
+            "out.txt",
+            [
+                "versions.yml:md5,b40206d5437ce4b044d15c47ddd93d8e"
+            ]
+        ],
+        "timestamp": "2023-11-29T14:21:11.169603542"
+    },
+    "sarscov2 - [vcf, tbi], [], [], []": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "out"
+                    },
+                    "out.txt:md5,87a2ab194e1ee3219b44e58429ec3307"
+                ]
+            ],
+            [
+                "versions.yml:md5,b40206d5437ce4b044d15c47ddd93d8e"
+            ]
+        ],
+        "timestamp": "2023-11-29T14:20:59.335041418"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/bcftools/query/tests/nextflow.config b/modules/nf-core/bcftools/query/tests/nextflow.config
new file mode 100644
index 00000000..da81c2a0
--- /dev/null
+++ b/modules/nf-core/bcftools/query/tests/nextflow.config
@@ -0,0 +1,3 @@
+process {
+    ext.args = "-f '%CHROM %POS %REF %ALT[%SAMPLE=%GT]'"
+}
\ No newline at end of file
diff --git a/modules/nf-core/bcftools/query/tests/tags.yml b/modules/nf-core/bcftools/query/tests/tags.yml
new file mode 100644
index 00000000..fb9455cb
--- /dev/null
+++ b/modules/nf-core/bcftools/query/tests/tags.yml
@@ -0,0 +1,2 @@
+bcftools/query:
+  - "modules/nf-core/bcftools/query/**"
diff --git a/modules/nf-core/bcftools/sort/environment.yml b/modules/nf-core/bcftools/sort/environment.yml
new file mode 100644
index 00000000..89cf911d
--- /dev/null
+++ b/modules/nf-core/bcftools/sort/environment.yml
@@ -0,0 +1,7 @@
+name: bcftools_sort
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::bcftools=1.18
diff --git a/modules/nf-core/bcftools/sort/main.nf b/modules/nf-core/bcftools/sort/main.nf
index 9ae3253b..c982944c 100644
--- a/modules/nf-core/bcftools/sort/main.nf
+++ b/modules/nf-core/bcftools/sort/main.nf
@@ -2,10 +2,10 @@ process BCFTOOLS_SORT {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::bcftools=1.16"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/bcftools:1.16--hfe4b78e_1':
-        'quay.io/biocontainers/bcftools:1.16--hfe4b78e_1' }"
+        'https://depot.galaxyproject.org/singularity/bcftools:1.18--h8b25389_0':
+        'biocontainers/bcftools:1.18--h8b25389_0' }"
 
     input:
     tuple val(meta), path(vcf)
@@ -30,6 +30,7 @@ process BCFTOOLS_SORT {
     bcftools \\
         sort \\
         --output ${prefix}.${extension} \\
+        --temp-dir . \\
         $args \\
         $vcf
 
diff --git a/modules/nf-core/bcftools/sort/meta.yml b/modules/nf-core/bcftools/sort/meta.yml
index 0c244a48..84747c6d 100644
--- a/modules/nf-core/bcftools/sort/meta.yml
+++ b/modules/nf-core/bcftools/sort/meta.yml
@@ -12,7 +12,6 @@ tools:
       tool_dev_url: https://github.com/samtools/bcftools
       doi: "10.1093/bioinformatics/btp352"
       licence: ["MIT"]
-
 input:
   - meta:
       type: map
@@ -23,7 +22,6 @@ input:
       type: file
       description: The VCF/BCF file to be sorted
       pattern: "*.{vcf.gz,vcf,bcf}"
-
 output:
   - meta:
       type: map
@@ -38,6 +36,7 @@ output:
       type: file
       description: Sorted VCF file
       pattern: "*.{vcf.gz}"
-
 authors:
   - "@Gwennid"
+maintainers:
+  - "@Gwennid"
diff --git a/modules/nf-core/bcftools/stats/environment.yml b/modules/nf-core/bcftools/stats/environment.yml
new file mode 100644
index 00000000..1a969528
--- /dev/null
+++ b/modules/nf-core/bcftools/stats/environment.yml
@@ -0,0 +1,7 @@
+name: bcftools_stats
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::bcftools=1.18
diff --git a/modules/nf-core/bcftools/stats/main.nf b/modules/nf-core/bcftools/stats/main.nf
index 51e9c91c..ffa1df64 100644
--- a/modules/nf-core/bcftools/stats/main.nf
+++ b/modules/nf-core/bcftools/stats/main.nf
@@ -2,16 +2,18 @@ process BCFTOOLS_STATS {
     tag "$meta.id"
     label 'process_single'
 
-    conda "bioconda::bcftools=1.16"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/bcftools:1.16--hfe4b78e_1':
-        'quay.io/biocontainers/bcftools:1.16--hfe4b78e_1' }"
+        'https://depot.galaxyproject.org/singularity/bcftools:1.18--h8b25389_0':
+        'biocontainers/bcftools:1.18--h8b25389_0' }"
 
     input:
-    tuple val(meta), path(vcf), path(tbi)
-    path regions
-    path targets
-    path samples
+    tuple val(meta),  path(vcf), path(tbi)
+    tuple val(meta2), path(regions)
+    tuple val(meta3), path(targets)
+    tuple val(meta4), path(samples)
+    tuple val(meta5), path(exons)
+    tuple val(meta6), path(fasta)
 
     output:
     tuple val(meta), path("*stats.txt"), emit: stats
@@ -26,12 +28,16 @@ process BCFTOOLS_STATS {
     def regions_file = regions ? "--regions-file ${regions}" : ""
     def targets_file = targets ? "--targets-file ${targets}" : ""
     def samples_file =  samples ? "--samples-file ${samples}" : ""
+    def reference_fasta = fasta ? "--fasta-ref ${fasta}" : ""
+    def exons_file = exons      ? "--exons ${exons}" : ""
     """
     bcftools stats \\
         $args \\
         $regions_file \\
         $targets_file \\
         $samples_file \\
+        $reference_fasta \\
+        $exons_file \\
         $vcf > ${prefix}.bcftools_stats.txt
 
     cat <<-END_VERSIONS > versions.yml
diff --git a/modules/nf-core/bcftools/stats/meta.yml b/modules/nf-core/bcftools/stats/meta.yml
index f7afcd50..7ea2103e 100644
--- a/modules/nf-core/bcftools/stats/meta.yml
+++ b/modules/nf-core/bcftools/stats/meta.yml
@@ -41,6 +41,16 @@ input:
       description: |
         Optional, file of sample names to be included or excluded.
         e.g. 'file.tsv'
+  - exons:
+      type: file
+      description: |
+        Tab-delimited file with exons for indel frameshifts (chr,beg,end; 1-based, inclusive, optionally bgzip compressed).
+        e.g. 'exons.tsv.gz'
+  - fasta:
+      type: file
+      description: |
+        Faidx indexed reference sequence file to determine INDEL context.
+        e.g. 'reference.fa'
 output:
   - meta:
       type: map
@@ -59,3 +69,9 @@ authors:
   - "@joseespinosa"
   - "@drpatelh"
   - "@SusiJo"
+  - "@TCLamnidis"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
+  - "@SusiJo"
+  - "@TCLamnidis"
diff --git a/modules/nf-core/bedtools/getfasta/environment.yml b/modules/nf-core/bedtools/getfasta/environment.yml
new file mode 100644
index 00000000..a89401f2
--- /dev/null
+++ b/modules/nf-core/bedtools/getfasta/environment.yml
@@ -0,0 +1,7 @@
+name: bedtools_getfasta
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::bedtools=2.31.1
diff --git a/modules/nf-core/bedtools/getfasta/main.nf b/modules/nf-core/bedtools/getfasta/main.nf
index 57e7f0de..50549c7d 100644
--- a/modules/nf-core/bedtools/getfasta/main.nf
+++ b/modules/nf-core/bedtools/getfasta/main.nf
@@ -2,10 +2,10 @@ process BEDTOOLS_GETFASTA {
     tag "$bed"
     label 'process_single'
 
-    conda "bioconda::bedtools=2.30.0"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/bedtools:2.30.0--hc088bd4_0' :
-        'quay.io/biocontainers/bedtools:2.30.0--hc088bd4_0' }"
+        'https://depot.galaxyproject.org/singularity/bedtools:2.31.1--hf5e1c6e_0' :
+        'biocontainers/bedtools:2.31.1--hf5e1c6e_0' }"
 
     input:
     path bed
diff --git a/modules/nf-core/bedtools/getfasta/meta.yml b/modules/nf-core/bedtools/getfasta/meta.yml
index 11335100..25fb19a1 100644
--- a/modules/nf-core/bedtools/getfasta/meta.yml
+++ b/modules/nf-core/bedtools/getfasta/meta.yml
@@ -19,7 +19,6 @@ input:
       type: file
       description: Input fasta file
       pattern: "*.{fa,fasta}"
-
 output:
   - fasta:
       type: file
@@ -32,3 +31,6 @@ output:
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
diff --git a/modules/nf-core/bedtools/maskfasta/environment.yml b/modules/nf-core/bedtools/maskfasta/environment.yml
new file mode 100644
index 00000000..71d18917
--- /dev/null
+++ b/modules/nf-core/bedtools/maskfasta/environment.yml
@@ -0,0 +1,7 @@
+name: bedtools_maskfasta
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::bedtools=2.31.1
diff --git a/modules/nf-core/bedtools/maskfasta/main.nf b/modules/nf-core/bedtools/maskfasta/main.nf
index a84a23c1..9511a8d8 100644
--- a/modules/nf-core/bedtools/maskfasta/main.nf
+++ b/modules/nf-core/bedtools/maskfasta/main.nf
@@ -2,10 +2,10 @@ process BEDTOOLS_MASKFASTA {
     tag "$meta.id"
     label 'process_single'
 
-    conda "bioconda::bedtools=2.30.0"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/bedtools:2.30.0--hc088bd4_0' :
-        'quay.io/biocontainers/bedtools:2.30.0--hc088bd4_0' }"
+        'https://depot.galaxyproject.org/singularity/bedtools:2.31.1--hf5e1c6e_0' :
+        'biocontainers/bedtools:2.31.1--hf5e1c6e_0' }"
 
     input:
     tuple val(meta), path(bed)
diff --git a/modules/nf-core/bedtools/maskfasta/meta.yml b/modules/nf-core/bedtools/maskfasta/meta.yml
index cc33df3e..94f81aba 100644
--- a/modules/nf-core/bedtools/maskfasta/meta.yml
+++ b/modules/nf-core/bedtools/maskfasta/meta.yml
@@ -24,7 +24,6 @@ input:
       type: file
       description: Input fasta file
       pattern: "*.{fa,fasta}"
-
 output:
   - meta:
       type: map
@@ -42,3 +41,6 @@ output:
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
diff --git a/modules/nf-core/bedtools/merge/environment.yml b/modules/nf-core/bedtools/merge/environment.yml
new file mode 100644
index 00000000..99707878
--- /dev/null
+++ b/modules/nf-core/bedtools/merge/environment.yml
@@ -0,0 +1,7 @@
+name: bedtools_merge
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::bedtools=2.31.1
diff --git a/modules/nf-core/bedtools/merge/main.nf b/modules/nf-core/bedtools/merge/main.nf
index 21b2e645..5310647d 100644
--- a/modules/nf-core/bedtools/merge/main.nf
+++ b/modules/nf-core/bedtools/merge/main.nf
@@ -2,10 +2,10 @@ process BEDTOOLS_MERGE {
     tag "$meta.id"
     label 'process_single'
 
-    conda "bioconda::bedtools=2.30.0"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/bedtools:2.30.0--hc088bd4_0' :
-        'quay.io/biocontainers/bedtools:2.30.0--hc088bd4_0' }"
+        'https://depot.galaxyproject.org/singularity/bedtools:2.31.1--hf5e1c6e_0' :
+        'biocontainers/bedtools:2.31.1--hf5e1c6e_0' }"
 
     input:
     tuple val(meta), path(bed)
@@ -33,4 +33,15 @@ process BEDTOOLS_MERGE {
         bedtools: \$(bedtools --version | sed -e "s/bedtools v//g")
     END_VERSIONS
     """
+
+    stub:
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    """
+    touch ${prefix}.bed
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        bedtools: \$(bedtools --version | sed -e "s/bedtools v//g")
+    END_VERSIONS
+    """
 }
diff --git a/modules/nf-core/bedtools/merge/meta.yml b/modules/nf-core/bedtools/merge/meta.yml
index 76743679..5565ce48 100644
--- a/modules/nf-core/bedtools/merge/meta.yml
+++ b/modules/nf-core/bedtools/merge/meta.yml
@@ -3,6 +3,8 @@ description: combines overlapping or “book-ended” features in an interval fi
 keywords:
   - bed
   - merge
+  - bedtools
+  - overlapped bed
 tools:
   - bedtools:
       description: |
@@ -37,3 +39,7 @@ authors:
   - "@Emiller88"
   - "@sruthipsuresh"
   - "@drpatelh"
+maintainers:
+  - "@Emiller88"
+  - "@sruthipsuresh"
+  - "@drpatelh"
diff --git a/modules/nf-core/blast/blastn/environment.yml b/modules/nf-core/blast/blastn/environment.yml
new file mode 100644
index 00000000..cb9b15dd
--- /dev/null
+++ b/modules/nf-core/blast/blastn/environment.yml
@@ -0,0 +1,7 @@
+name: blast_blastn
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::blast=2.14.1
diff --git a/modules/nf-core/blast/blastn/main.nf b/modules/nf-core/blast/blastn/main.nf
index 5f35422a..e8b96add 100644
--- a/modules/nf-core/blast/blastn/main.nf
+++ b/modules/nf-core/blast/blastn/main.nf
@@ -2,18 +2,18 @@ process BLAST_BLASTN {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::blast=2.13.0"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/blast:2.13.0--hf3cf87c_0' :
-        'quay.io/biocontainers/blast:2.13.0--hf3cf87c_0' }"
+        'https://depot.galaxyproject.org/singularity/blast:2.14.1--pl5321h6f7f691_0':
+        'biocontainers/blast:2.14.1--pl5321h6f7f691_0' }"
 
     input:
-    tuple val(meta), path(fasta)
-    path  db
+    tuple val(meta) , path(fasta)
+    tuple val(meta2), path(db)
 
     output:
-    tuple val(meta), path('*.blastn.txt'), emit: txt
-    path "versions.yml"                  , emit: versions
+    tuple val(meta), path('*.txt'), emit: txt
+    path "versions.yml"           , emit: versions
 
     when:
     task.ext.when == null || task.ext.when
@@ -21,14 +21,34 @@ process BLAST_BLASTN {
     script:
     def args = task.ext.args ?: ''
     def prefix = task.ext.prefix ?: "${meta.id}"
+    def is_compressed = fasta.getExtension() == "gz" ? true : false
+    def fasta_name = is_compressed ? fasta.getBaseName() : fasta
+
     """
-    DB=`find -L ./ -name "*.ndb" | sed 's/\\.ndb\$//'`
+    if [ "${is_compressed}" == "true" ]; then
+        gzip -c -d ${fasta} > ${fasta_name}
+    fi
+
+    DB=`find -L ./ -name "*.nin" | sed 's/\\.nin\$//'`
     blastn \\
-        -num_threads $task.cpus \\
+        -num_threads ${task.cpus} \\
         -db \$DB \\
-        -query $fasta \\
-        $args \\
-        -out ${prefix}.blastn.txt
+        -query ${fasta_name} \\
+        ${args} \\
+        -out ${prefix}.txt
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        blast: \$(blastn -version 2>&1 | sed 's/^.*blastn: //; s/ .*\$//')
+    END_VERSIONS
+    """
+
+    stub:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    """
+    touch ${prefix}.txt
+
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
         blast: \$(blastn -version 2>&1 | sed 's/^.*blastn: //; s/ .*\$//')
diff --git a/modules/nf-core/blast/blastn/meta.yml b/modules/nf-core/blast/blastn/meta.yml
index 2742278d..a0d64dd6 100644
--- a/modules/nf-core/blast/blastn/meta.yml
+++ b/modules/nf-core/blast/blastn/meta.yml
@@ -22,16 +22,26 @@ input:
   - fasta:
       type: file
       description: Input fasta file containing queries sequences
-      pattern: "*.{fa,fasta}"
+      pattern: "*.{fa,fasta,fa.gz,fasta.gz}"
+  - meta2:
+      type: map
+      description: |
+        Groovy Map containing db information
+        e.g. [ id:'test2', single_end:false ]
   - db:
       type: directory
-      description: Directory containing blast database
+      description: Directory containing the blast database
       pattern: "*"
 output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
   - txt:
       type: file
       description: File containing blastn hits
-      pattern: "*.{blastn.txt}"
+      pattern: "*.txt"
   - versions:
       type: file
       description: File containing software versions
@@ -39,3 +49,7 @@ output:
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
+  - "@vagkaratzas"
diff --git a/modules/nf-core/blast/blastn/tests/main.nf.test b/modules/nf-core/blast/blastn/tests/main.nf.test
new file mode 100644
index 00000000..0e909a7e
--- /dev/null
+++ b/modules/nf-core/blast/blastn/tests/main.nf.test
@@ -0,0 +1,71 @@
+nextflow_process {
+
+    name "Test Process BLAST_BLASTN"
+    script "../main.nf"
+    process "BLAST_BLASTN"
+    config "./nextflow.config"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "blast"
+    tag "blast/blastn"
+
+    setup {
+        run("BLAST_MAKEBLASTDB") {
+            script "../../makeblastdb/main.nf"
+            process {
+                """
+                input[0] = [ [id:'test2'], file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) ]
+                """
+            }
+        }
+    }
+
+    test("Should search for nucleotide hits against a blast db") {
+
+        when {
+            params {
+                outdir = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [ [id:'test'], file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) ]
+                input[1] = BLAST_MAKEBLASTDB.out.db
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert path(process.out.txt[0][1]).getText().contains("Query= MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate") },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+
+    }
+
+    test("Should search for zipped nucleotide hits against a blast db") {
+
+        when {
+            params {
+                outdir = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [ [id:'test'], file(params.test_data['sarscov2']['genome']['genome_fasta_gz'], checkIfExists: true) ]
+                input[1] = BLAST_MAKEBLASTDB.out.db
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert path(process.out.txt[0][1]).getText().contains("Query= MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate") },
+                { assert snapshot(process.out.versions).match("versions_zipped") }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/blast/blastn/tests/main.nf.test.snap b/modules/nf-core/blast/blastn/tests/main.nf.test.snap
new file mode 100644
index 00000000..d1b5f3f2
--- /dev/null
+++ b/modules/nf-core/blast/blastn/tests/main.nf.test.snap
@@ -0,0 +1,18 @@
+{
+    "versions": {
+        "content": [
+            [
+                "versions.yml:md5,2d5ffadc7035672f6a9e00b01d1751ea"
+            ]
+        ],
+        "timestamp": "2023-12-11T07:20:03.54997013"
+    },
+    "versions_zipped": {
+        "content": [
+            [
+                "versions.yml:md5,2d5ffadc7035672f6a9e00b01d1751ea"
+            ]
+        ],
+        "timestamp": "2023-12-11T07:20:12.925782708"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/blast/blastn/tests/nextflow.config b/modules/nf-core/blast/blastn/tests/nextflow.config
new file mode 100644
index 00000000..0899289b
--- /dev/null
+++ b/modules/nf-core/blast/blastn/tests/nextflow.config
@@ -0,0 +1,5 @@
+process {
+    withName: BLAST_MAKEBLASTDB {
+        ext.args = '-dbtype nucl'
+    }
+}
diff --git a/modules/nf-core/blast/blastn/tests/tags.yml b/modules/nf-core/blast/blastn/tests/tags.yml
new file mode 100644
index 00000000..b4588ab8
--- /dev/null
+++ b/modules/nf-core/blast/blastn/tests/tags.yml
@@ -0,0 +1,2 @@
+blast/blastn:
+  - modules/nf-core/blast/blastn/**
diff --git a/modules/nf-core/blast/makeblastdb/environment.yml b/modules/nf-core/blast/makeblastdb/environment.yml
new file mode 100644
index 00000000..cf84a60e
--- /dev/null
+++ b/modules/nf-core/blast/makeblastdb/environment.yml
@@ -0,0 +1,7 @@
+name: blast_makeblastdb
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::blast=2.14.1
diff --git a/modules/nf-core/blast/makeblastdb/main.nf b/modules/nf-core/blast/makeblastdb/main.nf
index 62abd813..cd1083d0 100644
--- a/modules/nf-core/blast/makeblastdb/main.nf
+++ b/modules/nf-core/blast/makeblastdb/main.nf
@@ -1,30 +1,62 @@
 process BLAST_MAKEBLASTDB {
-    tag "$fasta"
+    tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::blast=2.13.0"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/blast:2.13.0--hf3cf87c_0' :
-        'quay.io/biocontainers/blast:2.13.0--hf3cf87c_0' }"
+        'https://depot.galaxyproject.org/singularity/blast:2.14.1--pl5321h6f7f691_0':
+        'biocontainers/blast:2.14.1--pl5321h6f7f691_0' }"
 
     input:
-    path fasta
+    tuple val(meta), path(fasta)
 
     output:
-    path 'blast_db'     , emit: db
-    path "versions.yml" , emit: versions
+    tuple val(meta), path("${meta.id}"), emit: db
+    path "versions.yml"                , emit: versions
 
     when:
     task.ext.when == null || task.ext.when
 
     script:
     def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def is_compressed = fasta.getExtension() == "gz" ? true : false
+    def fasta_name = is_compressed ? fasta.getBaseName() : fasta
     """
+    if [ "${is_compressed}" == "true" ]; then
+        gzip -c -d ${fasta} > ${fasta_name}
+    fi
+
     makeblastdb \\
-        -in $fasta \\
-        $args
-    mkdir blast_db
-    mv ${fasta}* blast_db
+        -in ${fasta_name} \\
+        ${args}
+    mkdir ${prefix}
+    mv ${fasta_name}* ${prefix}
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        blast: \$(blastn -version 2>&1 | sed 's/^.*blastn: //; s/ .*\$//')
+    END_VERSIONS
+    """
+
+    stub:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def is_compressed = fasta.getExtension() == "gz" ? true : false
+    def fasta_name = is_compressed ? fasta.getBaseName() : fasta
+    """
+    touch ${fasta_name}.fasta
+    touch ${fasta_name}.fasta.ndb
+    touch ${fasta_name}.fasta.nhr
+    touch ${fasta_name}.fasta.nin
+    touch ${fasta_name}.fasta.njs
+    touch ${fasta_name}.fasta.not
+    touch ${fasta_name}.fasta.nsq
+    touch ${fasta_name}.fasta.ntf
+    touch ${fasta_name}.fasta.nto
+    mkdir ${prefix}
+    mv ${fasta_name}* ${prefix}
+
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
         blast: \$(blastn -version 2>&1 | sed 's/^.*blastn: //; s/ .*\$//')
diff --git a/modules/nf-core/blast/makeblastdb/meta.yml b/modules/nf-core/blast/makeblastdb/meta.yml
index 83c4b292..9ed63901 100644
--- a/modules/nf-core/blast/makeblastdb/meta.yml
+++ b/modules/nf-core/blast/makeblastdb/meta.yml
@@ -13,11 +13,21 @@ tools:
       doi: 10.1016/S0022-2836(05)80360-2
       licence: ["US-Government-Work"]
 input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
   - fasta:
       type: file
       description: Input fasta file
-      pattern: "*.{fa,fasta}"
+      pattern: "*.{fa,fasta,fa.gz,fasta.gz}"
 output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
   - db:
       type: directory
       description: Output directory containing blast database files
@@ -29,3 +39,7 @@ output:
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
+  - "@vagkaratzas"
diff --git a/modules/nf-core/blast/makeblastdb/tests/main.nf.test b/modules/nf-core/blast/makeblastdb/tests/main.nf.test
new file mode 100644
index 00000000..983b165f
--- /dev/null
+++ b/modules/nf-core/blast/makeblastdb/tests/main.nf.test
@@ -0,0 +1,92 @@
+nextflow_process {
+
+    name "Test Process BLAST_MAKEBLASTDB"
+    script "../main.nf"
+    process "BLAST_MAKEBLASTDB"
+    config "./nextflow.config"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "blast"
+    tag "blast/makeblastdb"
+
+    test("Should build a blast db folder from a fasta file") {
+
+        when {
+            params {
+                outdir = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [ [id:'test'], file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert process.out.db
+                    with(process.out.db) {
+                        assert size() == 1
+                        with(get(0).get(1)) {
+                            File folder = new File(get(0).get(1))
+                            File[] listOfFiles = folder.listFiles()
+                            listOfFiles = listOfFiles.sort { it.name }
+                            assert listOfFiles.length == 9
+                            assert snapshot("${get(0).get(1)}/${listOfFiles[0].name}").match("genome.fasta")
+                            assert snapshot("${get(0).get(1)}/${listOfFiles[1].name}").match("genome.fasta.ndb")
+                            assert snapshot("${get(0).get(1)}/${listOfFiles[2].name}").match("genome.fasta.nhr")
+                            assert snapshot("${get(0).get(1)}/${listOfFiles[5].name}").match("genome.fasta.not")
+                            assert snapshot("${get(0).get(1)}/${listOfFiles[6].name}").match("genome.fasta.nsq")
+                            assert snapshot("${get(0).get(1)}/${listOfFiles[7].name}").match("genome.fasta.ntf")
+                            assert snapshot("${get(0).get(1)}/${listOfFiles[8].name}").match("genome.fasta.nto")
+                        }
+                    }
+                },
+                { assert process.out.versions }
+            )
+        }
+
+    }
+
+    test("Should build a blast db folder from a zipped fasta file") {
+
+        when {
+            params {
+                outdir = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [ [id:'test'], file(params.test_data['sarscov2']['genome']['genome_fasta_gz'], checkIfExists: true) ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert process.out.db
+                    with(process.out.db) {
+                        assert size() == 1
+                        with(get(0).get(1)) {
+                            File folder = new File(get(0).get(1))
+                            File[] listOfFiles = folder.listFiles()
+                            listOfFiles = listOfFiles.sort { it.name }
+                            assert listOfFiles.length == 10
+                            assert snapshot("${get(0).get(1)}/${listOfFiles[0].name}").match("gz_genome.fasta")
+                            assert snapshot("${get(0).get(1)}/${listOfFiles[2].name}").match("gz_genome.fasta.ndb")
+                            assert snapshot("${get(0).get(1)}/${listOfFiles[3].name}").match("gz_genome.fasta.nhr")
+                            assert snapshot("${get(0).get(1)}/${listOfFiles[6].name}").match("gz_genome.fasta.not")
+                            assert snapshot("${get(0).get(1)}/${listOfFiles[7].name}").match("gz_genome.fasta.nsq")
+                            assert snapshot("${get(0).get(1)}/${listOfFiles[8].name}").match("gz_genome.fasta.ntf")
+                            assert snapshot("${get(0).get(1)}/${listOfFiles[9].name}").match("gz_genome.fasta.nto")
+                        }
+                    }
+                },
+                { assert process.out.versions }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/blast/makeblastdb/tests/main.nf.test.snap b/modules/nf-core/blast/makeblastdb/tests/main.nf.test.snap
new file mode 100644
index 00000000..b6f040ed
--- /dev/null
+++ b/modules/nf-core/blast/makeblastdb/tests/main.nf.test.snap
@@ -0,0 +1,86 @@
+{
+    "genome.fasta": {
+        "content": [
+            "genome.fasta:md5,6e9fe4042a72f2345f644f239272b7e6"
+        ],
+        "timestamp": "2023-11-07T12:52:38.457245596"
+    },
+    "gz_genome.fasta.ntf": {
+        "content": [
+            "genome.fasta.ntf:md5,de1250813f0c7affc6d12dac9d0fb6bb"
+        ],
+        "timestamp": "2023-11-07T12:58:02.121840034"
+    },
+    "genome.fasta.not": {
+        "content": [
+            "genome.fasta.not:md5,1e53e9d08f1d23af0299cfa87478a7bb"
+        ],
+        "timestamp": "2023-11-07T12:55:33.862012946"
+    },
+    "genome.fasta.nhr": {
+        "content": [
+            "genome.fasta.nhr:md5,f4b4ddb034fd3dd7b25c89e9d50c004e"
+        ],
+        "timestamp": "2023-11-07T12:55:33.857994517"
+    },
+    "gz_genome.fasta.nhr": {
+        "content": [
+            "genome.fasta.nhr:md5,f4b4ddb034fd3dd7b25c89e9d50c004e"
+        ],
+        "timestamp": "2023-11-07T12:58:02.102407993"
+    },
+    "genome.fasta.ntf": {
+        "content": [
+            "genome.fasta.ntf:md5,de1250813f0c7affc6d12dac9d0fb6bb"
+        ],
+        "timestamp": "2023-11-07T12:55:33.877288786"
+    },
+    "gz_genome.fasta.not": {
+        "content": [
+            "genome.fasta.not:md5,1e53e9d08f1d23af0299cfa87478a7bb"
+        ],
+        "timestamp": "2023-11-07T12:58:02.108135313"
+    },
+    "gz_genome.fasta.ndb": {
+        "content": [
+            "genome.fasta.ndb:md5,0d553c830656469211de113c5022f06d"
+        ],
+        "timestamp": "2023-11-07T12:58:02.094305556"
+    },
+    "gz_genome.fasta.nsq": {
+        "content": [
+            "genome.fasta.nsq:md5,982cbc7d9e38743b9b1037588862b9da"
+        ],
+        "timestamp": "2023-11-07T12:58:02.115010863"
+    },
+    "genome.fasta.nto": {
+        "content": [
+            "genome.fasta.nto:md5,33cdeccccebe80329f1fdbee7f5874cb"
+        ],
+        "timestamp": "2023-11-07T12:55:33.890761822"
+    },
+    "gz_genome.fasta.nto": {
+        "content": [
+            "genome.fasta.nto:md5,33cdeccccebe80329f1fdbee7f5874cb"
+        ],
+        "timestamp": "2023-11-07T12:58:02.12931429"
+    },
+    "genome.fasta.ndb": {
+        "content": [
+            "genome.fasta.ndb:md5,0d553c830656469211de113c5022f06d"
+        ],
+        "timestamp": "2023-11-07T12:55:33.853303997"
+    },
+    "genome.fasta.nsq": {
+        "content": [
+            "genome.fasta.nsq:md5,982cbc7d9e38743b9b1037588862b9da"
+        ],
+        "timestamp": "2023-11-07T12:55:33.866667927"
+    },
+    "gz_genome.fasta": {
+        "content": [
+            "genome.fasta:md5,6e9fe4042a72f2345f644f239272b7e6"
+        ],
+        "timestamp": "2023-11-07T12:58:02.081764854"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/blast/makeblastdb/tests/nextflow.config b/modules/nf-core/blast/makeblastdb/tests/nextflow.config
new file mode 100644
index 00000000..0899289b
--- /dev/null
+++ b/modules/nf-core/blast/makeblastdb/tests/nextflow.config
@@ -0,0 +1,5 @@
+process {
+    withName: BLAST_MAKEBLASTDB {
+        ext.args = '-dbtype nucl'
+    }
+}
diff --git a/modules/nf-core/blast/makeblastdb/tests/tags.yml b/modules/nf-core/blast/makeblastdb/tests/tags.yml
new file mode 100644
index 00000000..ab74c02a
--- /dev/null
+++ b/modules/nf-core/blast/makeblastdb/tests/tags.yml
@@ -0,0 +1,2 @@
+blast/makeblastdb:
+  - modules/nf-core/blast/makeblastdb/**
diff --git a/modules/nf-core/bowtie2/align/environment.yml b/modules/nf-core/bowtie2/align/environment.yml
new file mode 100644
index 00000000..d2796359
--- /dev/null
+++ b/modules/nf-core/bowtie2/align/environment.yml
@@ -0,0 +1,9 @@
+name: bowtie2_align
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::bowtie2=2.5.2
+  - bioconda::samtools=1.18
+  - conda-forge::pigz=2.6
diff --git a/modules/nf-core/bowtie2/align/main.nf b/modules/nf-core/bowtie2/align/main.nf
index 3d851866..8c405ee3 100644
--- a/modules/nf-core/bowtie2/align/main.nf
+++ b/modules/nf-core/bowtie2/align/main.nf
@@ -2,10 +2,10 @@ process BOWTIE2_ALIGN {
     tag "$meta.id"
     label "process_high"
 
-    conda "bioconda::bowtie2=2.4.4 bioconda::samtools=1.16.1 conda-forge::pigz=2.6"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/mulled-v2-ac74a7f02cebcfcc07d8e8d1d750af9c83b4d45a:a0ffedb52808e102887f6ce600d092675bf3528a-0' :
-        'quay.io/biocontainers/mulled-v2-ac74a7f02cebcfcc07d8e8d1d750af9c83b4d45a:a0ffedb52808e102887f6ce600d092675bf3528a-0' }"
+        'https://depot.galaxyproject.org/singularity/mulled-v2-ac74a7f02cebcfcc07d8e8d1d750af9c83b4d45a:f70b31a2db15c023d641c32f433fb02cd04df5a6-0' :
+        'biocontainers/mulled-v2-ac74a7f02cebcfcc07d8e8d1d750af9c83b4d45a:f70b31a2db15c023d641c32f433fb02cd04df5a6-0' }"
 
     input:
     tuple val(meta) , path(reads)
@@ -14,10 +14,10 @@ process BOWTIE2_ALIGN {
     val   sort_bam
 
     output:
-    tuple val(meta), path("*.bam")    , emit: bam
-    tuple val(meta), path("*.log")    , emit: log
-    tuple val(meta), path("*fastq.gz"), emit: fastq, optional:true
-    path  "versions.yml"              , emit: versions
+    tuple val(meta), path("*.{bam,sam}"), emit: aligned
+    tuple val(meta), path("*.log")      , emit: log
+    tuple val(meta), path("*fastq.gz")  , emit: fastq, optional:true
+    path  "versions.yml"                , emit: versions
 
     when:
     task.ext.when == null || task.ext.when
@@ -38,6 +38,8 @@ process BOWTIE2_ALIGN {
     }
 
     def samtools_command = sort_bam ? 'sort' : 'view'
+    def extension_pattern = /(--output-fmt|-O)+\s+(\S+)/
+    def extension = (args2 ==~ extension_pattern) ? (args2 =~ extension_pattern)[0][2].toLowerCase() : "bam"
 
     """
     INDEX=`find -L ./ -name "*.rev.1.bt2" | sed "s/\\.rev.1.bt2\$//"`
@@ -50,8 +52,8 @@ process BOWTIE2_ALIGN {
         --threads $task.cpus \\
         $unaligned \\
         $args \\
-        2> ${prefix}.bowtie2.log \\
-        | samtools $samtools_command $args2 --threads $task.cpus -o ${prefix}.bam -
+        2> >(tee ${prefix}.bowtie2.log >&2) \\
+        | samtools $samtools_command $args2 --threads $task.cpus -o ${prefix}.${extension} -
 
     if [ -f ${prefix}.unmapped.fastq.1.gz ]; then
         mv ${prefix}.unmapped.fastq.1.gz ${prefix}.unmapped_1.fastq.gz
@@ -68,4 +70,30 @@ process BOWTIE2_ALIGN {
         pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' )
     END_VERSIONS
     """
+
+    stub:
+    def args2 = task.ext.args2 ?: ""
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def extension_pattern = /(--output-fmt|-O)+\s+(\S+)/
+    def extension = (args2 ==~ extension_pattern) ? (args2 =~ extension_pattern)[0][2].toLowerCase() : "bam"
+    def create_unmapped = ""
+    if (meta.single_end) {
+        create_unmapped = save_unaligned ? "touch ${prefix}.unmapped.fastq.gz" : ""
+    } else {
+        create_unmapped = save_unaligned ? "touch ${prefix}.unmapped_1.fastq.gz && touch ${prefix}.unmapped_2.fastq.gz" : ""
+    }
+
+    """
+    touch ${prefix}.${extension}
+    touch ${prefix}.bowtie2.log
+    ${create_unmapped}
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        bowtie2: \$(echo \$(bowtie2 --version 2>&1) | sed 's/^.*bowtie2-align-s version //; s/ .*\$//')
+        samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
+        pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' )
+    END_VERSIONS
+    """
+
 }
diff --git a/modules/nf-core/bowtie2/align/meta.yml b/modules/nf-core/bowtie2/align/meta.yml
index c8e9a001..e66811d0 100644
--- a/modules/nf-core/bowtie2/align/meta.yml
+++ b/modules/nf-core/bowtie2/align/meta.yml
@@ -46,10 +46,10 @@ input:
       description: use samtools sort (true) or samtools view (false)
       pattern: "true or false"
 output:
-  - bam:
+  - aligned:
       type: file
-      description: Output BAM file containing read alignments
-      pattern: "*.{bam}"
+      description: Output BAM/SAM file containing read alignments
+      pattern: "*.{bam,sam}"
   - versions:
       type: file
       description: File containing software versions
@@ -65,3 +65,6 @@ output:
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
diff --git a/modules/nf-core/bowtie2/align/tests/large_index.config b/modules/nf-core/bowtie2/align/tests/large_index.config
new file mode 100644
index 00000000..fdc1c59d
--- /dev/null
+++ b/modules/nf-core/bowtie2/align/tests/large_index.config
@@ -0,0 +1,5 @@
+process {
+    withName: BOWTIE2_BUILD {
+        ext.args = '--large-index'
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/bowtie2/align/tests/main.nf.test b/modules/nf-core/bowtie2/align/tests/main.nf.test
new file mode 100644
index 00000000..a478d17b
--- /dev/null
+++ b/modules/nf-core/bowtie2/align/tests/main.nf.test
@@ -0,0 +1,561 @@
+nextflow_process {
+
+    name "Test Process BOWTIE2_ALIGN"
+    script "../main.nf"
+    process "BOWTIE2_ALIGN"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "bowtie2"
+    tag "bowtie2/align"
+
+    test("sarscov2 - fastq, index, false, false - bam") {
+
+        setup {
+            run("BOWTIE2_BUILD") {
+                script "../../build/main.nf"
+                process {
+                    """
+                    input[0] = [
+                        [ id:'test'],
+                        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    ]
+                    """
+                }
+            }
+        }
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+                ]
+                input[1] = BOWTIE2_BUILD.out.index
+                input[2] = false //save_unaligned
+                input[3] = false //sort
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.aligned[0][1]).name,
+                    process.out.log,
+                    process.out.fastq,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - fastq, index, false, false - sam") {
+
+        config "./sam.config"
+        setup {
+            run("BOWTIE2_BUILD") {
+                script "../../build/main.nf"
+                process {
+                    """
+                    input[0] = [
+                        [ id:'test'],
+                        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    ]
+                    """
+                }
+            }
+        }
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+                ]
+                input[1] = BOWTIE2_BUILD.out.index
+                input[2] = false //save_unaligned
+                input[3] = false //sort
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.aligned[0][1]).readLines()[0..4],
+                    process.out.log,
+                    process.out.fastq,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - fastq, index, false, false - sam2") {
+
+        config "./sam2.config"
+        setup {
+            run("BOWTIE2_BUILD") {
+                script "../../build/main.nf"
+                process {
+                    """
+                    input[0] = [
+                        [ id:'test'],
+                        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    ]
+                    """
+                }
+            }
+        }
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+                ]
+                input[1] = BOWTIE2_BUILD.out.index
+                input[2] = false //save_unaligned
+                input[3] = false //sort
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.aligned[0][1]).readLines()[0..4],
+                    process.out.log,
+                    process.out.fastq,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - fastq, index, false, true - bam") {
+
+        setup {
+            run("BOWTIE2_BUILD") {
+                script "../../build/main.nf"
+                process {
+                    """
+                    input[0] = [
+                        [ id:'test'],
+                        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    ]
+                    """
+                }
+            }
+        }
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+                ]
+                input[1] = BOWTIE2_BUILD.out.index
+                input[2] = false //save_unaligned
+                input[3] = true //sort
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.aligned[0][1]).name,
+                    process.out.log,
+                    process.out.fastq,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - [fastq1, fastq2], index, false, false - bam") {
+
+        setup {
+            run("BOWTIE2_BUILD") {
+                script "../../build/main.nf"
+                process {
+                    """
+                    input[0] = [
+                        [ id:'test'],
+                        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    ]
+                    """
+                }
+            }
+        }
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                        file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
+                    ]
+                ]
+                input[1] = BOWTIE2_BUILD.out.index
+                input[2] = false //save_unaligned
+                input[3] = false //sort
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.aligned[0][1]).name,
+                    process.out.log,
+                    process.out.fastq,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - [fastq1, fastq2], index, false, true - bam") {
+
+        setup {
+            run("BOWTIE2_BUILD") {
+                script "../../build/main.nf"
+                process {
+                    """
+                    input[0] = [
+                        [ id:'test'],
+                        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    ]
+                    """
+                }
+            }
+        }
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                        file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
+                    ]
+                ]
+                input[1] = BOWTIE2_BUILD.out.index
+                input[2] = false //save_unaligned
+                input[3] = true //sort
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.aligned[0][1]).name,
+                    process.out.log,
+                    process.out.fastq,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - fastq, large_index, false, false - bam") {
+
+        config "./large_index.config"
+        setup {
+            run("BOWTIE2_BUILD") {
+                script "../../build/main.nf"
+                process {
+                    """
+                    input[0] = [
+                        [ id:'test'],
+                        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    ]
+                    """
+                }
+            }
+        }
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+                ]
+                input[1] = BOWTIE2_BUILD.out.index
+                input[2] = false //save_unaligned
+                input[3] = false //sort
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.aligned[0][1]).name,
+                    process.out.log,
+                    process.out.fastq,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - [fastq1, fastq2], large_index, false, false - bam") {
+
+        config "./large_index.config"
+        setup {
+            run("BOWTIE2_BUILD") {
+                script "../../build/main.nf"
+                process {
+                    """
+                    input[0] = [
+                        [ id:'test'],
+                        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    ]
+                    """
+                }
+            }
+        }
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                        file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
+                    ]
+                ]
+                input[1] = BOWTIE2_BUILD.out.index
+                input[2] = false //save_unaligned
+                input[3] = false //sort
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.aligned[0][1]).name,
+                    process.out.log,
+                    process.out.fastq,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - [fastq1, fastq2], index, true, false - bam") {
+
+        setup {
+            run("BOWTIE2_BUILD") {
+                script "../../build/main.nf"
+                process {
+                    """
+                    input[0] = [
+                        [ id:'test'],
+                        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    ]
+                    """
+                }
+            }
+        }
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                        file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
+                    ]
+                ]
+                input[1] = BOWTIE2_BUILD.out.index
+                input[2] = true //save_unaligned
+                input[3] = false //sort
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.aligned[0][1]).name,
+                    process.out.log,
+                    process.out.fastq,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - fastq, index, true, false - bam") {
+
+        setup {
+            run("BOWTIE2_BUILD") {
+                script "../../build/main.nf"
+                process {
+                    """
+                    input[0] = [
+                        [ id:'test'],
+                        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    ]
+                    """
+                }
+            }
+        }
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+                ]
+                input[1] = BOWTIE2_BUILD.out.index
+                input[2] = true //save_unaligned
+                input[3] = false //sort
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.aligned[0][1]).name,
+                    process.out.log,
+                    process.out.fastq,
+                    process.out.versions
+                ).match() }
+
+            )
+        }
+
+    }
+
+    test("sarscov2 - [fastq1, fastq2], index, false, false - stub") {
+
+        options "-stub"
+        setup {
+            run("BOWTIE2_BUILD") {
+                script "../../build/main.nf"
+                process {
+                    """
+                    input[0] = [
+                        [ id:'test'],
+                        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    ]
+                    """
+                }
+            }
+        }
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                        file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
+                    ]
+                ]
+                input[1] = BOWTIE2_BUILD.out.index
+                input[2] = false //save_unaligned
+                input[3] = false //sort
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.aligned[0][1]).name,
+                    file(process.out.log[0][1]).name,
+                    process.out.fastq,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - fastq, index, true, false - stub") {
+
+        options "-stub"
+        setup {
+            run("BOWTIE2_BUILD") {
+                script "../../build/main.nf"
+                process {
+                    """
+                    input[0] = [
+                        [ id:'test'],
+                        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    ]
+                    """
+                }
+            }
+        }
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+                ]
+                input[1] = BOWTIE2_BUILD.out.index
+                input[2] = true //save_unaligned
+                input[3] = false //sort
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.aligned[0][1]).name,
+                    file(process.out.log[0][1]).name,
+                    file(process.out.fastq[0][1]).name,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+    
+}
diff --git a/modules/nf-core/bowtie2/align/tests/main.nf.test.snap b/modules/nf-core/bowtie2/align/tests/main.nf.test.snap
new file mode 100644
index 00000000..883dc7ec
--- /dev/null
+++ b/modules/nf-core/bowtie2/align/tests/main.nf.test.snap
@@ -0,0 +1,263 @@
+{
+    "sarscov2 - fastq, index, false, false - sam2": {
+        "content": [
+            [
+                "ERR5069949.2151832\t16\tMT192765.1\t17453\t42\t150M\t*\t0\t0\tACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGA\tAAAA<EEEEEEAEEEAEAAAAEEEEEEEEEAAAEE<EEEEEAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAAAAA\tAS:i:0\tXN:i:0\tXM:i:0\tXO:i:0\tXG:i:0\tNM:i:0\tMD:Z:150\tYT:Z:UU",
+                "ERR5069949.576388\t16\tMT192765.1\t5798\t42\t77M\t*\t0\t0\tGCATAGACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAGT\tEA/AEEE/<EEEEEEEEEEEAA<EEEEEEEEEEEEEEEEEEEEEAEEEEEAEEEAEE6/EEEAEEEEEEEEEA6AAA\tAS:i:0\tXN:i:0\tXM:i:0\tXO:i:0\tXG:i:0\tNM:i:0\tMD:Z:77\tYT:Z:UU",
+                "ERR5069949.501486\t16\tMT192765.1\t5423\t42\t146M\t*\t0\t0\tTAGGTGAGTTAGGTGATGTTAGAGAAACAATGAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTGGTGTGTAAAACTTGTGGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTAC\tEAAAAEAEEEE6E<AEEEEEEEE<EEEEEEAAEE/EEEEEE/<EEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAAAA\tAS:i:0\tXN:i:0\tXM:i:0\tXO:i:0\tXG:i:0\tNM:i:0\tMD:Z:146\tYT:Z:UU",
+                "ERR5069949.1331889\t0\tMT192765.1\t13010\t42\t132M\t*\t0\t0\tGTCTACAAGCTGGTAATGCAACAGAAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGATGCTGCTAAAGCTTACAAAGATTATCTAGCTAGTGGGGGACAACCAATCACTAATTGTG\tA/AAAEEEEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEEEEAEEEEEEEEEEEEEEE/EEEEE<AEAEEEEE/EAEAEEE/AEEEEEEEEEEEEEEEEEEEEAE/EEEEEEEEEEEEEEEEEEEEEEEA<EE\tAS:i:0\tXN:i:0\tXM:i:0\tXO:i:0\tXG:i:0\tNM:i:0\tMD:Z:132\tYT:Z:UU",
+                "ERR5069949.2161340\t0\tMT192765.1\t17482\t42\t80M\t*\t0\t0\tAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGT\tA/AA//EEAEA/E/AEEEE6EE/EEEA/6AEEEEEEEEE6EEEAEAEE//A/EEEEEE//E/E/A//E/E/<<EE</E/E\tAS:i:0\tXN:i:0\tXM:i:0\tXO:i:0\tXG:i:0\tNM:i:0\tMD:Z:80\tYT:Z:UU"
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.bowtie2.log:md5,7b8a9e61b7646da1089b041333c41a87"
+                ]
+            ],
+            [
+
+            ],
+            [
+                "versions.yml:md5,01d18ab035146ea790e9a0f70adb758f"
+            ]
+        ],
+        "timestamp": "2023-11-23T11:31:43.71534618"
+    },
+    "sarscov2 - fastq, index, false, false - bam": {
+        "content": [
+            "test.bam",
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.bowtie2.log:md5,7b8a9e61b7646da1089b041333c41a87"
+                ]
+            ],
+            [
+
+            ],
+            [
+                "versions.yml:md5,01d18ab035146ea790e9a0f70adb758f"
+            ]
+        ],
+        "timestamp": "2023-11-23T10:51:15.152469637"
+    },
+    "sarscov2 - [fastq1, fastq2], index, true, false - bam": {
+        "content": [
+            "test.bam",
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.bowtie2.log:md5,bd89ce1b28c93bf822bae391ffcedd19"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test.unmapped_1.fastq.gz:md5,84b4ab15e6ffc9f29d0a3f1b79003744",
+                        "test.unmapped_2.fastq.gz:md5,40bbe14edd48a98cca6f53574b2198fd"
+                    ]
+                ]
+            ],
+            [
+                "versions.yml:md5,01d18ab035146ea790e9a0f70adb758f"
+            ]
+        ],
+        "timestamp": "2023-11-23T11:32:26.773226801"
+    },
+    "sarscov2 - [fastq1, fastq2], index, false, false - stub": {
+        "content": [
+            "test.bam",
+            "test.bowtie2.log",
+            [
+
+            ],
+            [
+                "versions.yml:md5,01d18ab035146ea790e9a0f70adb758f"
+            ]
+        ],
+        "timestamp": "2023-11-23T11:38:10.240204508"
+    },
+    "sarscov2 - fastq, index, false, false - sam": {
+        "content": [
+            [
+                "ERR5069949.2151832\t16\tMT192765.1\t17453\t42\t150M\t*\t0\t0\tACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGA\tAAAA<EEEEEEAEEEAEAAAAEEEEEEEEEAAAEE<EEEEEAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAAAAA\tAS:i:0\tXN:i:0\tXM:i:0\tXO:i:0\tXG:i:0\tNM:i:0\tMD:Z:150\tYT:Z:UU",
+                "ERR5069949.576388\t16\tMT192765.1\t5798\t42\t77M\t*\t0\t0\tGCATAGACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAGT\tEA/AEEE/<EEEEEEEEEEEAA<EEEEEEEEEEEEEEEEEEEEEAEEEEEAEEEAEE6/EEEAEEEEEEEEEA6AAA\tAS:i:0\tXN:i:0\tXM:i:0\tXO:i:0\tXG:i:0\tNM:i:0\tMD:Z:77\tYT:Z:UU",
+                "ERR5069949.501486\t16\tMT192765.1\t5423\t42\t146M\t*\t0\t0\tTAGGTGAGTTAGGTGATGTTAGAGAAACAATGAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTGGTGTGTAAAACTTGTGGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTAC\tEAAAAEAEEEE6E<AEEEEEEEE<EEEEEEAAEE/EEEEEE/<EEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAAAA\tAS:i:0\tXN:i:0\tXM:i:0\tXO:i:0\tXG:i:0\tNM:i:0\tMD:Z:146\tYT:Z:UU",
+                "ERR5069949.1331889\t0\tMT192765.1\t13010\t42\t132M\t*\t0\t0\tGTCTACAAGCTGGTAATGCAACAGAAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGATGCTGCTAAAGCTTACAAAGATTATCTAGCTAGTGGGGGACAACCAATCACTAATTGTG\tA/AAAEEEEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEEEEAEEEEEEEEEEEEEEE/EEEEE<AEAEEEEE/EAEAEEE/AEEEEEEEEEEEEEEEEEEEEAE/EEEEEEEEEEEEEEEEEEEEEEEA<EE\tAS:i:0\tXN:i:0\tXM:i:0\tXO:i:0\tXG:i:0\tNM:i:0\tMD:Z:132\tYT:Z:UU",
+                "ERR5069949.2161340\t0\tMT192765.1\t17482\t42\t80M\t*\t0\t0\tAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGT\tA/AA//EEAEA/E/AEEEE6EE/EEEA/6AEEEEEEEEE6EEEAEAEE//A/EEEEEE//E/E/A//E/E/<<EE</E/E\tAS:i:0\tXN:i:0\tXM:i:0\tXO:i:0\tXG:i:0\tNM:i:0\tMD:Z:80\tYT:Z:UU"
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.bowtie2.log:md5,7b8a9e61b7646da1089b041333c41a87"
+                ]
+            ],
+            [
+
+            ],
+            [
+                "versions.yml:md5,01d18ab035146ea790e9a0f70adb758f"
+            ]
+        ],
+        "timestamp": "2023-11-23T10:54:41.68497071"
+    },
+    "sarscov2 - fastq, index, false, true - bam": {
+        "content": [
+            "test.bam",
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.bowtie2.log:md5,7b8a9e61b7646da1089b041333c41a87"
+                ]
+            ],
+            [
+
+            ],
+            [
+                "versions.yml:md5,01d18ab035146ea790e9a0f70adb758f"
+            ]
+        ],
+        "timestamp": "2023-11-23T11:31:51.235960009"
+    },
+    "sarscov2 - fastq, index, true, false - bam": {
+        "content": [
+            "test.bam",
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.bowtie2.log:md5,7b8a9e61b7646da1089b041333c41a87"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.unmapped.fastq.gz:md5,d17d9a4ff728b6a6afa6203a746b7a01"
+                ]
+            ],
+            [
+                "versions.yml:md5,01d18ab035146ea790e9a0f70adb758f"
+            ]
+        ],
+        "timestamp": "2023-11-23T11:32:34.218783018"
+    },
+    "sarscov2 - fastq, index, true, false - stub": {
+        "content": [
+            "test.bam",
+            "test.bowtie2.log",
+            "test.unmapped.fastq.gz",
+            [
+                "versions.yml:md5,01d18ab035146ea790e9a0f70adb758f"
+            ]
+        ],
+        "timestamp": "2023-11-23T11:47:34.072444428"
+    },
+    "sarscov2 - fastq, large_index, false, false - bam": {
+        "content": [
+            "test.bam",
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.bowtie2.log:md5,7b8a9e61b7646da1089b041333c41a87"
+                ]
+            ],
+            [
+
+            ],
+            [
+                "versions.yml:md5,01d18ab035146ea790e9a0f70adb758f"
+            ]
+        ],
+        "timestamp": "2023-11-23T11:32:11.560260131"
+    },
+    "sarscov2 - [fastq1, fastq2], large_index, false, false - bam": {
+        "content": [
+            "test.bam",
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.bowtie2.log:md5,bd89ce1b28c93bf822bae391ffcedd19"
+                ]
+            ],
+            [
+
+            ],
+            [
+                "versions.yml:md5,01d18ab035146ea790e9a0f70adb758f"
+            ]
+        ],
+        "timestamp": "2023-11-23T11:32:19.342811204"
+    },
+    "sarscov2 - [fastq1, fastq2], index, false, false - bam": {
+        "content": [
+            "test.bam",
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.bowtie2.log:md5,bd89ce1b28c93bf822bae391ffcedd19"
+                ]
+            ],
+            [
+
+            ],
+            [
+                "versions.yml:md5,01d18ab035146ea790e9a0f70adb758f"
+            ]
+        ],
+        "timestamp": "2023-11-23T11:40:46.647809118"
+    },
+    "sarscov2 - [fastq1, fastq2], index, false, true - bam": {
+        "content": [
+            "test.bam",
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.bowtie2.log:md5,bd89ce1b28c93bf822bae391ffcedd19"
+                ]
+            ],
+            [
+
+            ],
+            [
+                "versions.yml:md5,01d18ab035146ea790e9a0f70adb758f"
+            ]
+        ],
+        "timestamp": "2023-11-23T11:40:54.988626035"
+    }
+}
diff --git a/modules/nf-core/bowtie2/align/tests/sam.config b/modules/nf-core/bowtie2/align/tests/sam.config
new file mode 100644
index 00000000..c1d8c358
--- /dev/null
+++ b/modules/nf-core/bowtie2/align/tests/sam.config
@@ -0,0 +1,5 @@
+process {
+    withName: BOWTIE2_ALIGN {
+        ext.args2 = '--output-fmt SAM'
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/bowtie2/align/tests/sam2.config b/modules/nf-core/bowtie2/align/tests/sam2.config
new file mode 100644
index 00000000..4e85ff0e
--- /dev/null
+++ b/modules/nf-core/bowtie2/align/tests/sam2.config
@@ -0,0 +1,5 @@
+process {
+    withName: BOWTIE2_ALIGN {
+        ext.args2 = '-O SAM'
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/bowtie2/align/tests/tags.yml b/modules/nf-core/bowtie2/align/tests/tags.yml
new file mode 100644
index 00000000..ac47d1c8
--- /dev/null
+++ b/modules/nf-core/bowtie2/align/tests/tags.yml
@@ -0,0 +1,2 @@
+bowtie2/align:
+  - modules/nf-core/bowtie2/align/**
diff --git a/modules/nf-core/bowtie2/build/environment.yml b/modules/nf-core/bowtie2/build/environment.yml
new file mode 100644
index 00000000..22bbfc37
--- /dev/null
+++ b/modules/nf-core/bowtie2/build/environment.yml
@@ -0,0 +1,7 @@
+name: bowtie2_build
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::bowtie2=2.5.2
diff --git a/modules/nf-core/bowtie2/build/main.nf b/modules/nf-core/bowtie2/build/main.nf
index 551893af..9e2e0e5e 100644
--- a/modules/nf-core/bowtie2/build/main.nf
+++ b/modules/nf-core/bowtie2/build/main.nf
@@ -2,10 +2,10 @@ process BOWTIE2_BUILD {
     tag "$fasta"
     label 'process_high'
 
-    conda "bioconda::bowtie2=2.4.4"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/bowtie2:2.4.4--py39hbb4e92a_0' :
-        'quay.io/biocontainers/bowtie2:2.4.4--py39hbb4e92a_0' }"
+        'https://depot.galaxyproject.org/singularity/bowtie2:2.5.2--py39h6fed5c7_0' :
+        'biocontainers/bowtie2:2.5.2--py39h6fed5c7_0' }"
 
     input:
     tuple val(meta), path(fasta)
@@ -27,4 +27,16 @@ process BOWTIE2_BUILD {
         bowtie2: \$(echo \$(bowtie2 --version 2>&1) | sed 's/^.*bowtie2-align-s version //; s/ .*\$//')
     END_VERSIONS
     """
+
+    stub:
+    """
+    mkdir bowtie2
+    touch bowtie2/${fasta.baseName}.{1..4}.bt2
+    touch bowtie2/${fasta.baseName}.rev.{1,2}.bt2
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        bowtie2: \$(echo \$(bowtie2 --version 2>&1) | sed 's/^.*bowtie2-align-s version //; s/ .*\$//')
+    END_VERSIONS
+    """
 }
diff --git a/modules/nf-core/bowtie2/build/meta.yml b/modules/nf-core/bowtie2/build/meta.yml
index 0240224d..2d687991 100644
--- a/modules/nf-core/bowtie2/build/meta.yml
+++ b/modules/nf-core/bowtie2/build/meta.yml
@@ -41,3 +41,6 @@ output:
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
diff --git a/modules/nf-core/bowtie2/build/tests/main.nf.test b/modules/nf-core/bowtie2/build/tests/main.nf.test
new file mode 100644
index 00000000..16376025
--- /dev/null
+++ b/modules/nf-core/bowtie2/build/tests/main.nf.test
@@ -0,0 +1,31 @@
+nextflow_process {
+
+    name "Test Process BOWTIE2_BUILD"
+    script "modules/nf-core/bowtie2/build/main.nf"
+    process "BOWTIE2_BUILD"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "bowtie2"
+    tag "bowtie2/build"
+
+    test("Should run without failures") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ],
+                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assert process.success
+            assert snapshot(process.out).match()
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/bowtie2/build/tests/main.nf.test.snap b/modules/nf-core/bowtie2/build/tests/main.nf.test.snap
new file mode 100644
index 00000000..6875e021
--- /dev/null
+++ b/modules/nf-core/bowtie2/build/tests/main.nf.test.snap
@@ -0,0 +1,45 @@
+{
+    "Should run without failures": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        [
+                            "genome.1.bt2:md5,cbe3d0bbea55bc57c99b4bfa25b5fbdf",
+                            "genome.2.bt2:md5,47b153cd1319abc88dda532462651fcf",
+                            "genome.3.bt2:md5,4ed93abba181d8dfab2e303e33114777",
+                            "genome.4.bt2:md5,c25be5f8b0378abf7a58c8a880b87626",
+                            "genome.rev.1.bt2:md5,52be6950579598a990570fbcf5372184",
+                            "genome.rev.2.bt2:md5,e3b4ef343dea4dd571642010a7d09597"
+                        ]
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,1df11e9b82891527271c889c880d3974"
+                ],
+                "index": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        [
+                            "genome.1.bt2:md5,cbe3d0bbea55bc57c99b4bfa25b5fbdf",
+                            "genome.2.bt2:md5,47b153cd1319abc88dda532462651fcf",
+                            "genome.3.bt2:md5,4ed93abba181d8dfab2e303e33114777",
+                            "genome.4.bt2:md5,c25be5f8b0378abf7a58c8a880b87626",
+                            "genome.rev.1.bt2:md5,52be6950579598a990570fbcf5372184",
+                            "genome.rev.2.bt2:md5,e3b4ef343dea4dd571642010a7d09597"
+                        ]
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,1df11e9b82891527271c889c880d3974"
+                ]
+            }
+        ],
+        "timestamp": "2023-11-23T11:51:01.107681997"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/bowtie2/build/tests/tags.yml b/modules/nf-core/bowtie2/build/tests/tags.yml
new file mode 100644
index 00000000..81aa61da
--- /dev/null
+++ b/modules/nf-core/bowtie2/build/tests/tags.yml
@@ -0,0 +1,2 @@
+bowtie2/build:
+  - modules/nf-core/bowtie2/build/**
diff --git a/modules/nf-core/cat/fastq/environment.yml b/modules/nf-core/cat/fastq/environment.yml
new file mode 100644
index 00000000..bff93add
--- /dev/null
+++ b/modules/nf-core/cat/fastq/environment.yml
@@ -0,0 +1,7 @@
+name: cat_fastq
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - conda-forge::sed=4.7
diff --git a/modules/nf-core/cat/fastq/main.nf b/modules/nf-core/cat/fastq/main.nf
index 8a0b5600..3d963784 100644
--- a/modules/nf-core/cat/fastq/main.nf
+++ b/modules/nf-core/cat/fastq/main.nf
@@ -2,10 +2,10 @@ process CAT_FASTQ {
     tag "$meta.id"
     label 'process_single'
 
-    conda "conda-forge::sed=4.7"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/ubuntu:20.04' :
-        'ubuntu:20.04' }"
+        'nf-core/ubuntu:20.04' }"
 
     input:
     tuple val(meta), path(reads, stageAs: "input*/*")
diff --git a/modules/nf-core/cat/fastq/meta.yml b/modules/nf-core/cat/fastq/meta.yml
index c836598e..db4ac3c7 100644
--- a/modules/nf-core/cat/fastq/meta.yml
+++ b/modules/nf-core/cat/fastq/meta.yml
@@ -1,6 +1,7 @@
 name: cat_fastq
 description: Concatenates fastq files
 keywords:
+  - cat
   - fastq
   - concatenate
 tools:
@@ -16,7 +17,7 @@ input:
         Groovy Map containing sample information
         e.g. [ id:'test', single_end:false ]
   - reads:
-      type: list
+      type: file
       description: |
         List of input FastQ files to be concatenated.
 output:
@@ -33,7 +34,9 @@ output:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test b/modules/nf-core/cat/fastq/tests/main.nf.test
new file mode 100644
index 00000000..f5f94182
--- /dev/null
+++ b/modules/nf-core/cat/fastq/tests/main.nf.test
@@ -0,0 +1,143 @@
+nextflow_process {
+
+    name "Test Process CAT_FASTQ"
+    script "../main.nf"
+    process "CAT_FASTQ"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "cat"
+    tag "cat/fastq"
+
+    test("test_cat_fastq_single_end") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [
+                            [ id:'test', single_end:true ], // meta map
+                            [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                            file(params.test_data['sarscov2']['illumina']['test2_1_fastq_gz'], checkIfExists: true) ]
+                        ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out.reads).match() },
+                { assert path(process.out.versions.get(0)).getText().contains("cat") }
+            )
+        }
+    }
+
+    test("test_cat_fastq_paired_end") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                    file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true),
+                    file(params.test_data['sarscov2']['illumina']['test2_1_fastq_gz'], checkIfExists: true),
+                    file(params.test_data['sarscov2']['illumina']['test2_2_fastq_gz'], checkIfExists: true) ]
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out.reads).match() },
+                { assert path(process.out.versions.get(0)).getText().contains("cat") }
+            )
+        }
+    }
+
+    test("test_cat_fastq_single_end_same_name") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                    file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ]
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out.reads).match() },
+                { assert path(process.out.versions.get(0)).getText().contains("cat") }
+            )
+        }
+    }
+
+    test("test_cat_fastq_paired_end_same_name") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                    file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true),
+                    file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                    file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ]
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out.reads).match() },
+                { assert path(process.out.versions.get(0)).getText().contains("cat") }
+            )
+        }
+    }
+
+    test("test_cat_fastq_single_end_single_file") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)]
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out.reads).match() },
+                { assert path(process.out.versions.get(0)).getText().contains("cat") }
+            )
+        }
+    }
+}
diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test.snap b/modules/nf-core/cat/fastq/tests/main.nf.test.snap
new file mode 100644
index 00000000..ec2342e5
--- /dev/null
+++ b/modules/nf-core/cat/fastq/tests/main.nf.test.snap
@@ -0,0 +1,78 @@
+{
+    "test_cat_fastq_single_end": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.merged.fastq.gz:md5,f9cf5e375f7de81a406144a2c70cc64d"
+                ]
+            ]
+        ],
+        "timestamp": "2023-10-17T23:19:12.990284837"
+    },
+    "test_cat_fastq_single_end_same_name": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.merged.fastq.gz:md5,63f817db7a29a03eb538104495556f66"
+                ]
+            ]
+        ],
+        "timestamp": "2023-10-17T23:19:31.554568147"
+    },
+    "test_cat_fastq_single_end_single_file": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.merged.fastq.gz:md5,e325ef7deb4023447a1f074e285761af"
+                ]
+            ]
+        ],
+        "timestamp": "2023-10-17T23:19:49.629360033"
+    },
+    "test_cat_fastq_paired_end_same_name": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.merged.fastq.gz:md5,63f817db7a29a03eb538104495556f66",
+                        "test_2.merged.fastq.gz:md5,fe9f266f43a6fc3dcab690a18419a56e"
+                    ]
+                ]
+            ]
+        ],
+        "timestamp": "2023-10-17T23:19:40.711617539"
+    },
+    "test_cat_fastq_paired_end": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.merged.fastq.gz:md5,f9cf5e375f7de81a406144a2c70cc64d",
+                        "test_2.merged.fastq.gz:md5,77c8e966e130d8c6b6ec9be52fcb2bda"
+                    ]
+                ]
+            ]
+        ],
+        "timestamp": "2023-10-18T07:53:20.923560211"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/cat/fastq/tests/tags.yml b/modules/nf-core/cat/fastq/tests/tags.yml
new file mode 100644
index 00000000..6ac43614
--- /dev/null
+++ b/modules/nf-core/cat/fastq/tests/tags.yml
@@ -0,0 +1,2 @@
+cat/fastq:
+  - modules/nf-core/cat/fastq/**
diff --git a/modules/nf-core/custom/dumpsoftwareversions/custom-dumpsoftwareversions.diff b/modules/nf-core/custom/dumpsoftwareversions/custom-dumpsoftwareversions.diff
deleted file mode 100644
index 4746ec46..00000000
--- a/modules/nf-core/custom/dumpsoftwareversions/custom-dumpsoftwareversions.diff
+++ /dev/null
@@ -1,14 +0,0 @@
-Changes in module 'nf-core/custom/dumpsoftwareversions'
---- modules/nf-core/custom/dumpsoftwareversions/main.nf
-+++ modules/nf-core/custom/dumpsoftwareversions/main.nf
-@@ -5,7 +5,7 @@
-     conda "bioconda::multiqc=1.15"
-     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-         'https://depot.galaxyproject.org/singularity/multiqc:1.15--pyhdfd78af_0' :
--        'biocontainers/multiqc:1.15--pyhdfd78af_0' }"
-+        'quay.io/biocontainers/multiqc:1.15--pyhdfd78af_0' }"
- 
-     input:
-     path versions
-
-************************************************************
diff --git a/modules/nf-core/custom/dumpsoftwareversions/environment.yml b/modules/nf-core/custom/dumpsoftwareversions/environment.yml
new file mode 100644
index 00000000..f0c63f69
--- /dev/null
+++ b/modules/nf-core/custom/dumpsoftwareversions/environment.yml
@@ -0,0 +1,7 @@
+name: custom_dumpsoftwareversions
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::multiqc=1.17
diff --git a/modules/nf-core/custom/dumpsoftwareversions/main.nf b/modules/nf-core/custom/dumpsoftwareversions/main.nf
index d54a27fd..7685b33c 100644
--- a/modules/nf-core/custom/dumpsoftwareversions/main.nf
+++ b/modules/nf-core/custom/dumpsoftwareversions/main.nf
@@ -2,10 +2,10 @@ process CUSTOM_DUMPSOFTWAREVERSIONS {
     label 'process_single'
 
     // Requires `pyyaml` which does not have a dedicated container but is in the MultiQC container
-    conda "bioconda::multiqc=1.15"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/multiqc:1.15--pyhdfd78af_0' :
-        'quay.io/biocontainers/multiqc:1.15--pyhdfd78af_0' }"
+        'https://depot.galaxyproject.org/singularity/multiqc:1.17--pyhdfd78af_0' :
+        'biocontainers/multiqc:1.17--pyhdfd78af_0' }"
 
     input:
     path versions
diff --git a/modules/nf-core/custom/dumpsoftwareversions/meta.yml b/modules/nf-core/custom/dumpsoftwareversions/meta.yml
index c32657de..5f15a5fd 100644
--- a/modules/nf-core/custom/dumpsoftwareversions/meta.yml
+++ b/modules/nf-core/custom/dumpsoftwareversions/meta.yml
@@ -1,4 +1,4 @@
-# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/yaml-schema.json
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json
 name: custom_dumpsoftwareversions
 description: Custom module used to dump software versions within the nf-core pipeline template
 keywords:
@@ -16,7 +16,6 @@ input:
       type: file
       description: YML file containing software versions
       pattern: "*.yml"
-
 output:
   - yml:
       type: file
@@ -30,7 +29,9 @@ output:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-
 authors:
   - "@drpatelh"
   - "@grst"
+maintainers:
+  - "@drpatelh"
+  - "@grst"
diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test
new file mode 100644
index 00000000..eec1db10
--- /dev/null
+++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test
@@ -0,0 +1,38 @@
+nextflow_process {
+
+    name "Test Process CUSTOM_DUMPSOFTWAREVERSIONS"
+    script "../main.nf"
+    process "CUSTOM_DUMPSOFTWAREVERSIONS"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "custom"
+    tag "dumpsoftwareversions"
+    tag "custom/dumpsoftwareversions"
+
+    test("Should run without failures") {
+        when {
+            process {
+                """
+                def tool1_version = '''
+                TOOL1:
+                    tool1: 0.11.9
+                '''.stripIndent()
+
+                def tool2_version = '''
+                TOOL2:
+                    tool2: 1.9
+                '''.stripIndent()
+
+                input[0] = Channel.of(tool1_version, tool2_version).collectFile()
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+    }
+}
diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap
new file mode 100644
index 00000000..4274ed57
--- /dev/null
+++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap
@@ -0,0 +1,27 @@
+{
+    "Should run without failures": {
+        "content": [
+            {
+                "0": [
+                    "software_versions.yml:md5,1c851188476409cda5752ce971b20b58"
+                ],
+                "1": [
+                    "software_versions_mqc.yml:md5,2570f4ba271ad08357b0d3d32a9cf84d"
+                ],
+                "2": [
+                    "versions.yml:md5,3843ac526e762117eedf8825b40683df"
+                ],
+                "mqc_yml": [
+                    "software_versions_mqc.yml:md5,2570f4ba271ad08357b0d3d32a9cf84d"
+                ],
+                "versions": [
+                    "versions.yml:md5,3843ac526e762117eedf8825b40683df"
+                ],
+                "yml": [
+                    "software_versions.yml:md5,1c851188476409cda5752ce971b20b58"
+                ]
+            }
+        ],
+        "timestamp": "2023-11-03T14:43:22.157011"
+    }
+}
diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml
new file mode 100644
index 00000000..405aa24a
--- /dev/null
+++ b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml
@@ -0,0 +1,2 @@
+custom/dumpsoftwareversions:
+  - modules/nf-core/custom/dumpsoftwareversions/**
diff --git a/modules/nf-core/custom/getchromsizes/environment.yml b/modules/nf-core/custom/getchromsizes/environment.yml
new file mode 100644
index 00000000..2a01695f
--- /dev/null
+++ b/modules/nf-core/custom/getchromsizes/environment.yml
@@ -0,0 +1,7 @@
+name: custom_getchromsizes
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::samtools=1.16.1
diff --git a/modules/nf-core/custom/getchromsizes/main.nf b/modules/nf-core/custom/getchromsizes/main.nf
index 580f87fe..e8084ea2 100644
--- a/modules/nf-core/custom/getchromsizes/main.nf
+++ b/modules/nf-core/custom/getchromsizes/main.nf
@@ -2,10 +2,10 @@ process CUSTOM_GETCHROMSIZES {
     tag "$fasta"
     label 'process_single'
 
-    conda "bioconda::samtools=1.16.1"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' :
-        'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }"
+        'biocontainers/samtools:1.16.1--h6899075_1' }"
 
     input:
     tuple val(meta), path(fasta)
diff --git a/modules/nf-core/custom/getchromsizes/meta.yml b/modules/nf-core/custom/getchromsizes/meta.yml
index 219ca1d8..529be07e 100644
--- a/modules/nf-core/custom/getchromsizes/meta.yml
+++ b/modules/nf-core/custom/getchromsizes/meta.yml
@@ -12,7 +12,6 @@ tools:
       tool_dev_url: https://github.com/samtools/samtools
       doi: 10.1093/bioinformatics/btp352
       licence: ["MIT"]
-
 input:
   - meta:
       type: map
@@ -23,7 +22,6 @@ input:
       type: file
       description: FASTA file
       pattern: "*.{fa,fasta,fna,fas}"
-
 output:
   - meta:
       type: map
@@ -46,8 +44,11 @@ output:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-
 authors:
   - "@tamara-hodgetts"
   - "@chris-cheshire"
   - "@muffato"
+maintainers:
+  - "@tamara-hodgetts"
+  - "@chris-cheshire"
+  - "@muffato"
diff --git a/modules/nf-core/custom/getchromsizes/tests/main.nf.test b/modules/nf-core/custom/getchromsizes/tests/main.nf.test
new file mode 100644
index 00000000..844bd996
--- /dev/null
+++ b/modules/nf-core/custom/getchromsizes/tests/main.nf.test
@@ -0,0 +1,60 @@
+nextflow_process {
+
+    name "Test Process CUSTOM_GETCHROMSIZES"
+    script "../main.nf"
+    process "CUSTOM_GETCHROMSIZES"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "custom"
+    tag "custom/getchromsizes"
+
+    test("test_custom_getchromsizes") {
+
+        when {
+            params {
+                outdir = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [ [ id:'test', single_end:false ], // meta map
+                             file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                           ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("test_custom_getchromsizes_bgzip") {
+
+        when {
+            params {
+                outdir = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [ [ id:'test', single_end:false ], // meta map
+                             file(params.test_data['sarscov2']['genome']['genome_fasta_gz'], checkIfExists: true)
+                           ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap b/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap
new file mode 100644
index 00000000..142298ee
--- /dev/null
+++ b/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap
@@ -0,0 +1,124 @@
+{
+    "test_custom_getchromsizes": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "genome.fasta.sizes:md5,a57c401f27ae5133823fb09fb21c8a3c"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5"
+                    ]
+                ],
+                "2": [
+                    
+                ],
+                "3": [
+                    "versions.yml:md5,45a83c5f3dddbc5dcab30035169f7ce8"
+                ],
+                "fai": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5"
+                    ]
+                ],
+                "gzi": [
+                    
+                ],
+                "sizes": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "genome.fasta.sizes:md5,a57c401f27ae5133823fb09fb21c8a3c"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,45a83c5f3dddbc5dcab30035169f7ce8"
+                ]
+            }
+        ],
+        "timestamp": "2023-10-17T10:20:42.652464"
+    },
+    "test_custom_getchromsizes_bgzip": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "genome.fasta.gz.sizes:md5,a57c401f27ae5133823fb09fb21c8a3c"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5"
+                    ]
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474"
+                    ]
+                ],
+                "3": [
+                    "versions.yml:md5,45a83c5f3dddbc5dcab30035169f7ce8"
+                ],
+                "fai": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5"
+                    ]
+                ],
+                "gzi": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474"
+                    ]
+                ],
+                "sizes": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "genome.fasta.gz.sizes:md5,a57c401f27ae5133823fb09fb21c8a3c"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,45a83c5f3dddbc5dcab30035169f7ce8"
+                ]
+            }
+        ],
+        "timestamp": "2023-10-17T10:22:25.185203"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/custom/getchromsizes/tests/tags.yml b/modules/nf-core/custom/getchromsizes/tests/tags.yml
new file mode 100644
index 00000000..d89a805f
--- /dev/null
+++ b/modules/nf-core/custom/getchromsizes/tests/tags.yml
@@ -0,0 +1,2 @@
+custom/getchromsizes:
+  - modules/nf-core/custom/getchromsizes/**
diff --git a/modules/nf-core/fastp/environment.yml b/modules/nf-core/fastp/environment.yml
new file mode 100644
index 00000000..70389e66
--- /dev/null
+++ b/modules/nf-core/fastp/environment.yml
@@ -0,0 +1,7 @@
+name: fastp
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::fastp=0.23.4
diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf
index 5eeb9b09..2a3b679e 100644
--- a/modules/nf-core/fastp/main.nf
+++ b/modules/nf-core/fastp/main.nf
@@ -2,10 +2,10 @@ process FASTP {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::fastp=0.23.2"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/fastp:0.23.2--h79da9fb_0' :
-        'quay.io/biocontainers/fastp:0.23.2--h79da9fb_0' }"
+        'https://depot.galaxyproject.org/singularity/fastp:0.23.4--h5f740d0_0' :
+        'biocontainers/fastp:0.23.4--h5f740d0_0' }"
 
     input:
     tuple val(meta), path(reads)
@@ -45,7 +45,7 @@ process FASTP {
             $adapter_list \\
             $fail_fastq \\
             $args \\
-            2> ${prefix}.fastp.log \\
+            2> >(tee ${prefix}.fastp.log >&2) \\
         | gzip -c > ${prefix}.fastp.fastq.gz
 
         cat <<-END_VERSIONS > versions.yml
@@ -66,7 +66,7 @@ process FASTP {
             $adapter_list \\
             $fail_fastq \\
             $args \\
-            2> ${prefix}.fastp.log
+            2> >(tee ${prefix}.fastp.log >&2)
 
         cat <<-END_VERSIONS > versions.yml
         "${task.process}":
@@ -91,7 +91,7 @@ process FASTP {
             --thread $task.cpus \\
             --detect_adapter_for_pe \\
             $args \\
-            2> ${prefix}.fastp.log
+            2> >(tee ${prefix}.fastp.log >&2)
 
         cat <<-END_VERSIONS > versions.yml
         "${task.process}":
@@ -99,4 +99,22 @@ process FASTP {
         END_VERSIONS
         """
     }
+
+    stub:
+    def prefix              = task.ext.prefix ?: "${meta.id}"
+    def is_single_output    = task.ext.args?.contains('--interleaved_in') || meta.single_end
+    def touch_reads         = is_single_output ? "${prefix}.fastp.fastq.gz" : "${prefix}_1.fastp.fastq.gz ${prefix}_2.fastp.fastq.gz"
+    def touch_merged        = (!is_single_output && save_merged) ? "touch ${prefix}.merged.fastq.gz" : ""
+    """
+    touch $touch_reads
+    touch "${prefix}.fastp.json"
+    touch "${prefix}.fastp.html"
+    touch "${prefix}.fastp.log"
+    $touch_merged
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        fastp: \$(fastp --version 2>&1 | sed -e "s/fastp //g")
+    END_VERSIONS
+    """
 }
diff --git a/modules/nf-core/fastp/meta.yml b/modules/nf-core/fastp/meta.yml
index 197ea7ca..c22a16ab 100644
--- a/modules/nf-core/fastp/meta.yml
+++ b/modules/nf-core/fastp/meta.yml
@@ -33,7 +33,6 @@ input:
   - save_merged:
       type: boolean
       description: Specify true to save all merged reads to the a file ending in `*.merged.fastq.gz`
-
 output:
   - meta:
       type: map
@@ -71,3 +70,6 @@ output:
 authors:
   - "@drpatelh"
   - "@kevinmenden"
+maintainers:
+  - "@drpatelh"
+  - "@kevinmenden"
diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test
new file mode 100644
index 00000000..17dce8ac
--- /dev/null
+++ b/modules/nf-core/fastp/tests/main.nf.test
@@ -0,0 +1,726 @@
+nextflow_process {
+
+    name "Test Process FASTP"
+    script "../main.nf"
+    process "FASTP"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "fastp"
+
+    test("test_fastp_single_end") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+
+                input[0] = [
+                    [ id:'test', single_end:true ],
+                    [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ]
+                ]
+
+                input[1] = adapter_fasta
+                input[2] = save_trimmed_fail
+                input[3] = save_merged
+                """
+            }
+        }
+
+        then {
+            def html_text  = [ "Q20 bases:</td><td class='col2'>12.922000 K (92.984097%)",
+                                "single end (151 cycles)" ]
+            def log_text   = [ "Q20 bases: 12922(92.9841%)",
+								"reads passed filter: 99" ]
+            def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
+								"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
+								"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAA",
+								"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/1",
+								"ACTGTTTTCTTTGTAGAAAACATCCGTAATAGGACCTTTGTATTCTGAGGACTTTGTAAGTAAAGCACCGTCTATGC",
+								"AAA6AEEEEEEEEEAEEE/6EEAEEEAEEEEEAEEEEEEEEEEEEEEEEEEEEE<AAEEEEEEEEEEE</EEEA/AE"]
+            assertAll(
+                { assert process.success },
+                { read_lines.each { read_line ->
+                    { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) }
+                    }
+                },
+                { html_text.each { html_part ->
+                    { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
+                    }
+                },
+                { assert snapshot(process.out.json).match("test_fastp_single_end_json") },
+                { log_text.each { log_part ->
+                    { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
+                    }
+                },
+                {
+                    assert snapshot(
+                        (
+                            [process.out.reads[0][0].toString()] + // meta
+                            process.out.reads.collect { file(it[1]).getName() } +
+                            process.out.json.collect { file(it[1]).getName() } +
+                            process.out.html.collect { file(it[1]).getName() } +
+                            process.out.log.collect { file(it[1]).getName() } +
+                            process.out.reads_fail.collect { file(it[1]).getName() } +
+                            process.out.reads_merged.collect { file(it[1]).getName() }
+                        ).sort()
+                    ).match("test_fastp_single_end-for_stub_match")
+                },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+    }
+
+    test("test_fastp_single_end-stub") {
+
+        options '-stub'
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+
+                input[0] = [
+                    [ id:'test', single_end:true ],
+                    [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ]
+                ]
+
+                input[1] = adapter_fasta
+                input[2] = save_trimmed_fail
+                input[3] = save_merged
+                """
+            }
+        }
+
+        then {
+
+            assertAll(
+                { assert process.success },
+                {
+                    assert snapshot(
+                        (
+                            [process.out.reads[0][0].toString()] + // meta
+                            process.out.reads.collect { file(it[1]).getName() } +
+                            process.out.json.collect { file(it[1]).getName() } +
+                            process.out.html.collect { file(it[1]).getName() } +
+                            process.out.log.collect { file(it[1]).getName() } +
+                            process.out.reads_fail.collect { file(it[1]).getName() } +
+                            process.out.reads_merged.collect { file(it[1]).getName() }
+                        ).sort()
+                    ).match("test_fastp_single_end-for_stub_match")
+                },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+    }
+
+    test("test_fastp_paired_end") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                        file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ]
+                ]
+
+                input[1] = adapter_fasta
+                input[2] = save_trimmed_fail
+                input[3] = save_merged
+                """
+            }
+        }
+
+        then {
+            def html_text   = [ "Q20 bases:</td><td class='col2'>25.719000 K (93.033098%)",
+									"The input has little adapter percentage (~0.000000%), probably it's trimmed before."]
+            def log_text    = [ "No adapter detected for read1",
+									"Q30 bases: 12281(88.3716%)"]
+            def json_text   = ['"passed_filter_reads": 198']
+            def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
+									"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
+									"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAA",
+									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/1",
+									"ACTGTTTTCTTTGTAGAAAACATCCGTAATAGGACCTTTGTATTCTGAGGACTTTGTAAGTAAAGCACCGTCTATGC",
+									"AAA6AEEEEEEEEEAEEE/6EEAEEEAEEEEEAEEEEEEEEEEEEEEEEEEEEE<AAEEEEEEEEEEE</EEEA/AE"]
+            def read2_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/2",
+									"ATGTGTACATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTG",
+									"AAAAAEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEEEEAEEEEEAAEEEEEEEEEAAEAAA<<EAAEEEEEEEAAA<<<AE",
+									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/2",
+									"GCATAGACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAGT",
+									"AAAAA6EEAEEEEEAEEAEEAEEEEEEA6EEEEAEEAEEEEE6EEEEEEAEEEEA///A<<EEEEEEEEEAEEEEEE"]
+            assertAll(
+                { assert process.success },
+                { read1_lines.each { read1_line ->
+                    { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
+                    }
+                },
+                { read2_lines.each { read2_line ->
+                    { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
+                    }
+                },
+                { html_text.each { html_part ->
+                    { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
+                    }
+                },
+                { json_text.each { json_part ->
+                    { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
+                    }
+                },
+                { log_text.each { log_part ->
+                    { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
+                    }
+                },
+                {
+                    assert snapshot(
+                        (
+                            [process.out.reads[0][0].toString()] + // meta
+                            process.out.reads.collect { it[1].collect { item -> file(item).getName() } } +
+                            process.out.json.collect { file(it[1]).getName() } +
+                            process.out.html.collect { file(it[1]).getName() } +
+                            process.out.log.collect { file(it[1]).getName() } +
+                            process.out.reads_fail.collect { file(it[1]).getName() } +
+                            process.out.reads_merged.collect { file(it[1]).getName() }
+                        ).sort()
+                    ).match("test_fastp_paired_end-for_stub_match")
+                },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+    }
+
+    test("test_fastp_paired_end-stub") {
+
+        options '-stub'
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                        file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ]
+                ]
+
+                input[1] = adapter_fasta
+                input[2] = save_trimmed_fail
+                input[3] = save_merged
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                {
+                    assert snapshot(
+                        (
+                            [process.out.reads[0][0].toString()] + // meta
+                            process.out.reads.collect { it[1].collect { item -> file(item).getName() } } +
+                            process.out.json.collect { file(it[1]).getName() } +
+                            process.out.html.collect { file(it[1]).getName() } +
+                            process.out.log.collect { file(it[1]).getName() } +
+                            process.out.reads_fail.collect { file(it[1]).getName() } +
+                            process.out.reads_merged.collect { file(it[1]).getName() }
+                        ).sort()
+                    ).match("test_fastp_paired_end-for_stub_match")
+                },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+    }
+
+    test("fastp test_fastp_interleaved") {
+        config './nextflow.config'
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+
+                input[0] = [ [ id:'test', single_end:true ], // meta map
+                            [ file(params.test_data['sarscov2']['illumina']['test_interleaved_fastq_gz'], checkIfExists: true) ]
+                        ]
+
+                input[1] = adapter_fasta
+                input[2] = save_trimmed_fail
+                input[3] = save_merged
+                """
+            }
+        }
+
+        then {
+            def html_text  = [ "Q20 bases:</td><td class='col2'>25.719000 K (93.033098%)",
+									"paired end (151 cycles + 151 cycles)"]
+            def log_text   = [ "Q20 bases: 12922(92.9841%)",
+									"reads passed filter: 198"]
+            def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
+									"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
+									"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAA",
+									"@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/2",
+									"ATGTGTACATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTG",
+									"AAAAAEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEEEEAEEEEEAAEEEEEEEEEAAEAAA<<EAAEEEEEEEAAA<<<AE"]
+            assertAll(
+                { assert process.success },
+                { read_lines.each { read_line ->
+                    { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) }
+                    }
+                },
+                { html_text.each { html_part ->
+                    { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
+                    }
+                },
+                { assert snapshot(process.out.json).match("fastp test_fastp_interleaved_json") },
+                { log_text.each { log_part ->
+                    { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
+                    }
+                },
+                {
+                    assert snapshot(
+                        (
+                            [process.out.reads[0][0].toString()] + // meta
+                            process.out.reads.collect { file(it[1]).getName() } +
+                            process.out.json.collect { file(it[1]).getName() } +
+                            process.out.html.collect { file(it[1]).getName() } +
+                            process.out.log.collect { file(it[1]).getName() } +
+                            process.out.reads_fail.collect { file(it[1]).getName() } +
+                            process.out.reads_merged.collect { file(it[1]).getName() }
+                        ).sort()
+                    ).match("test_fastp_interleaved-for_stub_match")
+                },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+    }
+
+    test("fastp test_fastp_interleaved-stub") {
+
+        options '-stub'
+
+        config './nextflow.config'
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = false
+
+                input[0] = [ [ id:'test', single_end:true ], // meta map
+                            [ file(params.test_data['sarscov2']['illumina']['test_interleaved_fastq_gz'], checkIfExists: true) ]
+                        ]
+
+                input[1] = adapter_fasta
+                input[2] = save_trimmed_fail
+                input[3] = save_merged
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                {
+                    assert snapshot(
+                        (
+                            [process.out.reads[0][0].toString()] + // meta
+                            process.out.reads.collect { file(it[1]).getName() } +
+                            process.out.json.collect { file(it[1]).getName() } +
+                            process.out.html.collect { file(it[1]).getName() } +
+                            process.out.log.collect { file(it[1]).getName() } +
+                            process.out.reads_fail.collect { file(it[1]).getName() } +
+                            process.out.reads_merged.collect { file(it[1]).getName() }
+                        ).sort()
+                    ).match("test_fastp_interleaved-for_stub_match")
+                },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+    }
+
+    test("test_fastp_single_end_trim_fail") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                adapter_fasta     = []
+                save_trimmed_fail = true
+                save_merged       = false
+
+                input[0] = [ [ id:'test', single_end:true ], // meta map
+                            [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ]
+                        ]
+                input[1] = adapter_fasta
+                input[2] = save_trimmed_fail
+                input[3] = save_merged
+                """
+            }
+        }
+
+        then {
+            def html_text         = [ "Q20 bases:</td><td class='col2'>12.922000 K (92.984097%)",
+									"single end (151 cycles)"]
+            def log_text          = [ "Q20 bases: 12922(92.9841%)",
+									"reads passed filter: 99" ]
+            def read_lines        = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
+									"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
+									"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAA",
+									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/1",
+									"ACTGTTTTCTTTGTAGAAAACATCCGTAATAGGACCTTTGTATTCTGAGGACTTTGTAAGTAAAGCACCGTCTATGC",
+									"AAA6AEEEEEEEEEAEEE/6EEAEEEAEEEEEAEEEEEEEEEEEEEEEEEEEEE<AAEEEEEEEEEEE</EEEA/AE"]
+            def failed_read_lines = [ "@ERR5069949.885966 NS500628:121:HK3MMAFX2:4:11610:19682:20132/1 failed_quality_filter",
+									"GTCTAATCATAATTTCTTGGTACAGGCTGGTATTGTTCATCTCAGGGTTATTGGACATTCTATGCAAAATTGTGTACTT",
+									"AAA//E/EAA/E//E//E//E/E//AE/A/E//EAEA///AE//E///E/EEE6EEEAEEA///E/AEE/EAEE/E//E"]
+            assertAll(
+                { assert process.success },
+                { read_lines.each { read_line ->
+                    { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) }
+                    }
+                },
+                { failed_read_lines.each { failed_read_line ->
+                    { assert path(process.out.reads_fail.get(0).get(1)).linesGzip.contains(failed_read_line) }
+                    }
+                },
+                { html_text.each { html_part ->
+                    { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
+                    }
+                },
+                { assert snapshot(process.out.json).match("test_fastp_single_end_trim_fail_json") },
+                { log_text.each { log_part ->
+                    { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
+                    }
+                },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+    }
+
+    test("test_fastp_paired_end_trim_fail") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                adapter_fasta     = []
+                save_trimmed_fail = true
+                save_merged       = false
+
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                        file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
+                    ]
+                ]
+                input[1] = adapter_fasta
+                input[2] = save_trimmed_fail
+                input[3] = save_merged
+                """
+            }
+        }
+
+        then {
+            def html_text           = [ "Q20 bases:</td><td class='col2'>25.719000 K (93.033098%)",
+									"The input has little adapter percentage (~0.000000%), probably it's trimmed before."]
+            def log_text            = [ "No adapter detected for read1",
+									"Q30 bases: 12281(88.3716%)"]
+            def json_text           = ['"passed_filter_reads": 198']
+            def read1_lines         = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
+									"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
+									"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAA",
+									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/1",
+									"ACTGTTTTCTTTGTAGAAAACATCCGTAATAGGACCTTTGTATTCTGAGGACTTTGTAAGTAAAGCACCGTCTATGC",
+									"AAA6AEEEEEEEEEAEEE/6EEAEEEAEEEEEAEEEEEEEEEEEEEEEEEEEEE<AAEEEEEEEEEEE</EEEA/AE"]
+            def read2_lines         = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/2",
+									"ATGTGTACATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTG",
+									"AAAAAEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEEEEAEEEEEAAEEEEEEEEEAAEAAA<<EAAEEEEEEEAAA<<<AE",
+									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/2",
+									"GCATAGACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAGT",
+									"AAAAA6EEAEEEEEAEEAEEAEEEEEEA6EEEEAEEAEEEEE6EEEEEEAEEEEA///A<<EEEEEEEEEAEEEEEE"]
+            def failed_read2_lines  = ["@ERR5069949.885966 NS500628:121:HK3MMAFX2:4:11610:19682:20132/2",
+									"CTTAGGTCTTAGGATTGGCTGTATCAACCTTAAGCTTAAGTACACAATTTTGCATAGAATGTCCAATAA",
+									"A//AA6EEAEEEEE6EEE/EEA/EA///AAE/EAEEEAE6AE/E/E/EEAAE/EAA/E/E/<EA//E/6"]
+            // def failed_read1_lines = path(process.out.reads_fail.get(0).get(1).get(0)).linesGzip is empty file
+            assertAll(
+                { assert process.success },
+                { assert path(process.out.reads_fail.get(0).get(1).get(0)).exists() },
+                { read1_lines.each { read1_line ->
+                    { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
+                    }
+                },
+                { read2_lines.each { read2_line ->
+                    { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
+                    }
+                },
+                { failed_read2_lines.each { failed_read2_line ->
+                    { assert path(process.out.reads_fail.get(0).get(1).get(1)).linesGzip.contains(failed_read2_line) }
+                    }
+                },
+                { html_text.each { html_part ->
+                    { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
+                    }
+                },
+                { json_text.each { json_part ->
+                    { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
+                    }
+                },
+                { log_text.each { log_part ->
+                    { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
+                    }
+                },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+    }
+
+    test("test_fastp_paired_end_merged") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = true
+
+                input[0] = [ [ id:'test', single_end:false ], // meta map
+                             [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                               file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ]
+                           ]
+                input[1] = adapter_fasta
+                input[2] = save_trimmed_fail
+                input[3] = save_merged
+                """
+            }
+        }
+
+        then {
+            def html_text         = [ "<div id='After_filtering__merged__quality'>"]
+            def log_text          = [ "Merged and filtered:",
+									"total reads: 75",
+									"total bases: 13683"]
+            def json_text         = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683']
+            def read1_lines       = [ "@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1",
+									"CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC",
+									"AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE<AEEAEEEAEAEEEAEAEEAE/AEEEEAEEEEAEA",
+									"@ERR5069949.324865 NS500628:121:HK3MMAFX2:1:11102:17526:14721/1",
+									"CACAAACTCTAAAAGAATGTATAGGGTCAGCACCAAAAATACCAGCAGATAATAATGTTGCAAGTAGAACTTCGTGCAGATTAAAATTTTCATAAGCACTCTAAAGAAGTTGAATGTCTTCAAATTTCTTAACATTAGGGCCCACAACAAG",
+									"AAAAAEA/A<EAA/AE/EE/EE//////EA/EEE/E/EEEE//E/6//EA//<AA/A/EEEAA/EEEE/EEEA/E/</AEE////AEEEE//<E//EAE/A///<EEE//<E<<EEE<///A//E/E/EEEAA/<A////<A/AEAAA//E"]
+            def read2_lines       = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/2",
+									"GTACAAAAATAGCCTAAGAAACAATAAACTAGCATTATACACTGAAGTGTATTACCAGTTATGAAGAAAATAGGGCAATACTCAACACACATAAAAACAATACCTCTGGCCAAAAACATGACAGTTGTAACTACACCTGAGTAGTTAGAAG",
+									"AAAAAEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEAEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEA/EAA</EEEEEEEEEE/AE//A/E<AE<AA<AEEE/AAEAAAEEAEEA<A6AEEA<EEAEEEEEEEAA//EE",
+									"@ERR5069949.324865 NS500628:121:HK3MMAFX2:1:11102:17526:14721/2",
+									"ATGAATCTGATGAATACATAGCTACTAATGGACCTCTTAAAGTGCGTGGTAGTTGTGATTAAAGCGGACACATACTTGCTAAACACTCTCTTCATGATGTC",
+									"A/AAAEEEEA6AA6EE//EEA/EEEAE/EA/A////E</EEAA//EEA////EAE<///E/AEA</AAE/EA//E<EAAAE/AA//AEE//A/AE//</EE"]
+            def read_merged_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1 merged_150_37",
+									"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGTGGTGCAGGTAATTGAGCAGGGTCGCCAATGTACACAT",
+									"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAAEEEEEEEEEEEEEEEEEEEEE/EEEEEEEEEEAAAAA",
+									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/1 merged_77_0",
+									"ACTGTTTTCTTTGTAGAAAACATCCGTAATAGGACCTTTGTATTCTGAGGACTTTGTAAGTAAAGCACCGTCTATGC",
+									"AAA6AEEEEEEEEEAEEE/6EEAEEEAEEEEEAEEEEEEEEEEEEEEEEEEEEE<AAEEEEEEEEEEE</EEEA/AE"]
+            assertAll(
+                { assert process.success },
+                { read1_lines.each { read1_line ->
+                    { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
+                    }
+                },
+                { read2_lines.each { read2_line ->
+                    { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
+                    }
+                },
+                { read_merged_lines.each { read_merged_line ->
+                    { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) }
+                    }
+                },
+                { html_text.each { html_part ->
+                    { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
+                    }
+                },
+                { json_text.each { json_part ->
+                    { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
+                    }
+                },
+                { log_text.each { log_part ->
+                    { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
+                    }
+                },
+                {
+                    assert snapshot(
+                        (
+                            [process.out.reads[0][0].toString()] + // meta
+                            process.out.reads.collect { it[1].collect { item -> file(item).getName() } } +
+                            process.out.json.collect { file(it[1]).getName() } +
+                            process.out.html.collect { file(it[1]).getName() } +
+                            process.out.log.collect { file(it[1]).getName() } +
+                            process.out.reads_fail.collect { file(it[1]).getName() } +
+                            process.out.reads_merged.collect { file(it[1]).getName() }
+                        ).sort()
+                    ).match("test_fastp_paired_end_merged-for_stub_match")
+                },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+    }
+
+    test("test_fastp_paired_end_merged-stub") {
+
+        options '-stub'
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                adapter_fasta     = []
+                save_trimmed_fail = false
+                save_merged       = true
+
+                input[0] = [ [ id:'test', single_end:false ], // meta map
+                             [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                               file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ]
+                           ]
+                input[1] = adapter_fasta
+                input[2] = save_trimmed_fail
+                input[3] = save_merged
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                {
+                    assert snapshot(
+                        (
+                            [process.out.reads[0][0].toString()] + // meta
+                            process.out.reads.collect { it[1].collect { item -> file(item).getName() } } +
+                            process.out.json.collect { file(it[1]).getName() } +
+                            process.out.html.collect { file(it[1]).getName() } +
+                            process.out.log.collect { file(it[1]).getName() } +
+                            process.out.reads_fail.collect { file(it[1]).getName() } +
+                            process.out.reads_merged.collect { file(it[1]).getName() }
+                        ).sort()
+                    ).match("test_fastp_paired_end_merged-for_stub_match")
+                },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+    }
+
+    test("test_fastp_paired_end_merged_adapterlist") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                adapter_fasta     = file("https://github.com/nf-core/test-datasets/raw/modules/data/delete_me/fastp/adapters.fasta", checkIfExists: true)
+                save_trimmed_fail = false
+                save_merged       = true
+
+                input[0] = [ [ id:'test', single_end:false ], // meta map
+                             [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                               file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ]
+                           ]
+                input[1] = adapter_fasta
+                input[2] = save_trimmed_fail
+                input[3] = save_merged
+                """
+            }
+        }
+
+        then {
+            def html_text         = [ "<div id='After_filtering__merged__quality'>"]
+            def log_text          = [ "Merged and filtered:",
+									"total reads: 75",
+									"total bases: 13683"]
+            def json_text         = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683',"--adapter_fasta"]
+            def read1_lines       = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1",
+									"CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC",
+									"AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE<AEEAEEEAEAEEEAEAEEAE/AEEEEAEEEEAEA",
+									"@ERR5069949.324865 NS500628:121:HK3MMAFX2:1:11102:17526:14721/1",
+									"CACAAACTCTAAAAGAATGTATAGGGTCAGCACCAAAAATACCAGCAGATAATAATGTTGCAAGTAGAACTTCGTGCAGATTAAAATTTTCATAAGCACTCTAAAGAAGTTGAATGTCTTCAAATTTCTTAACATTAGGGCCCACAACAAG",
+									"AAAAAEA/A<EAA/AE/EE/EE//////EA/EEE/E/EEEE//E/6//EA//<AA/A/EEEAA/EEEE/EEEA/E/</AEE////AEEEE//<E//EAE/A///<EEE//<E<<EEE<///A//E/E/EEEAA/<A////<A/AEAAA//E"]
+            def read2_lines       = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/2",
+									"GTACAAAAATAGCCTAAGAAACAATAAACTAGCATTATACACTGAAGTGTATTACCAGTTATGAAGAAAATAGGGCAATACTCAACACACATAAAAACAATACCTCTGGCCAAAAACATGACAGTTGTAACTACACCTGAGTAGTTAGAAG",
+									"AAAAAEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEAEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEA/EAA</EEEEEEEEEE/AE//A/E<AE<AA<AEEE/AAEAAAEEAEEA<A6AEEA<EEAEEEEEEEAA//EE",
+									"@ERR5069949.324865 NS500628:121:HK3MMAFX2:1:11102:17526:14721/2",
+									"ATGAATCTGATGAATACATAGCTACTAATGGACCTCTTAAAGTGCGTGGTAGTTGTGATTAAAGCGGACACATACTTGCTAAACACTCTCTTCATGATGTC",
+									"A/AAAEEEEA6AA6EE//EEA/EEEAE/EA/A////E</EEAA//EEA////EAE<///E/AEA</AAE/EA//E<EAAAE/AA//AEE//A/AE//</EE"]
+            def read_merged_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1 merged_150_37",
+									"TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGTGGTGCAGGTAATTGAGCAGGGTCGCCAATGTACACAT",
+									"AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAAEEEEEEEEEEEEEEEEEEEEE/EEEEEEEEEEAAAAA",
+									"@ERR5069949.576388 NS500628:121:HK3MMAFX2:4:11501:11167:14939/1 merged_77_0",
+									"ACTGTTTTCTTTGTAGAAAACATCCGTAATAGGACCTTTGTATTCTGAGGACTTTGTAAGTAAAGCACCGTCTATGC",
+									"AAA6AEEEEEEEEEAEEE/6EEAEEEAEEEEEAEEEEEEEEEEEEEEEEEEEEE<AAEEEEEEEEEEE</EEEA/AE"]
+
+            assertAll(
+                { assert process.success },
+                { read1_lines.each { read1_line ->
+                    { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
+                    }
+                },
+                { read2_lines.each { read2_line ->
+                    { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
+                    }
+                },
+                { read_merged_lines.each { read_merged_line ->
+                    { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) }
+                    }
+                },
+                { html_text.each { html_part ->
+                    { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
+                    }
+                },
+                { json_text.each { json_part ->
+                    { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
+                    }
+                },
+                { log_text.each { log_part ->
+                    { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
+                    }
+                },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+    }
+}
diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap
new file mode 100644
index 00000000..1b7d2419
--- /dev/null
+++ b/modules/nf-core/fastp/tests/main.nf.test.snap
@@ -0,0 +1,107 @@
+{
+    "test_fastp_paired_end-for_stub_match": {
+        "content": [
+            [
+                [
+                    "test_1.fastp.fastq.gz",
+                    "test_2.fastp.fastq.gz"
+                ],
+                "test.fastp.html",
+                "test.fastp.json",
+                "test.fastp.log",
+                "{id=test, single_end=false}"
+            ]
+        ],
+        "timestamp": "2023-12-21T09:44:37.202512"
+    },
+    "fastp test_fastp_interleaved_json": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.fastp.json:md5,168f516f7bd4b7b6c32da7cba87299a4"
+                ]
+            ]
+        ],
+        "timestamp": "2023-10-17T11:04:45.794175881"
+    },
+    "test_fastp_paired_end_merged-for_stub_match": {
+        "content": [
+            [
+                [
+                    "test_1.fastp.fastq.gz",
+                    "test_2.fastp.fastq.gz"
+                ],
+                "test.fastp.html",
+                "test.fastp.json",
+                "test.fastp.log",
+                "test.merged.fastq.gz",
+                "{id=test, single_end=false}"
+            ]
+        ],
+        "timestamp": "2023-12-21T09:53:45.237014"
+    },
+    "test_fastp_single_end_json": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc"
+                ]
+            ]
+        ],
+        "timestamp": "2023-10-17T11:04:10.566343705"
+    },
+    "versions": {
+        "content": [
+            [
+                "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+            ]
+        ],
+        "timestamp": "2023-10-17T11:04:10.582076024"
+    },
+    "test_fastp_interleaved-for_stub_match": {
+        "content": [
+            [
+                "test.fastp.fastq.gz",
+                "test.fastp.html",
+                "test.fastp.json",
+                "test.fastp.log",
+                "{id=test, single_end=true}"
+            ]
+        ],
+        "timestamp": "2023-12-21T09:48:43.148485"
+    },
+    "test_fastp_single_end-for_stub_match": {
+        "content": [
+            [
+                "test.fastp.fastq.gz",
+                "test.fastp.html",
+                "test.fastp.json",
+                "test.fastp.log",
+                "{id=test, single_end=true}"
+            ]
+        ],
+        "timestamp": "2023-12-21T09:20:07.254788"
+    },
+    "test_fastp_single_end_trim_fail_json": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5"
+                ]
+            ]
+        ],
+        "timestamp": "2023-10-17T11:05:00.379878948"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/fastp/tests/nextflow.config b/modules/nf-core/fastp/tests/nextflow.config
new file mode 100644
index 00000000..0f7849ad
--- /dev/null
+++ b/modules/nf-core/fastp/tests/nextflow.config
@@ -0,0 +1,6 @@
+process {
+
+    withName: FASTP {
+        ext.args = "--interleaved_in"
+    }
+}
diff --git a/modules/nf-core/fastp/tests/tags.yml b/modules/nf-core/fastp/tests/tags.yml
new file mode 100644
index 00000000..c1afcce7
--- /dev/null
+++ b/modules/nf-core/fastp/tests/tags.yml
@@ -0,0 +1,2 @@
+fastp:
+  - modules/nf-core/fastp/**
diff --git a/modules/nf-core/fastqc/environment.yml b/modules/nf-core/fastqc/environment.yml
new file mode 100644
index 00000000..1787b38a
--- /dev/null
+++ b/modules/nf-core/fastqc/environment.yml
@@ -0,0 +1,7 @@
+name: fastqc
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::fastqc=0.12.1
diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf
index 9ae58381..9e19a74c 100644
--- a/modules/nf-core/fastqc/main.nf
+++ b/modules/nf-core/fastqc/main.nf
@@ -2,10 +2,10 @@ process FASTQC {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::fastqc=0.11.9"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/fastqc:0.11.9--0' :
-        'quay.io/biocontainers/fastqc:0.11.9--0' }"
+        'https://depot.galaxyproject.org/singularity/fastqc:0.12.1--hdfd78af_0' :
+        'biocontainers/fastqc:0.12.1--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(reads)
@@ -29,11 +29,15 @@ process FASTQC {
     printf "%s %s\\n" $rename_to | while read old_name new_name; do
         [ -f "\${new_name}" ] || ln -s \$old_name \$new_name
     done
-    fastqc $args --threads $task.cpus $renamed_files
+
+    fastqc \\
+        $args \\
+        --threads $task.cpus \\
+        $renamed_files
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
-        fastqc: \$( fastqc --version | sed -e "s/FastQC v//g" )
+        fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' )
     END_VERSIONS
     """
 
@@ -45,7 +49,7 @@ process FASTQC {
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
-        fastqc: \$( fastqc --version | sed -e "s/FastQC v//g" )
+        fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' )
     END_VERSIONS
     """
 }
diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml
index 4da5bb5a..ee5507e0 100644
--- a/modules/nf-core/fastqc/meta.yml
+++ b/modules/nf-core/fastqc/meta.yml
@@ -50,3 +50,8 @@ authors:
   - "@grst"
   - "@ewels"
   - "@FelixKrueger"
+maintainers:
+  - "@drpatelh"
+  - "@grst"
+  - "@ewels"
+  - "@FelixKrueger"
diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test
new file mode 100644
index 00000000..b9e8f926
--- /dev/null
+++ b/modules/nf-core/fastqc/tests/main.nf.test
@@ -0,0 +1,109 @@
+nextflow_process {
+
+    name "Test Process FASTQC"
+    script "../main.nf"
+    process "FASTQC"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "fastqc"
+
+    test("Single-Read") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [
+                    [ id: 'test', single_end:true ],
+                    [
+                        file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+                    ]
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+            { assert process.success },
+            // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it.
+            // looks like this: <div id="header_filename">Mon 2 Oct 2023<br/>test.gz</div>
+            // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039
+            { assert process.out.html.get(0).get(1) ==~ ".*/test_fastqc.html" },
+            { assert path(process.out.html.get(0).get(1)).getText().contains("<tr><td>File type</td><td>Conventional base calls</td></tr>") },
+            { assert snapshot(process.out.versions).match("versions") },
+            { assert process.out.zip.get(0).get(1) ==~ ".*/test_fastqc.zip" }
+            )
+        }
+    }
+// TODO
+// //
+// // Test with paired-end data
+// //
+// workflow test_fastqc_paired_end {
+//     input = [
+//                 [id: 'test', single_end: false], // meta map
+//                 [
+//                     file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+//                     file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
+//                 ]
+//             ]
+
+//     FASTQC ( input )
+// }
+
+// //
+// // Test with interleaved data
+// //
+// workflow test_fastqc_interleaved {
+//     input = [
+//                 [id: 'test', single_end: false], // meta map
+//                 file(params.test_data['sarscov2']['illumina']['test_interleaved_fastq_gz'], checkIfExists: true)
+//             ]
+
+//     FASTQC ( input )
+// }
+
+// //
+// // Test with bam data
+// //
+// workflow test_fastqc_bam {
+//     input = [
+//                 [id: 'test', single_end: false], // meta map
+//                 file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
+//             ]
+
+//     FASTQC ( input )
+// }
+
+// //
+// // Test with multiple samples
+// //
+// workflow test_fastqc_multiple {
+//     input = [
+//                 [id: 'test', single_end: false], // meta map
+//                 [
+//                     file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+//                     file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true),
+//                     file(params.test_data['sarscov2']['illumina']['test2_1_fastq_gz'], checkIfExists: true),
+//                     file(params.test_data['sarscov2']['illumina']['test2_2_fastq_gz'], checkIfExists: true)
+//                 ]
+//             ]
+
+//     FASTQC ( input )
+// }
+
+// //
+// // Test with custom prefix
+// //
+// workflow test_fastqc_custom_prefix {
+//     input = [
+//                 [ id:'mysample', single_end:true ], // meta map
+//                 file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+//             ]
+
+//     FASTQC ( input )
+// }
+}
diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap
new file mode 100644
index 00000000..636a32ce
--- /dev/null
+++ b/modules/nf-core/fastqc/tests/main.nf.test.snap
@@ -0,0 +1,10 @@
+{
+    "versions": {
+        "content": [
+            [
+                "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+            ]
+        ],
+        "timestamp": "2023-10-09T23:40:54+0000"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/fastqc/tests/tags.yml b/modules/nf-core/fastqc/tests/tags.yml
new file mode 100644
index 00000000..7834294b
--- /dev/null
+++ b/modules/nf-core/fastqc/tests/tags.yml
@@ -0,0 +1,2 @@
+fastqc:
+  - modules/nf-core/fastqc/**
diff --git a/modules/nf-core/freyja/boot/environment.yml b/modules/nf-core/freyja/boot/environment.yml
new file mode 100644
index 00000000..71c285aa
--- /dev/null
+++ b/modules/nf-core/freyja/boot/environment.yml
@@ -0,0 +1,7 @@
+name: freyja_boot
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::freyja=1.4.7
diff --git a/modules/nf-core/freyja/boot/main.nf b/modules/nf-core/freyja/boot/main.nf
index 10e39d02..7d35c06a 100644
--- a/modules/nf-core/freyja/boot/main.nf
+++ b/modules/nf-core/freyja/boot/main.nf
@@ -2,10 +2,11 @@ process FREYJA_BOOT {
     tag "$meta.id"
     label 'process_high'
 
-    conda "bioconda::freyja=1.3.12"
+
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/freyja:1.3.12--pyhdfd78af_0':
-        'quay.io/biocontainers/freyja:1.3.12--pyhdfd78af_0' }"
+        'https://depot.galaxyproject.org/singularity/freyja:1.4.7--pyhdfd78af_0':
+        'biocontainers/freyja:1.4.7--pyhdfd78af_0' }"
 
     input:
     tuple val(meta), path(variants), path(depths)
diff --git a/modules/nf-core/freyja/boot/meta.yml b/modules/nf-core/freyja/boot/meta.yml
index 3eca1568..f3d91b52 100644
--- a/modules/nf-core/freyja/boot/meta.yml
+++ b/modules/nf-core/freyja/boot/meta.yml
@@ -12,9 +12,8 @@ tools:
       homepage: "https://github.com/andersen-lab/Freyja"
       documentation: "https://github.com/andersen-lab/Freyja/wiki"
       tool_dev_url: "https://github.com/andersen-lab/Freyja"
-      doi: "http://dx.doi.org/10.1038/s41586-022-05049-6"
-      licence: "['BSD-2-Clause']"
-
+      doi: "10.1038/s41586-022-05049-6"
+      licence: ["BSD-2-Clause"]
 input:
   - meta:
       type: map
@@ -25,41 +24,21 @@ input:
       type: file
       description: File containing identified variants in a gff-like format
       pattern: "*.variants.tsv"
-
-  - meta2:
-      type: map
-      description: |
-        Groovy Map containing sample information
-        e.g. [ id:'test', single_end:false ]
   - depths:
       type: file
       description: File containing depth of the variants
       pattern: "*.depth.tsv"
-
   - repeats:
-      type: value (int)
+      type: integer
       description: Number of bootstrap repeats to perform
-
-  - meta3:
-      type: map
-      description: |
-        Groovy Map containing sample information
-        e.g. [ id:'test', single_end:false ]
   - barcodes:
       type: file
       description: File containing lineage defining barcodes
       pattern: "*barcodes.csv"
-
-  - meta4:
-      type: map
-      description: |
-        Groovy Map containing sample information
-        e.g. [ id:'test', single_end:false ]
   - lineages_meta:
       type: file
       description: File containing lineage metadata that correspond to barcodes
       pattern: "*lineages.json"
-
 output:
   - meta:
       type: map
@@ -78,6 +57,7 @@ output:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-
 authors:
   - "@Joon-Klaps"
+maintainers:
+  - "@Joon-Klaps"
diff --git a/modules/nf-core/freyja/boot/tests/main.nf.test b/modules/nf-core/freyja/boot/tests/main.nf.test
new file mode 100644
index 00000000..6f75a9c6
--- /dev/null
+++ b/modules/nf-core/freyja/boot/tests/main.nf.test
@@ -0,0 +1,61 @@
+nextflow_process {
+
+    name "Test Process FREYJA_BOOT"
+    script "../main.nf"
+    process "FREYJA_BOOT"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "freyja"
+    tag "freyja/boot"
+    tag "freyja/variants"
+    tag "freyja/updatedb"
+
+    test("sarscov2 - illumina - test_paired_end_sorted - bam") {
+
+        setup {
+            run("FREYJA_VARIANTS") {
+                script "../../variants/main.nf"
+                process {
+                    """
+                    input[0] = [
+                            [ id:'test', single_end:false ], // meta map
+                            file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
+                        ]
+                    input[1] = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    """
+                }
+            }
+            run("FREYJA_UPDATE") {
+                script "../../update/main.nf"
+                process {
+                    """
+                    input[0] = "freyja_db"
+                    """
+                }
+            }
+        }
+
+        when {
+            process {
+                """
+                input[0] = FREYJA_VARIANTS.out.variants
+                input[1] = 10
+                input[2] = FREYJA_UPDATE.out.barcodes
+                input[3] = FREYJA_UPDATE.out.lineages_meta
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert path(process.out.summarized.get(0).get(1)).getText().contains("0.025,") },
+                { assert path(process.out.lineages.get(0).get(1)).getText().contains("0.025,") },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/freyja/boot/tests/main.nf.test.snap b/modules/nf-core/freyja/boot/tests/main.nf.test.snap
new file mode 100644
index 00000000..b6143310
--- /dev/null
+++ b/modules/nf-core/freyja/boot/tests/main.nf.test.snap
@@ -0,0 +1,10 @@
+{
+    "versions": {
+        "content": [
+            [
+                "versions.yml:md5,0cf7253a5b3b16532fca5908dffb01b8"
+            ]
+        ],
+        "timestamp": "2023-12-06T15:36:42.746574889"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/freyja/boot/tests/nextflow.config b/modules/nf-core/freyja/boot/tests/nextflow.config
new file mode 100644
index 00000000..3045d571
--- /dev/null
+++ b/modules/nf-core/freyja/boot/tests/nextflow.config
@@ -0,0 +1,8 @@
+process {
+
+
+    withName: FREYJA_BOOT {
+        ext.args="--depthcutoff 1"
+    }
+
+}
diff --git a/modules/nf-core/freyja/boot/tests/tags.yml b/modules/nf-core/freyja/boot/tests/tags.yml
new file mode 100644
index 00000000..8ccc35eb
--- /dev/null
+++ b/modules/nf-core/freyja/boot/tests/tags.yml
@@ -0,0 +1,2 @@
+freyja/boot:
+  - "modules/nf-core/freyja/boot/**"
diff --git a/modules/nf-core/freyja/demix/environment.yml b/modules/nf-core/freyja/demix/environment.yml
new file mode 100644
index 00000000..d692468f
--- /dev/null
+++ b/modules/nf-core/freyja/demix/environment.yml
@@ -0,0 +1,7 @@
+name: freyja_demix
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::freyja=1.4.7
diff --git a/modules/nf-core/freyja/demix/main.nf b/modules/nf-core/freyja/demix/main.nf
index 6587cb3c..9ea5bdd4 100644
--- a/modules/nf-core/freyja/demix/main.nf
+++ b/modules/nf-core/freyja/demix/main.nf
@@ -2,10 +2,11 @@ process FREYJA_DEMIX {
     tag "$meta.id"
     label 'process_low'
 
-    conda "bioconda::freyja=1.3.12"
+
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/freyja:1.3.12--pyhdfd78af_0':
-        'quay.io/biocontainers/freyja:1.3.12--pyhdfd78af_0' }"
+        'https://depot.galaxyproject.org/singularity/freyja:1.4.7--pyhdfd78af_0':
+        'biocontainers/freyja:1.4.7--pyhdfd78af_0' }"
 
     input:
     tuple val(meta), path(variants), path(depths)
diff --git a/modules/nf-core/freyja/demix/meta.yml b/modules/nf-core/freyja/demix/meta.yml
index a47663df..141a155f 100644
--- a/modules/nf-core/freyja/demix/meta.yml
+++ b/modules/nf-core/freyja/demix/meta.yml
@@ -11,9 +11,8 @@ tools:
       homepage: "https://github.com/andersen-lab/Freyja"
       documentation: "https://github.com/andersen-lab/Freyja/wiki"
       tool_dev_url: "https://github.com/andersen-lab/Freyja"
-      doi: "http://dx.doi.org/10.1038/s41586-022-05049-6"
-      licence: "['BSD-2-Clause']"
-
+      doi: "10.1038/s41586-022-05049-6"
+      licence: ["BSD-2-Clause"]
 input:
   - meta:
       type: map
@@ -24,37 +23,18 @@ input:
       type: file
       description: File containing identified variants in a gff-like format
       pattern: "*.variants.tsv"
-
-  - meta2:
-    type: map
-    description: |
-      Groovy Map containing sample information
-      e.g. [ id:'test', single_end:false ]
   - depths:
       type: file
       description: File containing depth of the variants
       pattern: "*.depth.tsv"
-
-  - meta3:
-      type: map
-      description: |
-        Groovy Map containing sample information
-        e.g. [ id:'test', single_end:false ]
   - barcodes:
       type: file
       description: File containing lineage defining barcodes
       pattern: "*barcodes.csv"
-
-  - meta4:
-      type: map
-      description: |
-        Groovy Map containing sample information
-        e.g. [ id:'test', single_end:false ]
   - lineages_meta:
       type: file
       description: File containing lineage metadata that correspond to barcodes
       pattern: "*lineages.json"
-
 output:
   - meta:
       type: map
@@ -69,6 +49,7 @@ output:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-
 authors:
   - "@Joon-Klaps"
+maintainers:
+  - "@Joon-Klaps"
diff --git a/modules/nf-core/freyja/demix/tests/main.nf.test b/modules/nf-core/freyja/demix/tests/main.nf.test
new file mode 100644
index 00000000..6ad1fb4a
--- /dev/null
+++ b/modules/nf-core/freyja/demix/tests/main.nf.test
@@ -0,0 +1,60 @@
+
+nextflow_process {
+
+    name "Test Process FREYJA_DEMIX"
+    script "../main.nf"
+    process "FREYJA_DEMIX"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "freyja"
+    tag "freyja/demix"
+    tag "freyja/variants"
+    tag "freyja/updatedb"
+
+    test("sarscov2 - illumina - test_paired_end_sorted - bam") {
+
+        setup {
+            run("FREYJA_VARIANTS") {
+                script "../../variants/main.nf"
+                process {
+                    """
+                    input[0] = [
+                            [ id:'test', single_end:false ], // meta map
+                            file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
+                        ]
+                    input[1] = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                    """
+                }
+            }
+            run("FREYJA_UPDATE") {
+                script "../../update/main.nf"
+                process {
+                    """
+                    input[0] = "freyja_db"
+                    """
+                }
+            }
+        }
+
+        when {
+            process {
+                """
+                input[0] = FREYJA_VARIANTS.out.variants
+                input[1] = FREYJA_UPDATE.out.barcodes
+                input[2] = FREYJA_UPDATE.out.lineages_meta
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert path(process.out.demix.get(0).get(1)).getText().contains("summarized") },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/freyja/demix/tests/main.nf.test.snap b/modules/nf-core/freyja/demix/tests/main.nf.test.snap
new file mode 100644
index 00000000..e4d3fad5
--- /dev/null
+++ b/modules/nf-core/freyja/demix/tests/main.nf.test.snap
@@ -0,0 +1,10 @@
+{
+    "versions": {
+        "content": [
+            [
+                "versions.yml:md5,d36ecae032c1b476d7b57de248b72729"
+            ]
+        ],
+        "timestamp": "2023-12-06T13:37:14.56803127"
+    }
+}
diff --git a/modules/nf-core/freyja/demix/tests/nextflow.config b/modules/nf-core/freyja/demix/tests/nextflow.config
new file mode 100644
index 00000000..ebd5a70d
--- /dev/null
+++ b/modules/nf-core/freyja/demix/tests/nextflow.config
@@ -0,0 +1,8 @@
+process {
+
+
+    withName: FREYJA_DEMIX{
+        ext.args = "--depthcutoff 1"
+    }
+
+}
diff --git a/modules/nf-core/freyja/demix/tests/tags.yml b/modules/nf-core/freyja/demix/tests/tags.yml
new file mode 100644
index 00000000..9e2c4bd1
--- /dev/null
+++ b/modules/nf-core/freyja/demix/tests/tags.yml
@@ -0,0 +1,2 @@
+freyja/demix:
+  - "modules/nf-core/freyja/demix/**"
diff --git a/modules/nf-core/freyja/update/environment.yml b/modules/nf-core/freyja/update/environment.yml
new file mode 100644
index 00000000..7d7b1e9b
--- /dev/null
+++ b/modules/nf-core/freyja/update/environment.yml
@@ -0,0 +1,7 @@
+name: freyja_update
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::freyja=1.4.7
diff --git a/modules/nf-core/freyja/update/main.nf b/modules/nf-core/freyja/update/main.nf
index 1711b14c..eb320b35 100644
--- a/modules/nf-core/freyja/update/main.nf
+++ b/modules/nf-core/freyja/update/main.nf
@@ -2,10 +2,11 @@ process FREYJA_UPDATE {
     tag "$db_name"
     label 'process_single'
 
-    conda "bioconda::freyja=1.3.12"
+
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/freyja:1.3.12--pyhdfd78af_0':
-        'quay.io/biocontainers/freyja:1.3.12--pyhdfd78af_0' }"
+        'https://depot.galaxyproject.org/singularity/freyja:1.4.7--pyhdfd78af_0':
+        'biocontainers/freyja:1.4.7--pyhdfd78af_0' }"
 
     input:
     val db_name
diff --git a/modules/nf-core/freyja/update/meta.yml b/modules/nf-core/freyja/update/meta.yml
index 2af5d662..1f5fc3c6 100644
--- a/modules/nf-core/freyja/update/meta.yml
+++ b/modules/nf-core/freyja/update/meta.yml
@@ -10,14 +10,12 @@ tools:
       homepage: "https://github.com/andersen-lab/Freyja"
       documentation: "https://github.com/andersen-lab/Freyja/wiki"
       tool_dev_url: "https://github.com/andersen-lab/Freyja"
-      doi: "http://dx.doi.org/10.1038/s41586-022-05049-6"
-      licence: "['BSD-2-Clause']"
-
+      doi: "10.1038/s41586-022-05049-6"
+      licence: ["BSD-2-Clause"]
 input:
   - db_name:
       type: string
       description: "The name of the database directory"
-
 output:
   - barcodes:
       type: file
@@ -35,6 +33,7 @@ output:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-
 authors:
   - "@Joon-Klaps"
+maintainers:
+  - "@Joon-Klaps"
diff --git a/modules/nf-core/freyja/update/tests/main.nf.test b/modules/nf-core/freyja/update/tests/main.nf.test
new file mode 100644
index 00000000..e1c293cc
--- /dev/null
+++ b/modules/nf-core/freyja/update/tests/main.nf.test
@@ -0,0 +1,34 @@
+nextflow_process {
+
+    name "Test Process FREYJA_UPDATE"
+    script "../main.nf"
+    process "FREYJA_UPDATE"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "freyja"
+    tag "freyja/update"
+
+    test("sarscov2 - value db name ") {
+
+        when {
+            process {
+                """
+                input[0] = "test_db"
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert path(process.out.barcodes.get(0)).exists() },
+                { assert path(process.out.lineages_meta.get(0)).exists() },
+                { assert path(process.out.lineages_topology.get(0)).exists() },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/freyja/update/tests/main.nf.test.snap b/modules/nf-core/freyja/update/tests/main.nf.test.snap
new file mode 100644
index 00000000..6eae23e0
--- /dev/null
+++ b/modules/nf-core/freyja/update/tests/main.nf.test.snap
@@ -0,0 +1,10 @@
+{
+    "versions": {
+        "content": [
+            [
+                "versions.yml:md5,8649650231828547e8fed40e072da108"
+            ]
+        ],
+        "timestamp": "2023-12-06T14:13:14.806958334"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/freyja/update/tests/tags.yml b/modules/nf-core/freyja/update/tests/tags.yml
new file mode 100644
index 00000000..90826aab
--- /dev/null
+++ b/modules/nf-core/freyja/update/tests/tags.yml
@@ -0,0 +1,2 @@
+freyja/update:
+  - "modules/nf-core/freyja/update/**"
diff --git a/modules/nf-core/freyja/variants/environment.yml b/modules/nf-core/freyja/variants/environment.yml
new file mode 100644
index 00000000..4fb28982
--- /dev/null
+++ b/modules/nf-core/freyja/variants/environment.yml
@@ -0,0 +1,7 @@
+name: freyja_variants
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::freyja=1.4.7
diff --git a/modules/nf-core/freyja/variants/main.nf b/modules/nf-core/freyja/variants/main.nf
index cdc6d788..e319114b 100644
--- a/modules/nf-core/freyja/variants/main.nf
+++ b/modules/nf-core/freyja/variants/main.nf
@@ -2,10 +2,11 @@ process FREYJA_VARIANTS {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::freyja=1.3.12"
+
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/freyja:1.3.12--pyhdfd78af_0':
-        'quay.io/biocontainers/freyja:1.3.12--pyhdfd78af_0' }"
+        'https://depot.galaxyproject.org/singularity/freyja:1.4.7--pyhdfd78af_0':
+        'biocontainers/freyja:1.4.7--pyhdfd78af_0' }"
 
     input:
     tuple val(meta), path(bam)
diff --git a/modules/nf-core/freyja/variants/meta.yml b/modules/nf-core/freyja/variants/meta.yml
index 13ddd377..24f8d693 100644
--- a/modules/nf-core/freyja/variants/meta.yml
+++ b/modules/nf-core/freyja/variants/meta.yml
@@ -10,9 +10,8 @@ tools:
       homepage: "https://github.com/andersen-lab/Freyja"
       documentation: "https://github.com/andersen-lab/Freyja/wiki"
       tool_dev_url: "https://github.com/andersen-lab/Freyja"
-      doi: "http://dx.doi.org/10.1038/s41586-022-05049-6"
-      licence: "['BSD-2-Clause']"
-
+      doi: "10.1038/s41586-022-05049-6"
+      licence: ["BSD-2-Clause"]
 input:
   - meta:
       type: map
@@ -23,12 +22,10 @@ input:
       type: file
       description: Sorted BAM file
       pattern: "*.bam"
-
   - fasta:
       type: file
       description: The reference sequence used for mapping and generating the BAM file
       pattern: "*.fa"
-
 output:
   - meta:
       type: map
@@ -47,6 +44,7 @@ output:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-
 authors:
   - "@Joon-Klaps"
+maintainers:
+  - "@Joon-Klaps"
diff --git a/modules/nf-core/freyja/variants/tests/main.nf.test b/modules/nf-core/freyja/variants/tests/main.nf.test
new file mode 100644
index 00000000..e0bb4026
--- /dev/null
+++ b/modules/nf-core/freyja/variants/tests/main.nf.test
@@ -0,0 +1,35 @@
+nextflow_process {
+
+    name "Test Process FREYJA_VARIANTS"
+    script "../main.nf"
+    process "FREYJA_VARIANTS"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "freyja"
+    tag "freyja/variants"
+
+    test("sarscov2 - illumina - test_paired_end_sorted - bam") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                            [ id:'test', single_end:false ], // meta map
+                            file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
+                        ]
+                    input[1] = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/freyja/variants/tests/main.nf.test.snap b/modules/nf-core/freyja/variants/tests/main.nf.test.snap
new file mode 100644
index 00000000..2693e2f9
--- /dev/null
+++ b/modules/nf-core/freyja/variants/tests/main.nf.test.snap
@@ -0,0 +1,35 @@
+{
+    "sarscov2 - illumina - test_paired_end_sorted - bam": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.variants.tsv:md5,966450bae4d9abae278572927b821983",
+                        "test.depth.tsv:md5,27f79b28a365a8af915895b484d1153e"
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,f7edb34ea4dfc2fbb2299aef03791926"
+                ],
+                "variants": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.variants.tsv:md5,966450bae4d9abae278572927b821983",
+                        "test.depth.tsv:md5,27f79b28a365a8af915895b484d1153e"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,f7edb34ea4dfc2fbb2299aef03791926"
+                ]
+            }
+        ],
+        "timestamp": "2023-12-06T15:13:57.445426554"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/freyja/variants/tests/tags.yml b/modules/nf-core/freyja/variants/tests/tags.yml
new file mode 100644
index 00000000..b53250c9
--- /dev/null
+++ b/modules/nf-core/freyja/variants/tests/tags.yml
@@ -0,0 +1,2 @@
+freyja/variants:
+  - "modules/nf-core/freyja/variants/**"
diff --git a/modules/nf-core/gunzip/environment.yml b/modules/nf-core/gunzip/environment.yml
new file mode 100644
index 00000000..25910b34
--- /dev/null
+++ b/modules/nf-core/gunzip/environment.yml
@@ -0,0 +1,7 @@
+name: gunzip
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - conda-forge::sed=4.7
diff --git a/modules/nf-core/gunzip/main.nf b/modules/nf-core/gunzip/main.nf
index d906034c..468a6f28 100644
--- a/modules/nf-core/gunzip/main.nf
+++ b/modules/nf-core/gunzip/main.nf
@@ -2,10 +2,10 @@ process GUNZIP {
     tag "$archive"
     label 'process_single'
 
-    conda "conda-forge::sed=4.7"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/ubuntu:20.04' :
-        'ubuntu:20.04' }"
+        'nf-core/ubuntu:20.04' }"
 
     input:
     tuple val(meta), path(archive)
@@ -21,10 +21,14 @@ process GUNZIP {
     def args = task.ext.args ?: ''
     gunzip = archive.toString() - '.gz'
     """
-    gunzip \\
-        -f \\
+    # Not calling gunzip itself because it creates files
+    # with the original group ownership rather than the
+    # default one for that user / the work directory
+    gzip \\
+        -cd \\
         $args \\
-        $archive
+        $archive \\
+        > $gunzip
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
diff --git a/modules/nf-core/gunzip/meta.yml b/modules/nf-core/gunzip/meta.yml
index 2e0e4054..231034f2 100644
--- a/modules/nf-core/gunzip/meta.yml
+++ b/modules/nf-core/gunzip/meta.yml
@@ -3,6 +3,7 @@ description: Compresses and decompresses files.
 keywords:
   - gunzip
   - compression
+  - decompression
 tools:
   - gunzip:
       description: |
@@ -32,3 +33,7 @@ authors:
   - "@joseespinosa"
   - "@drpatelh"
   - "@jfy133"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
+  - "@jfy133"
diff --git a/modules/nf-core/gunzip/tests/main.nf.test b/modules/nf-core/gunzip/tests/main.nf.test
new file mode 100644
index 00000000..d0317922
--- /dev/null
+++ b/modules/nf-core/gunzip/tests/main.nf.test
@@ -0,0 +1,35 @@
+nextflow_process {
+
+    name "Test Process GUNZIP"
+    script "../main.nf"
+    process "GUNZIP"
+    tag "gunzip"
+    tag "modules_nfcore"
+    tag "modules"
+
+    test("Should run without failures") {
+
+        when {
+            params {
+                outdir = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [
+                                [],
+                                file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+                            ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+            { assert process.success },
+            { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/gunzip/tests/main.nf.test.snap b/modules/nf-core/gunzip/tests/main.nf.test.snap
new file mode 100644
index 00000000..720fd9ff
--- /dev/null
+++ b/modules/nf-core/gunzip/tests/main.nf.test.snap
@@ -0,0 +1,31 @@
+{
+    "Should run without failures": {
+        "content": [
+            {
+                "0": [
+                    [
+                        [
+                            
+                        ],
+                        "test_1.fastq:md5,4161df271f9bfcd25d5845a1e220dbec"
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,54376d32aca20e937a4ec26dac228e84"
+                ],
+                "gunzip": [
+                    [
+                        [
+                            
+                        ],
+                        "test_1.fastq:md5,4161df271f9bfcd25d5845a1e220dbec"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,54376d32aca20e937a4ec26dac228e84"
+                ]
+            }
+        ],
+        "timestamp": "2023-10-17T15:35:37.690477896"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/gunzip/tests/tags.yml b/modules/nf-core/gunzip/tests/tags.yml
new file mode 100644
index 00000000..fd3f6915
--- /dev/null
+++ b/modules/nf-core/gunzip/tests/tags.yml
@@ -0,0 +1,2 @@
+gunzip:
+  - modules/nf-core/gunzip/**
diff --git a/modules/nf-core/ivar/consensus/environment.yml b/modules/nf-core/ivar/consensus/environment.yml
new file mode 100644
index 00000000..c7b87d02
--- /dev/null
+++ b/modules/nf-core/ivar/consensus/environment.yml
@@ -0,0 +1,7 @@
+name: ivar_consensus
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::ivar=1.4
diff --git a/modules/nf-core/ivar/consensus/main.nf b/modules/nf-core/ivar/consensus/main.nf
index 827463dd..9786200e 100644
--- a/modules/nf-core/ivar/consensus/main.nf
+++ b/modules/nf-core/ivar/consensus/main.nf
@@ -2,10 +2,10 @@ process IVAR_CONSENSUS {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::ivar=1.4"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/ivar:1.4--h6b7c446_1' :
-        'quay.io/biocontainers/ivar:1.4--h6b7c446_1' }"
+        'biocontainers/ivar:1.4--h6b7c446_1' }"
 
     input:
     tuple val(meta), path(bam)
diff --git a/modules/nf-core/ivar/consensus/meta.yml b/modules/nf-core/ivar/consensus/meta.yml
index fb562603..99e11924 100644
--- a/modules/nf-core/ivar/consensus/meta.yml
+++ b/modules/nf-core/ivar/consensus/meta.yml
@@ -54,3 +54,6 @@ output:
 authors:
   - "@andersgs"
   - "@drpatelh"
+maintainers:
+  - "@andersgs"
+  - "@drpatelh"
diff --git a/modules/nf-core/ivar/trim/environment.yml b/modules/nf-core/ivar/trim/environment.yml
new file mode 100644
index 00000000..7fb8b3a2
--- /dev/null
+++ b/modules/nf-core/ivar/trim/environment.yml
@@ -0,0 +1,7 @@
+name: ivar_trim
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::ivar=1.4
diff --git a/modules/nf-core/ivar/trim/main.nf b/modules/nf-core/ivar/trim/main.nf
index a7dc404d..7a687d02 100644
--- a/modules/nf-core/ivar/trim/main.nf
+++ b/modules/nf-core/ivar/trim/main.nf
@@ -2,10 +2,10 @@ process IVAR_TRIM {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::ivar=1.4"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/ivar:1.4--h6b7c446_1' :
-        'quay.io/biocontainers/ivar:1.4--h6b7c446_1' }"
+        'biocontainers/ivar:1.4--h6b7c446_1' }"
 
     input:
     tuple val(meta), path(bam), path(bai)
diff --git a/modules/nf-core/ivar/trim/meta.yml b/modules/nf-core/ivar/trim/meta.yml
index d01dd1a2..3a99f6f3 100644
--- a/modules/nf-core/ivar/trim/meta.yml
+++ b/modules/nf-core/ivar/trim/meta.yml
@@ -50,3 +50,6 @@ output:
 authors:
   - "@andersgs"
   - "@drpatelh"
+maintainers:
+  - "@andersgs"
+  - "@drpatelh"
diff --git a/modules/nf-core/ivar/variants/environment.yml b/modules/nf-core/ivar/variants/environment.yml
new file mode 100644
index 00000000..7431cac4
--- /dev/null
+++ b/modules/nf-core/ivar/variants/environment.yml
@@ -0,0 +1,7 @@
+name: ivar_variants
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::ivar=1.4
diff --git a/modules/nf-core/ivar/variants/main.nf b/modules/nf-core/ivar/variants/main.nf
index ae647f2b..189696aa 100644
--- a/modules/nf-core/ivar/variants/main.nf
+++ b/modules/nf-core/ivar/variants/main.nf
@@ -2,10 +2,10 @@ process IVAR_VARIANTS {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::ivar=1.4"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/ivar:1.4--h6b7c446_1' :
-        'quay.io/biocontainers/ivar:1.4--h6b7c446_1' }"
+        'biocontainers/ivar:1.4--h6b7c446_1' }"
 
     input:
     tuple val(meta), path(bam)
diff --git a/modules/nf-core/ivar/variants/meta.yml b/modules/nf-core/ivar/variants/meta.yml
index 4d09e449..9dc9b05c 100644
--- a/modules/nf-core/ivar/variants/meta.yml
+++ b/modules/nf-core/ivar/variants/meta.yml
@@ -58,3 +58,6 @@ output:
 authors:
   - "@andersgs"
   - "@drpatelh"
+maintainers:
+  - "@andersgs"
+  - "@drpatelh"
diff --git a/modules/nf-core/kraken2/kraken2/environment.yml b/modules/nf-core/kraken2/kraken2/environment.yml
new file mode 100644
index 00000000..63be419b
--- /dev/null
+++ b/modules/nf-core/kraken2/kraken2/environment.yml
@@ -0,0 +1,8 @@
+name: kraken2_kraken2
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::kraken2=2.1.2
+  - conda-forge::pigz=2.6
diff --git a/modules/nf-core/kraken2/kraken2/main.nf b/modules/nf-core/kraken2/kraken2/main.nf
index 5901064e..cdf02d0f 100644
--- a/modules/nf-core/kraken2/kraken2/main.nf
+++ b/modules/nf-core/kraken2/kraken2/main.nf
@@ -2,10 +2,10 @@ process KRAKEN2_KRAKEN2 {
     tag "$meta.id"
     label 'process_high'
 
-    conda "bioconda::kraken2=2.1.2 conda-forge::pigz=2.6"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/mulled-v2-5799ab18b5fc681e75923b2450abaa969907ec98:87fc08d11968d081f3e8a37131c1f1f6715b6542-0' :
-        'quay.io/biocontainers/mulled-v2-5799ab18b5fc681e75923b2450abaa969907ec98:87fc08d11968d081f3e8a37131c1f1f6715b6542-0' }"
+        'biocontainers/mulled-v2-5799ab18b5fc681e75923b2450abaa969907ec98:87fc08d11968d081f3e8a37131c1f1f6715b6542-0' }"
 
     input:
     tuple val(meta), path(reads)
diff --git a/modules/nf-core/kraken2/kraken2/meta.yml b/modules/nf-core/kraken2/kraken2/meta.yml
index 7129fe3a..7909ffe7 100644
--- a/modules/nf-core/kraken2/kraken2/meta.yml
+++ b/modules/nf-core/kraken2/kraken2/meta.yml
@@ -28,12 +28,12 @@ input:
       type: directory
       description: Kraken2 database
   - save_output_fastqs:
-      type: boolean
+      type: string
       description: |
         If true, optional commands are added to save classified and unclassified reads
         as fastq files
   - save_reads_assignment:
-      type: boolean
+      type: string
       description: |
         If true, an optional command is added to save a file reporting the taxonomic
         classification of each input read
@@ -73,3 +73,6 @@ output:
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
diff --git a/modules/nf-core/kraken2/kraken2/tests/main.nf.test b/modules/nf-core/kraken2/kraken2/tests/main.nf.test
new file mode 100644
index 00000000..4cf63e2f
--- /dev/null
+++ b/modules/nf-core/kraken2/kraken2/tests/main.nf.test
@@ -0,0 +1,142 @@
+nextflow_process {
+    name "Test Process KRAKEN2_KRAKEN2"
+    script "../main.nf"
+    process "KRAKEN2_KRAKEN2"
+    tag "kraken2"
+    tag "kraken2/kraken2"
+    tag "modules"
+    tag "modules_nfcore"
+
+    setup {
+        run("UNTAR") {
+            script "modules/nf-core/untar/main.nf"
+            process {
+                """
+                input[0] = Channel.of([
+                    [],
+                    file(
+                        params.test_data['sarscov2']['genome']['kraken2_tar_gz'],
+                        checkIfExists: true
+                    )
+                ])
+                """
+            }
+        }
+    }
+
+    test("sarscov2 illumina single end [fastq]") {
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    [ file(
+                        params.test_data['sarscov2']['illumina']['test_1_fastq_gz'],
+                        checkIfExists: true
+                    )]
+                ]
+                input[1] = UNTAR.out.untar.map{ it[1] }
+                input[2] = true
+                input[3] = false
+                """
+            }
+        }
+
+        then {
+            assertAll(
+            { assert process.success },
+            { assert snapshot(
+                    process.out.report,
+                    process.out.versions,
+                ).match()
+            },
+            { assert process.out.classified_reads_fastq.get(0).get(1) ==~ ".*/test.classified.fastq.gz" },
+            { assert process.out.unclassified_reads_fastq.get(0).get(1) ==~ ".*/test.unclassified.fastq.gz" },
+            )
+        }
+    }
+
+    test("sarscov2 illumina paired end [fastq]") {
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    [
+                        file(
+                            params.test_data['sarscov2']['illumina']['test_1_fastq_gz'],
+                            checkIfExists: true
+                        ),
+                        file(
+                            params.test_data['sarscov2']['illumina']['test_2_fastq_gz'],
+                            checkIfExists: true
+                        )
+
+                    ]
+                ]
+                input[1] = UNTAR.out.untar.map{ it[1] }
+                input[2] = true
+                input[3] = false
+                """
+            }
+        }
+
+        then {
+            assertAll(
+            { assert process.success },
+            { assert snapshot(
+                    process.out.report,
+                    process.out.versions,
+                ).match()
+            },
+            { assert process.out.classified_reads_fastq.get(0).get(1).get(0)
+                ==~ ".*/test.classified_1.fastq.gz" },
+            { assert process.out.classified_reads_fastq.get(0).get(1).get(1)
+                ==~ ".*/test.classified_2.fastq.gz" },
+            { assert process.out.unclassified_reads_fastq.get(0).get(1).get(0)
+                ==~ ".*/test.unclassified_1.fastq.gz" },
+            { assert process.out.unclassified_reads_fastq.get(0).get(1).get(1)
+                ==~ ".*/test.unclassified_2.fastq.gz" },
+            )
+        }
+    }
+
+    test("sarscov2 illumina single end [fastq] + save_reads_assignment") {
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    [ file(
+                        params.test_data['sarscov2']['illumina']['test_1_fastq_gz'],
+                        checkIfExists: true
+                    )]
+                ]
+                input[1] = UNTAR.out.untar.map{ it[1] }
+                input[2] = false
+                input[3] = true
+                """
+            }
+        }
+
+        then {
+            assertAll(
+            { assert process.success },
+            { assert snapshot(
+                    process.out.report,
+                    process.out.classified_reads_assignment,
+                    process.out.versions,
+                ).match()
+            },
+            )
+        }
+    }
+}
diff --git a/modules/nf-core/kraken2/kraken2/tests/main.nf.test.snap b/modules/nf-core/kraken2/kraken2/tests/main.nf.test.snap
new file mode 100644
index 00000000..c1bdd0c6
--- /dev/null
+++ b/modules/nf-core/kraken2/kraken2/tests/main.nf.test.snap
@@ -0,0 +1,62 @@
+{
+    "sarscov2 illumina single end [fastq]": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.kraken2.report.txt:md5,4227755fe40478b8d7dc8634b489761e"
+                ]
+            ],
+            [
+                "versions.yml:md5,bcb3e2520685846df02bb27cc6b1794b"
+            ]
+        ],
+        "timestamp": "2023-10-25T09:01:29.775797"
+    },
+    "sarscov2 illumina paired end [fastq]": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.kraken2.report.txt:md5,4227755fe40478b8d7dc8634b489761e"
+                ]
+            ],
+            [
+                "versions.yml:md5,bcb3e2520685846df02bb27cc6b1794b"
+            ]
+        ],
+        "timestamp": "2023-10-25T09:01:37.025389"
+    },
+    "sarscov2 illumina single end [fastq] + save_reads_assignment": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.kraken2.report.txt:md5,4227755fe40478b8d7dc8634b489761e"
+                ]
+            ],
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.kraken2.classifiedreads.txt:md5,e7a90531f0d8d777316515c36fe4cae0"
+                ]
+            ],
+            [
+                "versions.yml:md5,bcb3e2520685846df02bb27cc6b1794b"
+            ]
+        ],
+        "timestamp": "2023-10-25T09:01:45.775262"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/kraken2/kraken2/tests/tags.yml b/modules/nf-core/kraken2/kraken2/tests/tags.yml
new file mode 100644
index 00000000..9ebfd7ab
--- /dev/null
+++ b/modules/nf-core/kraken2/kraken2/tests/tags.yml
@@ -0,0 +1,3 @@
+kraken2/kraken2:
+  - modules/nf-core/kraken2/kraken2/**
+  - modules/nf-core/untar/**
diff --git a/modules/nf-core/minia/environment.yml b/modules/nf-core/minia/environment.yml
new file mode 100644
index 00000000..10e45529
--- /dev/null
+++ b/modules/nf-core/minia/environment.yml
@@ -0,0 +1,7 @@
+name: minia
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::minia=3.2.6
diff --git a/modules/nf-core/minia/main.nf b/modules/nf-core/minia/main.nf
index fe242920..40d3213f 100644
--- a/modules/nf-core/minia/main.nf
+++ b/modules/nf-core/minia/main.nf
@@ -2,10 +2,10 @@ process MINIA {
     tag "$meta.id"
     label 'process_high'
 
-    conda "bioconda::minia=3.2.6"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/minia:3.2.6--h9a82719_0' :
-        'quay.io/biocontainers/minia:3.2.6--h9a82719_0' }"
+        'biocontainers/minia:3.2.6--h9a82719_0' }"
 
     input:
     tuple val(meta), path(reads)
diff --git a/modules/nf-core/minia/meta.yml b/modules/nf-core/minia/meta.yml
index ae86f75c..03241027 100644
--- a/modules/nf-core/minia/meta.yml
+++ b/modules/nf-core/minia/meta.yml
@@ -45,3 +45,6 @@ output:
 authors:
   - "@drpatelh"
   - "@kevinmenden"
+maintainers:
+  - "@drpatelh"
+  - "@kevinmenden"
diff --git a/modules/nf-core/mosdepth/environment.yml b/modules/nf-core/mosdepth/environment.yml
new file mode 100644
index 00000000..88c7126c
--- /dev/null
+++ b/modules/nf-core/mosdepth/environment.yml
@@ -0,0 +1,8 @@
+name: mosdepth
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  # renovate: datasource=conda depName=bioconda/mosdepth
+  - mosdepth=0.3.6
diff --git a/modules/nf-core/mosdepth/main.nf b/modules/nf-core/mosdepth/main.nf
index be4be831..c7e24303 100644
--- a/modules/nf-core/mosdepth/main.nf
+++ b/modules/nf-core/mosdepth/main.nf
@@ -2,15 +2,14 @@ process MOSDEPTH {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::mosdepth=0.3.3"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/mosdepth:0.3.3--hdfd78af_1' :
-        'quay.io/biocontainers/mosdepth:0.3.3--hdfd78af_1'}"
+        'https://depot.galaxyproject.org/singularity/mosdepth:0.3.6--hd299d5a_0' :
+        'biocontainers/mosdepth:0.3.6--hd299d5a_0'}"
 
     input:
-    tuple val(meta),  path(bam), path(bai)
-    tuple val(meta2), path(bed)
-    tuple val(meta3), path(fasta)
+    tuple val(meta),  path(bam), path(bai), path(bed)
+    tuple val(meta2), path(fasta)
 
     output:
     tuple val(meta), path('*.global.dist.txt')      , emit: global_txt
@@ -36,10 +35,10 @@ process MOSDEPTH {
     def reference = fasta ? "--fasta ${fasta}" : ""
     def interval = bed ? "--by ${bed}" : ""
     if (bed && args.contains("--by")) {
-        exit 1, "'--by' can only be specified once when running mosdepth! Either remove input BED file definition or remove '--by' from 'ext.args' definition"
+        error "'--by' can only be specified once when running mosdepth! Either remove input BED file definition or remove '--by' from 'ext.args' definition"
     }
     if (!bed && args.contains("--thresholds")) {
-        exit 1, "'--thresholds' can only be specified in conjunction with '--by'"
+        error "'--thresholds' can only be specified in conjunction with '--by'"
     }
 
     """
diff --git a/modules/nf-core/mosdepth/meta.yml b/modules/nf-core/mosdepth/meta.yml
index adf3893f..9caaf2cd 100644
--- a/modules/nf-core/mosdepth/meta.yml
+++ b/modules/nf-core/mosdepth/meta.yml
@@ -26,19 +26,14 @@ input:
       type: file
       description: Index for BAM/CRAM file
       pattern: "*.{bai,crai}"
-  - meta2:
-      type: map
-      description: |
-        Groovy Map containing bed information
-        e.g. [ id:'test' ]
   - bed:
       type: file
       description: BED file with intersected intervals
       pattern: "*.{bed}"
-  - meta3:
+  - meta2:
       type: map
       description: |
-        Groovy Map containing reference information
+        Groovy Map containing bed information
         e.g. [ id:'test' ]
   - fasta:
       type: file
@@ -107,3 +102,8 @@ authors:
   - "@drpatelh"
   - "@ramprasadn"
   - "@matthdsm"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
+  - "@ramprasadn"
+  - "@matthdsm"
diff --git a/modules/nf-core/mosdepth/tests/main.nf.test b/modules/nf-core/mosdepth/tests/main.nf.test
new file mode 100644
index 00000000..d991f819
--- /dev/null
+++ b/modules/nf-core/mosdepth/tests/main.nf.test
@@ -0,0 +1,260 @@
+nextflow_process {
+
+    name "Test Process MOSDEPTH"
+    script "../main.nf"
+    process "MOSDEPTH"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "mosdepth"
+
+    test("homo_sapiens - bam, bai, []") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ],
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true),
+                    []
+                ]
+                input[1] = [[],[]]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("homo_sapiens - bam, bai, bed") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ],
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true),
+                    file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
+                ]
+                input[1] = [[],[]]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("homo_sapiens - cram, crai, []") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ],
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true),
+                    []
+                ]
+                input[1] = [
+                    [ id:'test' ],
+                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("homo_sapiens - cram, crai, bed") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ],
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true),
+                    file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
+                ]
+                input[1] = [
+                    [ id:'test' ],
+                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("homo_sapiens - bam, bai, [] - window") {
+
+        config "./window.config"
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ],
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true),
+                    []
+                ]
+                input[1] = [[],[]]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("homo_sapiens - bam, bai, [] - quantized") {
+
+        config "./quantized.config"
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ],
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true),
+                    []
+                ]
+                input[1] = [[],[]]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("homo_sapiens - bam, bai, bed - thresholds") {
+
+        config "./threshold.config"
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ],
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true),
+                    file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
+                ]
+                input[1] = [[],[]]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("homo_sapiens - bam, bai, bed - fail") {
+
+        config "./window.config"
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ],
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true),
+                    file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
+                ]
+                input[1] = [[],[]]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.failed }
+            )
+        }
+
+    }
+
+    test("homo_sapiens - bam, bai, [] - stub") {
+
+        options "-stub"
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ],
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true),
+                    file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
+                ]
+                input[1] = [[],[]]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.global_txt[0][1]).name,
+                    file(process.out.summary_txt[0][1]).name,
+                    file(process.out.regions_txt[0][1]).name,
+                    file(process.out.per_base_d4[0][1]).name,
+                    file(process.out.per_base_bed[0][1]).name,
+                    file(process.out.per_base_csi[0][1]).name,
+                    file(process.out.regions_bed[0][1]).name,
+                    file(process.out.regions_csi[0][1]).name,
+                    file(process.out.quantized_bed[0][1]).name,
+                    file(process.out.quantized_csi[0][1]).name,
+                    file(process.out.thresholds_bed[0][1]).name,
+                    file(process.out.thresholds_csi[0][1]).name,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/mosdepth/tests/main.nf.test.snap b/modules/nf-core/mosdepth/tests/main.nf.test.snap
new file mode 100644
index 00000000..dc4d9508
--- /dev/null
+++ b/modules/nf-core/mosdepth/tests/main.nf.test.snap
@@ -0,0 +1,1145 @@
+{
+    "homo_sapiens - bam, bai, [] - stub": {
+        "content": [
+            "test.global.dist.txt",
+            "test.summary.txt",
+            "test.region.dist.txt",
+            "test.per-base.d4",
+            "test.per-base.bed.gz",
+            "test.per-base.bed.gz.csi",
+            "test.regions.bed.gz",
+            "test.regions.bed.gz.csi",
+            "test.quantized.bed.gz",
+            "test.quantized.bed.gz.csi",
+            "test.thresholds.bed.gz",
+            "test.thresholds.bed.gz.csi",
+            [
+                "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8"
+            ]
+        ],
+        "timestamp": "2023-11-27T15:14:34.897155161"
+    },
+    "homo_sapiens - cram, crai, bed": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82"
+                    ]
+                ],
+                "10": [
+                    
+                ],
+                "11": [
+                    
+                ],
+                "12": [
+                    "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8"
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "3": [
+                    
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a"
+                    ]
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4"
+                    ]
+                ],
+                "6": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz:md5,5d398caf7171ec4406278e2add3009ae"
+                    ]
+                ],
+                "7": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f"
+                    ]
+                ],
+                "8": [
+                    
+                ],
+                "9": [
+                    
+                ],
+                "global_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "per_base_bed": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a"
+                    ]
+                ],
+                "per_base_csi": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4"
+                    ]
+                ],
+                "per_base_d4": [
+                    
+                ],
+                "quantized_bed": [
+                    
+                ],
+                "quantized_csi": [
+                    
+                ],
+                "regions_bed": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz:md5,5d398caf7171ec4406278e2add3009ae"
+                    ]
+                ],
+                "regions_csi": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f"
+                    ]
+                ],
+                "regions_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "summary_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82"
+                    ]
+                ],
+                "thresholds_bed": [
+                    
+                ],
+                "thresholds_csi": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8"
+                ]
+            }
+        ],
+        "timestamp": "2023-11-27T14:47:18.171150781"
+    },
+    "homo_sapiens - bam, bai, [] - quantized": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59"
+                    ]
+                ],
+                "10": [
+                    
+                ],
+                "11": [
+                    
+                ],
+                "12": [
+                    "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8"
+                ],
+                "2": [
+                    
+                ],
+                "3": [
+                    
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a"
+                    ]
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4"
+                    ]
+                ],
+                "6": [
+                    
+                ],
+                "7": [
+                    
+                ],
+                "8": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.quantized.bed.gz:md5,3e434a8bafcf59a67841ae3d4d752838"
+                    ]
+                ],
+                "9": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.quantized.bed.gz.csi:md5,be9617f551f19a33923f1e886eaefb93"
+                    ]
+                ],
+                "global_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "per_base_bed": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a"
+                    ]
+                ],
+                "per_base_csi": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4"
+                    ]
+                ],
+                "per_base_d4": [
+                    
+                ],
+                "quantized_bed": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.quantized.bed.gz:md5,3e434a8bafcf59a67841ae3d4d752838"
+                    ]
+                ],
+                "quantized_csi": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.quantized.bed.gz.csi:md5,be9617f551f19a33923f1e886eaefb93"
+                    ]
+                ],
+                "regions_bed": [
+                    
+                ],
+                "regions_csi": [
+                    
+                ],
+                "regions_txt": [
+                    
+                ],
+                "summary_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59"
+                    ]
+                ],
+                "thresholds_bed": [
+                    
+                ],
+                "thresholds_csi": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8"
+                ]
+            }
+        ],
+        "timestamp": "2023-11-27T14:47:29.228103864"
+    },
+    "homo_sapiens - bam, bai, bed": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82"
+                    ]
+                ],
+                "10": [
+                    
+                ],
+                "11": [
+                    
+                ],
+                "12": [
+                    "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8"
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "3": [
+                    
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a"
+                    ]
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4"
+                    ]
+                ],
+                "6": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz:md5,5d398caf7171ec4406278e2add3009ae"
+                    ]
+                ],
+                "7": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f"
+                    ]
+                ],
+                "8": [
+                    
+                ],
+                "9": [
+                    
+                ],
+                "global_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "per_base_bed": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a"
+                    ]
+                ],
+                "per_base_csi": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4"
+                    ]
+                ],
+                "per_base_d4": [
+                    
+                ],
+                "quantized_bed": [
+                    
+                ],
+                "quantized_csi": [
+                    
+                ],
+                "regions_bed": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz:md5,5d398caf7171ec4406278e2add3009ae"
+                    ]
+                ],
+                "regions_csi": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f"
+                    ]
+                ],
+                "regions_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "summary_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82"
+                    ]
+                ],
+                "thresholds_bed": [
+                    
+                ],
+                "thresholds_csi": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8"
+                ]
+            }
+        ],
+        "timestamp": "2023-11-27T14:47:04.537716314"
+    },
+    "homo_sapiens - bam, bai, [] - window": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82"
+                    ]
+                ],
+                "10": [
+                    
+                ],
+                "11": [
+                    
+                ],
+                "12": [
+                    "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8"
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.region.dist.txt:md5,39e0e707ec32feb5176fd20a95f1f468"
+                    ]
+                ],
+                "3": [
+                    
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a"
+                    ]
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4"
+                    ]
+                ],
+                "6": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz:md5,f02e2cb49cc050e13d76942d6960827a"
+                    ]
+                ],
+                "7": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz.csi:md5,257d67678136963d9dd904330079609d"
+                    ]
+                ],
+                "8": [
+                    
+                ],
+                "9": [
+                    
+                ],
+                "global_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "per_base_bed": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a"
+                    ]
+                ],
+                "per_base_csi": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4"
+                    ]
+                ],
+                "per_base_d4": [
+                    
+                ],
+                "quantized_bed": [
+                    
+                ],
+                "quantized_csi": [
+                    
+                ],
+                "regions_bed": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz:md5,f02e2cb49cc050e13d76942d6960827a"
+                    ]
+                ],
+                "regions_csi": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz.csi:md5,257d67678136963d9dd904330079609d"
+                    ]
+                ],
+                "regions_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.region.dist.txt:md5,39e0e707ec32feb5176fd20a95f1f468"
+                    ]
+                ],
+                "summary_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82"
+                    ]
+                ],
+                "thresholds_bed": [
+                    
+                ],
+                "thresholds_csi": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8"
+                ]
+            }
+        ],
+        "timestamp": "2023-11-27T14:47:23.708536171"
+    },
+    "homo_sapiens - bam, bai, []": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59"
+                    ]
+                ],
+                "10": [
+                    
+                ],
+                "11": [
+                    
+                ],
+                "12": [
+                    "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8"
+                ],
+                "2": [
+                    
+                ],
+                "3": [
+                    
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a"
+                    ]
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4"
+                    ]
+                ],
+                "6": [
+                    
+                ],
+                "7": [
+                    
+                ],
+                "8": [
+                    
+                ],
+                "9": [
+                    
+                ],
+                "global_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "per_base_bed": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a"
+                    ]
+                ],
+                "per_base_csi": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4"
+                    ]
+                ],
+                "per_base_d4": [
+                    
+                ],
+                "quantized_bed": [
+                    
+                ],
+                "quantized_csi": [
+                    
+                ],
+                "regions_bed": [
+                    
+                ],
+                "regions_csi": [
+                    
+                ],
+                "regions_txt": [
+                    
+                ],
+                "summary_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59"
+                    ]
+                ],
+                "thresholds_bed": [
+                    
+                ],
+                "thresholds_csi": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8"
+                ]
+            }
+        ],
+        "timestamp": "2023-11-27T14:46:56.975710077"
+    },
+    "homo_sapiens - cram, crai, []": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59"
+                    ]
+                ],
+                "10": [
+                    
+                ],
+                "11": [
+                    
+                ],
+                "12": [
+                    "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8"
+                ],
+                "2": [
+                    
+                ],
+                "3": [
+                    
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a"
+                    ]
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4"
+                    ]
+                ],
+                "6": [
+                    
+                ],
+                "7": [
+                    
+                ],
+                "8": [
+                    
+                ],
+                "9": [
+                    
+                ],
+                "global_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "per_base_bed": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a"
+                    ]
+                ],
+                "per_base_csi": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4"
+                    ]
+                ],
+                "per_base_d4": [
+                    
+                ],
+                "quantized_bed": [
+                    
+                ],
+                "quantized_csi": [
+                    
+                ],
+                "regions_bed": [
+                    
+                ],
+                "regions_csi": [
+                    
+                ],
+                "regions_txt": [
+                    
+                ],
+                "summary_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59"
+                    ]
+                ],
+                "thresholds_bed": [
+                    
+                ],
+                "thresholds_csi": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8"
+                ]
+            }
+        ],
+        "timestamp": "2023-11-27T14:47:12.09259995"
+    },
+    "homo_sapiens - bam, bai, bed - thresholds": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82"
+                    ]
+                ],
+                "10": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.thresholds.bed.gz:md5,13101e326eea3cbfa1d569b69f494f4c"
+                    ]
+                ],
+                "11": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.thresholds.bed.gz.csi:md5,912055ee9452229439df6fae95644196"
+                    ]
+                ],
+                "12": [
+                    "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8"
+                ],
+                "2": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "3": [
+                    
+                ],
+                "4": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a"
+                    ]
+                ],
+                "5": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4"
+                    ]
+                ],
+                "6": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz:md5,5d398caf7171ec4406278e2add3009ae"
+                    ]
+                ],
+                "7": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f"
+                    ]
+                ],
+                "8": [
+                    
+                ],
+                "9": [
+                    
+                ],
+                "global_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "per_base_bed": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a"
+                    ]
+                ],
+                "per_base_csi": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4"
+                    ]
+                ],
+                "per_base_d4": [
+                    
+                ],
+                "quantized_bed": [
+                    
+                ],
+                "quantized_csi": [
+                    
+                ],
+                "regions_bed": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz:md5,5d398caf7171ec4406278e2add3009ae"
+                    ]
+                ],
+                "regions_csi": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f"
+                    ]
+                ],
+                "regions_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e"
+                    ]
+                ],
+                "summary_txt": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82"
+                    ]
+                ],
+                "thresholds_bed": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.thresholds.bed.gz:md5,13101e326eea3cbfa1d569b69f494f4c"
+                    ]
+                ],
+                "thresholds_csi": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.thresholds.bed.gz.csi:md5,912055ee9452229439df6fae95644196"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8"
+                ]
+            }
+        ],
+        "timestamp": "2023-11-27T14:49:44.311847326"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/mosdepth/tests/quantized.config b/modules/nf-core/mosdepth/tests/quantized.config
new file mode 100644
index 00000000..63c55350
--- /dev/null
+++ b/modules/nf-core/mosdepth/tests/quantized.config
@@ -0,0 +1,3 @@
+process {
+    ext.args = "--quantize 0:1:4:100:200"
+}
\ No newline at end of file
diff --git a/modules/nf-core/mosdepth/tests/tags.yml b/modules/nf-core/mosdepth/tests/tags.yml
new file mode 100644
index 00000000..5cd2e08e
--- /dev/null
+++ b/modules/nf-core/mosdepth/tests/tags.yml
@@ -0,0 +1,2 @@
+mosdepth:
+  - "modules/nf-core/mosdepth/**"
diff --git a/modules/nf-core/mosdepth/tests/threshold.config b/modules/nf-core/mosdepth/tests/threshold.config
new file mode 100644
index 00000000..9b014ddf
--- /dev/null
+++ b/modules/nf-core/mosdepth/tests/threshold.config
@@ -0,0 +1,3 @@
+process {
+    ext.args = "--thresholds 1,10,20,30"
+}
\ No newline at end of file
diff --git a/modules/nf-core/mosdepth/tests/window.config b/modules/nf-core/mosdepth/tests/window.config
new file mode 100644
index 00000000..7a0f755c
--- /dev/null
+++ b/modules/nf-core/mosdepth/tests/window.config
@@ -0,0 +1,3 @@
+process {
+    ext.args = "--by 100"
+}
\ No newline at end of file
diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml
new file mode 100644
index 00000000..bc0bdb5b
--- /dev/null
+++ b/modules/nf-core/multiqc/environment.yml
@@ -0,0 +1,7 @@
+name: multiqc
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::multiqc=1.18
diff --git a/modules/nf-core/multiqc/tests/main.nf.test b/modules/nf-core/multiqc/tests/main.nf.test
new file mode 100644
index 00000000..c2dad217
--- /dev/null
+++ b/modules/nf-core/multiqc/tests/main.nf.test
@@ -0,0 +1,63 @@
+nextflow_process {
+
+    name "Test Process MULTIQC"
+    script "../main.nf"
+    process "MULTIQC"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "multiqc"
+
+    test("MULTIQC: FASTQC") {
+
+        when {
+            params {
+                outdir = "$outputDir"
+            }
+            process {
+                """
+                input[0] = Channel.of([file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz_fastqc_zip'], checkIfExists: true)])
+                input[1] = []
+                input[2] = []
+                input[3] = []
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert path(process.out.report.get(0)).exists() },
+                { assert path(process.out.data.get(0)).exists() },
+                { assert path(process.out.versions.get(0)).getText().contains("multiqc") }
+            )
+        }
+
+    }
+
+    test("MULTIQC: FASTQC and a config file") {
+
+        when {
+            params {
+                outdir = "$outputDir"
+            }
+            process {
+                """
+                input[0] = Channel.of([file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz_fastqc_zip'], checkIfExists: true)])
+                input[1] = Channel.of(file("https://github.com/nf-core/tools/raw/dev/nf_core/pipeline-template/assets/multiqc_config.yml", checkIfExists: true))
+                input[2] = []
+                input[3] = []
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert path(process.out.report.get(0)).exists() },
+                { assert path(process.out.data.get(0)).exists() },
+                { assert path(process.out.versions.get(0)).getText().contains("multiqc") }
+            )
+        }
+
+    }
+}
diff --git a/modules/nf-core/multiqc/tests/tags.yml b/modules/nf-core/multiqc/tests/tags.yml
new file mode 100644
index 00000000..bea6c0d3
--- /dev/null
+++ b/modules/nf-core/multiqc/tests/tags.yml
@@ -0,0 +1,2 @@
+multiqc:
+  - modules/nf-core/multiqc/**
diff --git a/modules/nf-core/nanoplot/environment.yml b/modules/nf-core/nanoplot/environment.yml
new file mode 100644
index 00000000..219cd2e3
--- /dev/null
+++ b/modules/nf-core/nanoplot/environment.yml
@@ -0,0 +1,7 @@
+name: nanoplot
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::nanoplot=1.41.6
diff --git a/modules/nf-core/nanoplot/main.nf b/modules/nf-core/nanoplot/main.nf
index ca0d8454..6dfe1352 100644
--- a/modules/nf-core/nanoplot/main.nf
+++ b/modules/nf-core/nanoplot/main.nf
@@ -2,10 +2,10 @@ process NANOPLOT {
     tag "$meta.id"
     label 'process_low'
 
-    conda "bioconda::nanoplot=1.41.0"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/nanoplot:1.41.0--pyhdfd78af_0' :
-        'quay.io/biocontainers/nanoplot:1.41.0--pyhdfd78af_0' }"
+        'https://depot.galaxyproject.org/singularity/nanoplot:1.41.6--pyhdfd78af_0' :
+        'biocontainers/nanoplot:1.41.6--pyhdfd78af_0' }"
 
     input:
     tuple val(meta), path(ontfile)
@@ -29,6 +29,7 @@ process NANOPLOT {
         $args \\
         -t $task.cpus \\
         $input_file
+
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
         nanoplot: \$(echo \$(NanoPlot --version 2>&1) | sed 's/^.*NanoPlot //; s/ .*\$//')
diff --git a/modules/nf-core/nanoplot/meta.yml b/modules/nf-core/nanoplot/meta.yml
index 28c8c2d3..46fbd562 100644
--- a/modules/nf-core/nanoplot/meta.yml
+++ b/modules/nf-core/nanoplot/meta.yml
@@ -57,3 +57,6 @@ output:
 authors:
   - "@drpatelh"
   - "@yuukiiwa"
+maintainers:
+  - "@drpatelh"
+  - "@yuukiiwa"
diff --git a/modules/nf-core/nanoplot/tests/main.nf.test b/modules/nf-core/nanoplot/tests/main.nf.test
new file mode 100644
index 00000000..d8dc6bc0
--- /dev/null
+++ b/modules/nf-core/nanoplot/tests/main.nf.test
@@ -0,0 +1,71 @@
+nextflow_process {
+
+    name "Test Process NANOPLOT"
+    tag "modules_nfcore"
+    tag "modules"
+    tag "nanoplot"
+    script "../main.nf"
+    process "NANOPLOT"
+
+    test("NanoPlot summary") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ], // meta map
+                    [ file(params.test_data['sarscov2']['nanopore']['test_sequencing_summary'], checkIfExists: true) ]
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                            process.out.txt,
+                            process.out.versions
+                         ).match()
+                },
+                {
+                    with(process.out.html.get(0)) {
+                        assert get(1).collect { p -> file(p).getName() }.contains("NanoPlot-report.html")
+                    }
+                } 
+            )
+        }
+
+    }
+
+    test("NanoPlot FASTQ") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ], // meta map
+                    [ file(params.test_data['sarscov2']['nanopore']['test_fastq_gz'], checkIfExists: true) ]
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                            process.out.txt,
+                            process.out.versions
+                         ).match()
+                },
+                {
+                    with(process.out.html.get(0)) {
+                        assert get(1).collect { p -> file(p).getName() }.contains("NanoPlot-report.html")
+                    }
+                } 
+            )
+        }
+
+    }
+}
diff --git a/modules/nf-core/nanoplot/tests/main.nf.test.snap b/modules/nf-core/nanoplot/tests/main.nf.test.snap
new file mode 100644
index 00000000..1df28066
--- /dev/null
+++ b/modules/nf-core/nanoplot/tests/main.nf.test.snap
@@ -0,0 +1,34 @@
+{
+    "NanoPlot FASTQ": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "NanoStats.txt:md5,50373c7543e71e3baf040926f0c69ac1"
+                ]
+            ],
+            [
+                "versions.yml:md5,961cee64736aeb9e56b65d05ee3cd1a5"
+            ]
+        ],
+        "timestamp": "2023-10-17T16:18:44.848688965"
+    },
+    "NanoPlot summary": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "NanoStats.txt:md5,90464bf7049ca66106de56e7eac23dd4"
+                ]
+            ],
+            [
+                "versions.yml:md5,961cee64736aeb9e56b65d05ee3cd1a5"
+            ]
+        ],
+        "timestamp": "2023-10-17T16:18:31.104601192"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/nanoplot/tests/tags.yaml b/modules/nf-core/nanoplot/tests/tags.yaml
new file mode 100644
index 00000000..7c6ce3fa
--- /dev/null
+++ b/modules/nf-core/nanoplot/tests/tags.yaml
@@ -0,0 +1,2 @@
+nanoplot:
+  - modules/nf-core/nanoplot/**
diff --git a/modules/nf-core/nextclade/datasetget/environment.yml b/modules/nf-core/nextclade/datasetget/environment.yml
new file mode 100644
index 00000000..cdd9f646
--- /dev/null
+++ b/modules/nf-core/nextclade/datasetget/environment.yml
@@ -0,0 +1,7 @@
+name: nextclade_datasetget
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::nextclade=2.12.0
diff --git a/modules/nf-core/nextclade/datasetget/main.nf b/modules/nf-core/nextclade/datasetget/main.nf
index ab2e20d3..70c900a5 100644
--- a/modules/nf-core/nextclade/datasetget/main.nf
+++ b/modules/nf-core/nextclade/datasetget/main.nf
@@ -2,10 +2,10 @@ process NEXTCLADE_DATASETGET {
     tag "$dataset"
     label 'process_low'
 
-    conda "bioconda::nextclade=2.12.0"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/nextclade:2.12.0--h9ee0642_0' :
-        'quay.io/biocontainers/nextclade:2.12.0--h9ee0642_0' }"
+        'biocontainers/nextclade:2.12.0--h9ee0642_0' }"
 
     input:
     val dataset
diff --git a/modules/nf-core/nextclade/datasetget/meta.yml b/modules/nf-core/nextclade/datasetget/meta.yml
index 16ee59f7..f3fb403e 100644
--- a/modules/nf-core/nextclade/datasetget/meta.yml
+++ b/modules/nf-core/nextclade/datasetget/meta.yml
@@ -10,9 +10,7 @@ tools:
       homepage: https://github.com/nextstrain/nextclade
       documentation: https://github.com/nextstrain/nextclade
       tool_dev_url: https://github.com/nextstrain/nextclade
-
       licence: ["MIT"]
-
 input:
   - dataset:
       type: string
@@ -26,7 +24,6 @@ input:
       type: string
       description: Version tag of the dataset to download. A list of available datasets can be obtained using the nextclade dataset list command.
       pattern: ".+"
-
 output:
   - versions:
       type: file
@@ -36,7 +33,9 @@ output:
       type: path
       description: A directory containing the dataset files needed for nextclade run
       pattern: "prefix"
-
 authors:
   - "@antunderwood"
   - "@drpatelh"
+maintainers:
+  - "@antunderwood"
+  - "@drpatelh"
diff --git a/modules/nf-core/nextclade/run/environment.yml b/modules/nf-core/nextclade/run/environment.yml
new file mode 100644
index 00000000..1e50e8d4
--- /dev/null
+++ b/modules/nf-core/nextclade/run/environment.yml
@@ -0,0 +1,7 @@
+name: nextclade_run
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::nextclade=2.12.0
diff --git a/modules/nf-core/nextclade/run/main.nf b/modules/nf-core/nextclade/run/main.nf
index 960892b7..33fb34c6 100644
--- a/modules/nf-core/nextclade/run/main.nf
+++ b/modules/nf-core/nextclade/run/main.nf
@@ -2,10 +2,10 @@ process NEXTCLADE_RUN {
     tag "$meta.id"
     label 'process_low'
 
-    conda "bioconda::nextclade=2.12.0"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/nextclade:2.12.0--h9ee0642_0' :
-        'quay.io/biocontainers/nextclade:2.12.0--h9ee0642_0' }"
+        'biocontainers/nextclade:2.12.0--h9ee0642_0' }"
 
     input:
     tuple val(meta), path(fasta)
diff --git a/modules/nf-core/nextclade/run/meta.yml b/modules/nf-core/nextclade/run/meta.yml
index 3271fca4..ceebfe20 100644
--- a/modules/nf-core/nextclade/run/meta.yml
+++ b/modules/nf-core/nextclade/run/meta.yml
@@ -10,9 +10,7 @@ tools:
       homepage: https://github.com/nextstrain/nextclade
       documentation: https://github.com/nextstrain/nextclade
       tool_dev_url: https://github.com/nextstrain/nextclade
-
       licence: ["MIT"]
-
 input:
   - meta:
       type: map
@@ -27,7 +25,6 @@ input:
       type: file
       description: FASTA file containing one or more consensus sequences
       pattern: "*.{fasta,fa}"
-
 output:
   - meta:
       type: map
@@ -54,7 +51,9 @@ output:
       type: file
       description: TSV file containing nextclade results
       pattern: "*.{tsv}"
-
 authors:
   - "@antunderwood"
   - "@drpatelh"
+maintainers:
+  - "@antunderwood"
+  - "@drpatelh"
diff --git a/modules/nf-core/pangolin/environment.yml b/modules/nf-core/pangolin/environment.yml
new file mode 100644
index 00000000..3c4d98c8
--- /dev/null
+++ b/modules/nf-core/pangolin/environment.yml
@@ -0,0 +1,7 @@
+name: pangolin
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::pangolin=4.2
diff --git a/modules/nf-core/pangolin/main.nf b/modules/nf-core/pangolin/main.nf
index e2db37b2..00cf4290 100644
--- a/modules/nf-core/pangolin/main.nf
+++ b/modules/nf-core/pangolin/main.nf
@@ -2,10 +2,10 @@ process PANGOLIN {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::pangolin=4.2"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/pangolin:4.2--pyhdfd78af_1' :
-        'quay.io/biocontainers/pangolin:4.2--pyhdfd78af_1' }"
+        'biocontainers/pangolin:4.2--pyhdfd78af_1' }"
 
     input:
     tuple val(meta), path(fasta)
diff --git a/modules/nf-core/pangolin/meta.yml b/modules/nf-core/pangolin/meta.yml
index 93c25a75..6493f2c8 100644
--- a/modules/nf-core/pangolin/meta.yml
+++ b/modules/nf-core/pangolin/meta.yml
@@ -32,3 +32,6 @@ output:
 authors:
   - "@kevinmenden"
   - "@drpatelh"
+maintainers:
+  - "@kevinmenden"
+  - "@drpatelh"
diff --git a/modules/nf-core/picard/collectmultiplemetrics/environment.yml b/modules/nf-core/picard/collectmultiplemetrics/environment.yml
new file mode 100644
index 00000000..79b33280
--- /dev/null
+++ b/modules/nf-core/picard/collectmultiplemetrics/environment.yml
@@ -0,0 +1,7 @@
+name: picard_collectmultiplemetrics
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::picard=3.1.1
diff --git a/modules/nf-core/picard/collectmultiplemetrics/main.nf b/modules/nf-core/picard/collectmultiplemetrics/main.nf
index ed88dbe7..5640ce94 100644
--- a/modules/nf-core/picard/collectmultiplemetrics/main.nf
+++ b/modules/nf-core/picard/collectmultiplemetrics/main.nf
@@ -2,10 +2,10 @@ process PICARD_COLLECTMULTIPLEMETRICS {
     tag "$meta.id"
     label 'process_single'
 
-    conda "bioconda::picard=3.0.0"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:3.0.0--hdfd78af_1' :
-        'quay.io/biocontainers/picard:3.0.0--hdfd78af_1' }"
+        'https://depot.galaxyproject.org/singularity/picard:3.1.1--hdfd78af_0' :
+        'biocontainers/picard:3.1.1--hdfd78af_0' }"
 
     input:
     tuple val(meta) , path(bam), path(bai)
@@ -14,7 +14,7 @@ process PICARD_COLLECTMULTIPLEMETRICS {
 
     output:
     tuple val(meta), path("*_metrics"), emit: metrics
-    tuple val(meta), path("*.pdf")    , emit: pdf
+    tuple val(meta), path("*.pdf")    , emit: pdf, optional: true
     path  "versions.yml"              , emit: versions
 
     when:
diff --git a/modules/nf-core/picard/collectmultiplemetrics/meta.yml b/modules/nf-core/picard/collectmultiplemetrics/meta.yml
index 22656080..67bba57b 100644
--- a/modules/nf-core/picard/collectmultiplemetrics/meta.yml
+++ b/modules/nf-core/picard/collectmultiplemetrics/meta.yml
@@ -66,3 +66,5 @@ output:
       pattern: "versions.yml"
 authors:
   - "@drpatelh"
+maintainers:
+  - "@drpatelh"
diff --git a/modules/nf-core/picard/markduplicates/environment.yml b/modules/nf-core/picard/markduplicates/environment.yml
new file mode 100644
index 00000000..58b795f5
--- /dev/null
+++ b/modules/nf-core/picard/markduplicates/environment.yml
@@ -0,0 +1,7 @@
+name: picard_markduplicates
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::picard=3.1.1
diff --git a/modules/nf-core/picard/markduplicates/main.nf b/modules/nf-core/picard/markduplicates/main.nf
index 1fe6ee2d..80930cc4 100644
--- a/modules/nf-core/picard/markduplicates/main.nf
+++ b/modules/nf-core/picard/markduplicates/main.nf
@@ -2,15 +2,15 @@ process PICARD_MARKDUPLICATES {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::picard=3.0.0"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:3.0.0--hdfd78af_1' :
-        'quay.io/biocontainers/picard:3.0.0--hdfd78af_1' }"
+        'https://depot.galaxyproject.org/singularity/picard:3.1.1--hdfd78af_0' :
+        'biocontainers/picard:3.1.1--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(bam)
-    path fasta
-    path fai
+    tuple val(meta2), path(fasta)
+    tuple val(meta3), path(fai)
 
     output:
     tuple val(meta), path("*.bam")        , emit: bam
@@ -30,6 +30,9 @@ process PICARD_MARKDUPLICATES {
     } else {
         avail_mem = (task.memory.mega*0.8).intValue()
     }
+
+    if ("$bam" == "${prefix}.bam") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!"
+
     """
     picard \\
         -Xmx${avail_mem}M \\
@@ -48,6 +51,7 @@ process PICARD_MARKDUPLICATES {
 
     stub:
     def prefix = task.ext.prefix ?: "${meta.id}"
+    if ("$bam" == "${prefix}.bam") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!"
     """
     touch ${prefix}.bam
     touch ${prefix}.bam.bai
diff --git a/modules/nf-core/picard/markduplicates/meta.yml b/modules/nf-core/picard/markduplicates/meta.yml
index 3f2357bb..1ab90c07 100644
--- a/modules/nf-core/picard/markduplicates/meta.yml
+++ b/modules/nf-core/picard/markduplicates/meta.yml
@@ -25,10 +25,20 @@ input:
       type: file
       description: BAM file
       pattern: "*.{bam,cram,sam}"
+  - meta2:
+      type: map
+      description: |
+        Groovy Map containing reference information
+        e.g. [ id:'genome' ]
   - fasta:
       type: file
       description: Reference genome fasta file
       pattern: "*.{fasta,fa}"
+  - meta3:
+      type: map
+      description: |
+        Groovy Map containing reference information
+        e.g. [ id:'genome' ]
   - fai:
       type: file
       description: Reference genome fasta index
@@ -58,3 +68,8 @@ output:
 authors:
   - "@drpatelh"
   - "@projectoriented"
+  - "@ramprasadn"
+maintainers:
+  - "@drpatelh"
+  - "@projectoriented"
+  - "@ramprasadn"
diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test b/modules/nf-core/picard/markduplicates/tests/main.nf.test
new file mode 100644
index 00000000..b2bba094
--- /dev/null
+++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test
@@ -0,0 +1,111 @@
+nextflow_process {
+
+    name "Test Process PICARD_MARKDUPLICATES"
+    script "../main.nf"
+    process "PICARD_MARKDUPLICATES"
+    config "./nextflow.config"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "picard"
+    tag "picard/markduplicates"
+
+    test("sarscov2 - bam, fasta, fai - sorted bam") {
+
+        when {
+            process {
+                """
+                input[0] = [ 
+                    [ id:'test', single_end:false ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
+                ]
+                input[1] = [ 
+                    [ id:'genome' ],
+                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                ]
+                input[2] = [ 
+                    [ id:'genome' ],
+                    file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.bam[0][1]).name,
+                    path(process.out.metrics.get(0).get(1)).readLines()[0..2],
+                    process.out.versions
+                ).match() }
+            )
+        }
+    }
+
+    test("sarscov2 - bam, fasta, fai - unsorted bam") {
+
+        when {
+            process {
+                """
+                input[0] = [ 
+                    [ id:'test', single_end:false ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true)
+                ]
+                input[1] = [ 
+                    [ id:'genome' ],
+                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                ]
+                input[2] = [ 
+                    [ id:'genome' ],
+                    file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.bam[0][1]).name,
+                    path(process.out.metrics.get(0).get(1)).readLines()[0..2],
+                    process.out.versions
+                ).match() }
+            )
+        }
+    }
+
+   test("homo_sapiens - cram, fasta, fai") {
+
+        when {
+            process {
+                """
+                input[0] = [ 
+                    [ id:'test', single_end:false ], // meta map
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true)
+                ]
+                input[1] = [ 
+                    [ id:'genome' ],
+                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                ]
+                input[2] = [ 
+                    [ id:'genome' ],
+                    file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.bam[0][1]).name,
+                    path(process.out.metrics.get(0).get(1)).readLines()[0..2],
+                    process.out.versions
+                ).match() }
+            )
+        }
+    }
+
+}
diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap
new file mode 100644
index 00000000..cd788a4d
--- /dev/null
+++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap
@@ -0,0 +1,44 @@
+{
+    "sarscov2 - bam, fasta, fai - unsorted bam": {
+        "content": [
+            "test.marked.bam",
+            [
+                "## htsjdk.samtools.metrics.StringHeader",
+                "# MarkDuplicates --INPUT test.paired_end.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX <optimized capture of last three ':' separated fields as numeric values> --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false",
+                "## htsjdk.samtools.metrics.StringHeader"
+            ],
+            [
+                "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
+            ]
+        ],
+        "timestamp": "2023-11-28T10:50:37.735339781"
+    },
+    "homo_sapiens - cram, fasta, fai": {
+        "content": [
+            "test.marked.bam",
+            [
+                "## htsjdk.samtools.metrics.StringHeader",
+                "# MarkDuplicates --INPUT test.paired_end.sorted.cram --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX <optimized capture of last three ':' separated fields as numeric values> --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false",
+                "## htsjdk.samtools.metrics.StringHeader"
+            ],
+            [
+                "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
+            ]
+        ],
+        "timestamp": "2023-11-28T10:50:48.897954543"
+    },
+    "sarscov2 - bam, fasta, fai - sorted bam": {
+        "content": [
+            "test.marked.bam",
+            [
+                "## htsjdk.samtools.metrics.StringHeader",
+                "# MarkDuplicates --INPUT test.paired_end.sorted.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX <optimized capture of last three ':' separated fields as numeric values> --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false",
+                "## htsjdk.samtools.metrics.StringHeader"
+            ],
+            [
+                "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
+            ]
+        ],
+        "timestamp": "2023-11-28T10:50:26.591387512"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/picard/markduplicates/tests/nextflow.config b/modules/nf-core/picard/markduplicates/tests/nextflow.config
new file mode 100644
index 00000000..02818dd6
--- /dev/null
+++ b/modules/nf-core/picard/markduplicates/tests/nextflow.config
@@ -0,0 +1,6 @@
+process {
+    withName: PICARD_MARKDUPLICATES {
+        ext.prefix = { "${meta.id}.marked" }
+        ext.args = '--ASSUME_SORT_ORDER queryname'
+    }
+}
diff --git a/modules/nf-core/picard/markduplicates/tests/tags.yml b/modules/nf-core/picard/markduplicates/tests/tags.yml
new file mode 100644
index 00000000..4f213d62
--- /dev/null
+++ b/modules/nf-core/picard/markduplicates/tests/tags.yml
@@ -0,0 +1,2 @@
+picard/markduplicates:
+  - modules/nf-core/picard/markduplicates/**
diff --git a/modules/nf-core/plasmidid/environment.yml b/modules/nf-core/plasmidid/environment.yml
new file mode 100644
index 00000000..1eda21d5
--- /dev/null
+++ b/modules/nf-core/plasmidid/environment.yml
@@ -0,0 +1,7 @@
+name: plasmidid
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::plasmidid=1.6.5
diff --git a/modules/nf-core/plasmidid/main.nf b/modules/nf-core/plasmidid/main.nf
index ff7165b1..32fe7716 100644
--- a/modules/nf-core/plasmidid/main.nf
+++ b/modules/nf-core/plasmidid/main.nf
@@ -2,10 +2,10 @@ process PLASMIDID {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::plasmidid=1.6.5"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/plasmidid:1.6.5--hdfd78af_0' :
-        'quay.io/biocontainers/plasmidid:1.6.5--hdfd78af_0' }"
+        'biocontainers/plasmidid:1.6.5--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(scaffold)
diff --git a/modules/nf-core/plasmidid/meta.yml b/modules/nf-core/plasmidid/meta.yml
index 4e0169d8..66479359 100644
--- a/modules/nf-core/plasmidid/meta.yml
+++ b/modules/nf-core/plasmidid/meta.yml
@@ -10,9 +10,7 @@ tools:
       homepage: https://github.com/BU-ISCIII/plasmidID/wiki
       documentation: https://github.com/BU-ISCIII/plasmidID#readme
       tool_dev_url: https://github.com/BU-ISCIII/plasmidID
-
       licence: ["GPL v3"]
-
 input:
   - meta:
       type: map
@@ -27,7 +25,6 @@ input:
       type: file
       description: FASTA reference file
       pattern: "*.{fasta,fa}"
-
 output:
   - meta:
       type: map
@@ -70,7 +67,9 @@ output:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
diff --git a/modules/nf-core/pycoqc/environment.yml b/modules/nf-core/pycoqc/environment.yml
new file mode 100644
index 00000000..c2a3a4d1
--- /dev/null
+++ b/modules/nf-core/pycoqc/environment.yml
@@ -0,0 +1,7 @@
+name: pycoqc
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::pycoqc=2.5.2
diff --git a/modules/nf-core/pycoqc/main.nf b/modules/nf-core/pycoqc/main.nf
index 02092a4b..98169db2 100644
--- a/modules/nf-core/pycoqc/main.nf
+++ b/modules/nf-core/pycoqc/main.nf
@@ -2,10 +2,10 @@ process PYCOQC {
     tag "$summary"
     label 'process_medium'
 
-    conda "bioconda::pycoqc=2.5.2"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/pycoqc:2.5.2--py_0' :
-        'quay.io/biocontainers/pycoqc:2.5.2--py_0' }"
+        'biocontainers/pycoqc:2.5.2--py_0' }"
 
     input:
     tuple val(meta), path(summary)
diff --git a/modules/nf-core/pycoqc/meta.yml b/modules/nf-core/pycoqc/meta.yml
index 83748855..cfbd8516 100644
--- a/modules/nf-core/pycoqc/meta.yml
+++ b/modules/nf-core/pycoqc/meta.yml
@@ -13,7 +13,6 @@ tools:
       tool_dev_url: https://github.com/tleonardi/pycoQC
       doi: "10.21105/joss.01236"
       licence: ["GNU General Public v3 (GPL v3)"]
-
 input:
   - meta:
       type: map
@@ -24,7 +23,6 @@ input:
       type: file
       description: sequencing summary file
       pattern: "*.{txt}"
-
 output:
   - meta:
       type: map
@@ -42,7 +40,9 @@ output:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-
 authors:
   - "@joseespinosa"
   - "@drpatelh"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
diff --git a/modules/nf-core/pycoqc/tests/main.nf.test b/modules/nf-core/pycoqc/tests/main.nf.test
new file mode 100644
index 00000000..afc15a98
--- /dev/null
+++ b/modules/nf-core/pycoqc/tests/main.nf.test
@@ -0,0 +1,43 @@
+nextflow_process {
+
+    name "Test Process PYCOQC"
+    script "../main.nf"
+    config "./nextflow.config"
+    process "PYCOQC"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "pycoqc"
+
+    test("sarscov2 nanopore [sequencing_summary.txt]") {
+
+        when {
+            params {
+                outdir = "$outputDir"
+            }
+            process {
+                """
+                input[0] =  [
+                                [ id:'test' ], // meta map
+                                file(params.test_data['sarscov2']['nanopore']['test_sequencing_summary'], checkIfExists: true)
+                            ]
+
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out.versions).match("versions") },
+                { assert process.out.html.get(0).get(1) ==~ ".*/test.html" },
+                {
+                    with (process.out.json.get(0)) {
+                        assert snapshot(path(get(1)).json['All Reads']).match("all_reads")
+                    }
+                }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/pycoqc/tests/main.nf.test.snap b/modules/nf-core/pycoqc/tests/main.nf.test.snap
new file mode 100644
index 00000000..6f76ec99
--- /dev/null
+++ b/modules/nf-core/pycoqc/tests/main.nf.test.snap
@@ -0,0 +1,642 @@
+{
+    "versions": {
+        "content": [
+            [
+                "versions.yml:md5,b8cbbd20cd14b232853b22dad9097029"
+            ]
+        ],
+        "timestamp": "2023-10-26T12:27:18.329232497"
+    },
+    "all_reads": {
+        "content": [
+            {
+                "run": {
+                    "run_duration": 0.05634208255343967,
+                    "active_channels": 4,
+                    "runid_number": 85,
+                    "barcodes_number": 2
+                },
+                "basecall": {
+                    "reads_number": 100,
+                    "bases_number": 1160,
+                    "N50": 12,
+                    "len_percentiles": [
+                        7.0,
+                        7.99,
+                        8.0,
+                        8.0,
+                        8.96,
+                        9.0,
+                        9.0,
+                        9.0,
+                        9.0,
+                        9.0,
+                        9.0,
+                        9.0,
+                        9.0,
+                        9.0,
+                        9.860000000000001,
+                        10.0,
+                        10.0,
+                        10.0,
+                        10.0,
+                        10.0,
+                        10.0,
+                        10.0,
+                        10.0,
+                        10.0,
+                        10.759999999999998,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.0,
+                        11.490000000000002,
+                        12.0,
+                        12.0,
+                        12.0,
+                        12.0,
+                        12.0,
+                        12.0,
+                        12.0,
+                        12.0,
+                        12.0,
+                        12.0,
+                        12.0,
+                        12.0,
+                        12.0,
+                        12.350000000000009,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.0,
+                        13.129999999999995,
+                        14.0,
+                        14.0,
+                        14.0,
+                        14.0,
+                        14.0,
+                        14.0,
+                        14.0,
+                        14.0,
+                        14.0,
+                        14.030000000000001,
+                        15.019999999999996,
+                        16.010000000000005,
+                        17.0
+                    ],
+                    "qual_score_percentiles": [
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0,
+                        0.0
+                    ],
+                    "len_hist": {
+                        "x": [
+                            7.079467203414813,
+                            7.1598365548894245,
+                            7.241118296021455,
+                            7.323322784675837,
+                            7.406460496304719,
+                            7.490542025282382,
+                            7.575578086255286,
+                            7.661579515507467,
+                            7.748557272341409,
+                            7.836522440474623,
+                            7.925486229452044,
+                            8.0154599760745,
+                            8.106455145843357,
+                            8.198483334421615,
+                            8.291556269111537,
+                            8.38568581034909,
+                            8.480883953215336,
+                            8.577162828964994,
+                            8.674534706572327,
+                            8.773011994294619,
+                            8.872607241253366,
+                            8.973333139033429,
+                            9.075202523300351,
+                            9.178228375436028,
+                            9.282423824192943,
+                            9.38780214736718,
+                            9.494376773490446,
+                            9.60216128354128,
+                            9.711169412675714,
+                            9.821415051977546,
+                            9.93291225022852,
+                            10.045675215698578,
+                            10.159718317956445,
+                            10.275056089700772,
+                            10.39170322861204,
+                            10.509674599225537,
+                            10.628985234825558,
+                            10.74965033936112,
+                            10.87168528938343,
+                            10.995105636005325,
+                            11.11992710688301,
+                            11.24616560822024,
+                            11.373837226795256,
+                            11.502958232010789,
+                            11.633545077967261,
+                            11.765614405559578,
+                            11.899183044597708,
+                            12.0342680159513,
+                            12.170886533718726,
+                            12.309056007420674,
+                            12.448794044218685,
+                            12.590118451158833,
+                            12.733047237440953,
+                            12.877598616713547,
+                            13.023791009394788,
+                            13.171643045019879,
+                            13.321173564615009,
+                            13.472401623098337,
+                            13.625346491708175,
+                            13.780027660458732,
+                            13.936464840623792,
+                            14.094677967248542,
+                            14.254687201689917,
+                            14.416512934185814,
+                            14.580175786453418,
+                            14.74569661431711,
+                            14.913096510366126,
+                            15.082396806642413,
+                            15.253619077359039,
+                            15.426785141649408,
+                            15.601917066347703,
+                            15.779037168800926,
+                            15.958168019712783,
+                            16.139332446019967,
+                            16.322553533800992,
+                            16.507854631218105,
+                            16.69525935149256,
+                            16.88479157591372,
+                            17.076475456882275,
+                            17.270335420988005,
+                            17.466396172122547,
+                            17.66468269462737,
+                            17.86522025647767,
+                            18.068034412502243,
+                            18.27315100763998,
+                            18.48059618023337,
+                            18.69039636535932,
+                            18.902578298197817,
+                            19.117169017438876,
+                            19.33419586872804,
+                            19.553686508151195,
+                            19.77566890575874,
+                            20.00017134912987,
+                            20.22722244697736,
+                            20.456851132793165,
+                            20.689086668535484,
+                            20.923958648357658,
+                            21.16149700237941,
+                            21.401732000500846
+                        ],
+                        "y": [
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            1.0,
+                            1.0,
+                            1.0,
+                            1.0,
+                            1.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            1.0,
+                            1.0,
+                            1.0,
+                            1.0,
+                            1.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            1.0,
+                            3.0,
+                            4.0,
+                            5.0,
+                            4.0,
+                            3.0,
+                            2.0,
+                            1.0,
+                            1.0,
+                            2.0,
+                            2.0,
+                            2.0,
+                            1.0,
+                            1.0,
+                            1.0,
+                            2.0,
+                            3.0,
+                            4.0,
+                            3.0,
+                            2.0,
+                            1.0,
+                            1.0,
+                            1.0,
+                            1.0,
+                            2.0,
+                            1.0,
+                            1.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0
+                        ]
+                    },
+                    "qual_score_hist": {
+                        "x": [
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0
+                        ],
+                        "y": [
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            0.0,
+                            1.0,
+                            3.0,
+                            9.0,
+                            18.0,
+                            29.0,
+                            37.0
+                        ]
+                    }
+                }
+            }
+        ],
+        "timestamp": "2023-10-26T12:19:31.009207323"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/pycoqc/tests/nextflow.config b/modules/nf-core/pycoqc/tests/nextflow.config
new file mode 100644
index 00000000..d532f8f7
--- /dev/null
+++ b/modules/nf-core/pycoqc/tests/nextflow.config
@@ -0,0 +1,9 @@
+process {
+
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+
+    withName: PYCOQC {
+        ext.args = '--min_pass_qual 0'
+    }
+
+}
diff --git a/modules/nf-core/pycoqc/tests/tags.yml b/modules/nf-core/pycoqc/tests/tags.yml
new file mode 100644
index 00000000..ab301426
--- /dev/null
+++ b/modules/nf-core/pycoqc/tests/tags.yml
@@ -0,0 +1,2 @@
+pycoqc:
+  - modules/nf-core/pycoqc/**
diff --git a/modules/nf-core/quast/environment.yml b/modules/nf-core/quast/environment.yml
new file mode 100644
index 00000000..0f9e3079
--- /dev/null
+++ b/modules/nf-core/quast/environment.yml
@@ -0,0 +1,7 @@
+name: quast
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::quast=5.2.0
diff --git a/modules/nf-core/quast/main.nf b/modules/nf-core/quast/main.nf
index a7f9a4c8..d8f36284 100644
--- a/modules/nf-core/quast/main.nf
+++ b/modules/nf-core/quast/main.nf
@@ -1,31 +1,33 @@
 process QUAST {
+    tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::quast=5.2.0"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/quast:5.2.0--py39pl5321h2add14b_1' :
-        'quay.io/biocontainers/quast:5.2.0--py39pl5321h2add14b_1' }"
+        'biocontainers/quast:5.2.0--py39pl5321h2add14b_1' }"
 
     input:
-    path consensus
-    path fasta
-    path gff
-    val use_fasta
-    val use_gff
+    tuple val(meta) , path(consensus)
+    tuple val(meta2), path(fasta)
+    tuple val(meta3), path(gff)
 
     output:
-    path "${prefix}"    , emit: results
-    path '*.tsv'        , emit: tsv
-    path "versions.yml" , emit: versions
+    tuple val(meta), path("${prefix}")                   , emit: results
+    tuple val(meta), path("${prefix}.tsv")               , emit: tsv
+    tuple val(meta), path("${prefix}_transcriptome.tsv") , optional: true , emit: transcriptome
+    tuple val(meta), path("${prefix}_misassemblies.tsv") , optional: true , emit: misassemblies
+    tuple val(meta), path("${prefix}_unaligned.tsv")     , optional: true , emit: unaligned
+    path "versions.yml"                                  , emit: versions
 
     when:
     task.ext.when == null || task.ext.when
 
     script:
-    def args = task.ext.args   ?: ''
-    prefix   = task.ext.prefix ?: 'quast'
-    def features  = use_gff ? "--features $gff" : ''
-    def reference = use_fasta ? "-r $fasta" : ''
+    def args      = task.ext.args   ?: ''
+    prefix        = task.ext.prefix ?: "${meta.id}"
+    def features  = gff             ?  "--features $gff" : ''
+    def reference = fasta           ?  "-r $fasta"       : ''
     """
     quast.py \\
         --output-dir $prefix \\
@@ -35,7 +37,96 @@ process QUAST {
         $args \\
         ${consensus.join(' ')}
 
-    ln -s ${prefix}/report.tsv
+    ln -s ${prefix}/report.tsv ${prefix}.tsv
+    [ -f  ${prefix}/contigs_reports/all_alignments_transcriptome.tsv ] && ln -s ${prefix}/contigs_reports/all_alignments_transcriptome.tsv ${prefix}_transcriptome.tsv
+    [ -f  ${prefix}/contigs_reports/misassemblies_report.tsv         ] && ln -s ${prefix}/contigs_reports/misassemblies_report.tsv ${prefix}_misassemblies.tsv
+    [ -f  ${prefix}/contigs_reports/unaligned_report.tsv             ] && ln -s ${prefix}/contigs_reports/unaligned_report.tsv ${prefix}_unaligned.tsv
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        quast: \$(quast.py --version 2>&1 | sed 's/^.*QUAST v//; s/ .*\$//')
+    END_VERSIONS
+    """
+
+    stub:
+    def args      = task.ext.args   ?: ''
+    prefix        = task.ext.prefix ?: "${meta.id}"
+    def features  = gff             ? "--features $gff" : ''
+    def reference = fasta           ? "-r $fasta" : ''
+
+    """
+    mkdir -p $prefix
+    touch $prefix/report.tsv
+    touch $prefix/report.html
+    touch $prefix/report.pdf
+    touch $prefix/quast.log
+    touch $prefix/transposed_report.txt
+    touch $prefix/transposed_report.tex
+    touch $prefix/icarus.html
+    touch $prefix/report.tex
+    touch $prefix/report.txt
+
+    mkdir -p $prefix/basic_stats
+    touch $prefix/basic_stats/cumulative_plot.pdf
+    touch $prefix/basic_stats/Nx_plot.pdf
+    touch $prefix/basic_stats/genome_GC_content_plot.pdf
+    touch $prefix/basic_stats/GC_content_plot.pdf
+
+    mkdir -p $prefix/icarus_viewers
+    touch $prefix/icarus_viewers/contig_size_viewer.html
+
+    ln -s $prefix/report.tsv ${prefix}.tsv
+
+    if [ $fasta ]; then
+        touch $prefix/basic_stats/NGx_plot.pdf
+        touch $prefix/basic_stats/gc.icarus.txt
+
+        mkdir -p $prefix/aligned_stats
+        touch $prefix/aligned_stats/NAx_plot.pdf
+        touch $prefix/aligned_stats/NGAx_plot.pdf
+        touch $prefix/aligned_stats/cumulative_plot.pdf
+
+        mkdir -p $prefix/contigs_reports
+        touch $prefix/contigs_reports/all_alignments_transcriptome.tsv
+        touch $prefix/contigs_reports/contigs_report_transcriptome.mis_contigs.info
+        touch $prefix/contigs_reports/contigs_report_transcriptome.stderr
+        touch $prefix/contigs_reports/contigs_report_transcriptome.stdout
+        touch $prefix/contigs_reports/contigs_report_transcriptome.unaligned.info
+        mkdir -p $prefix/contigs_reports/minimap_output
+        touch $prefix/contigs_reports/minimap_output/transcriptome.coords
+        touch $prefix/contigs_reports/minimap_output/transcriptome.coords.filtered
+        touch $prefix/contigs_reports/minimap_output/transcriptome.coords_tmp
+        touch $prefix/contigs_reports/minimap_output/transcriptome.sf
+        touch $prefix/contigs_reports/minimap_output/transcriptome.unaligned
+        touch $prefix/contigs_reports/minimap_output/transcriptome.used_snps
+        touch $prefix/contigs_reports/misassemblies_frcurve_plot.pdf
+        touch $prefix/contigs_reports/misassemblies_plot.pdf
+        touch $prefix/contigs_reports/misassemblies_report.tex
+        touch $prefix/contigs_reports/misassemblies_report.tsv
+        touch $prefix/contigs_reports/misassemblies_report.txt
+        touch $prefix/contigs_reports/transcriptome.mis_contigs.fa
+        touch $prefix/contigs_reports/transposed_report_misassemblies.tex
+        touch $prefix/contigs_reports/transposed_report_misassemblies.tsv
+        touch $prefix/contigs_reports/transposed_report_misassemblies.txt
+        touch $prefix/contigs_reports/unaligned_report.tex
+        touch $prefix/contigs_reports/unaligned_report.tsv
+        touch $prefix/contigs_reports/unaligned_report.txt
+
+        mkdir -p $prefix/genome_stats
+        touch $prefix/genome_stats/genome_info.txt
+        touch $prefix/genome_stats/transcriptome_gaps.txt
+        touch $prefix/icarus_viewers/alignment_viewer.html
+
+        ln -sf ${prefix}/contigs_reports/misassemblies_report.tsv ${prefix}_misassemblies.tsv
+        ln -sf ${prefix}/contigs_reports/unaligned_report.tsv ${prefix}_unaligned.tsv
+        ln -sf ${prefix}/contigs_reports/all_alignments_transcriptome.tsv ${prefix}_transcriptome.tsv
+
+    fi
+
+    if ([ $fasta ] && [ $gff ]); then
+        touch $prefix/genome_stats/features_cumulative_plot.pdf
+        touch $prefix/genome_stats/features_frcurve_plot.pdf
+    fi
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
diff --git a/modules/nf-core/quast/meta.yml b/modules/nf-core/quast/meta.yml
index 2189bb3e..5850ff98 100644
--- a/modules/nf-core/quast/meta.yml
+++ b/modules/nf-core/quast/meta.yml
@@ -4,6 +4,8 @@ keywords:
   - quast
   - assembly
   - quality
+  - contig
+  - scaffold
 tools:
   - quast:
       description: |
@@ -20,16 +22,9 @@ input:
       type: file
       description: |
         The genome assembly to be evaluated. Has to contain at least a non-empty string dummy value.
-  - use_fasta:
-      type: boolean
-      description: Whether to use the provided fasta reference genome file
   - gff:
       type: file
       description: The genome GFF file. Has to contain at least a non-empty string dummy value.
-  - use_gff:
-      type: boolean
-      description: Whether to use the provided gff reference annotation file
-
 output:
   - quast:
       type: directory
@@ -38,13 +33,29 @@ output:
   - report:
       type: file
       description: tab-separated version of the summary, suitable for spreadsheets and mqc
-      pattern: "report.tsv"
-
+      pattern: "${prefix}.tsv"
+  - misassemblies:
+      type: file
+      description: |
+        Report containing misassemblies, only when a reference fasta is provided
+      pattern: "${prefix}_misassemblies.tsv"
+  - transcriptome:
+      type: file
+      description: |
+        Report containing all the alignments of transcriptome to the assembly, only when a reference fasta is provided
+      pattern: "${prefix}_transcriptome.tsv"
+  - unaligned:
+      type: file
+      description: |
+        Report containing unaligned contigs, only when a reference fasta is provided
+      pattern: "${prefix}_unaligned.tsv"
   - versions:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-
 authors:
   - "@drpatelh"
   - "@kevinmenden"
+maintainers:
+  - "@drpatelh"
+  - "@kevinmenden"
diff --git a/modules/nf-core/samtools/flagstat/environment.yml b/modules/nf-core/samtools/flagstat/environment.yml
new file mode 100644
index 00000000..5efae053
--- /dev/null
+++ b/modules/nf-core/samtools/flagstat/environment.yml
@@ -0,0 +1,7 @@
+name: samtools_flagstat
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::samtools=1.18
diff --git a/modules/nf-core/samtools/flagstat/main.nf b/modules/nf-core/samtools/flagstat/main.nf
index 2120cd7d..f1893d7c 100644
--- a/modules/nf-core/samtools/flagstat/main.nf
+++ b/modules/nf-core/samtools/flagstat/main.nf
@@ -2,10 +2,10 @@ process SAMTOOLS_FLAGSTAT {
     tag "$meta.id"
     label 'process_single'
 
-    conda "bioconda::samtools=1.16.1"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' :
-        'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }"
+        'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' :
+        'biocontainers/samtools:1.18--h50ea8bc_1' }"
 
     input:
     tuple val(meta), path(bam), path(bai)
@@ -32,4 +32,15 @@ process SAMTOOLS_FLAGSTAT {
         samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
     END_VERSIONS
     """
+
+    stub:
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    """
+    touch ${prefix}.flagstat
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
+    END_VERSIONS
+    """
 }
diff --git a/modules/nf-core/samtools/flagstat/meta.yml b/modules/nf-core/samtools/flagstat/meta.yml
index 954225df..97991358 100644
--- a/modules/nf-core/samtools/flagstat/meta.yml
+++ b/modules/nf-core/samtools/flagstat/meta.yml
@@ -47,3 +47,5 @@ output:
       pattern: "versions.yml"
 authors:
   - "@drpatelh"
+maintainers:
+  - "@drpatelh"
diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test b/modules/nf-core/samtools/flagstat/tests/main.nf.test
new file mode 100644
index 00000000..c8dd8dc9
--- /dev/null
+++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test
@@ -0,0 +1,36 @@
+nextflow_process {
+
+    name "Test Process SAMTOOLS_FLAGSTAT"
+    script "../main.nf"
+    process "SAMTOOLS_FLAGSTAT"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "samtools"
+    tag "samtools/flagstat"
+
+    test("BAM") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+                    file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out.flagstat).match() },
+                { assert path(process.out.versions.get(0)).getText().contains("samtools") }
+            )
+        }
+    }
+}
diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap
new file mode 100644
index 00000000..880019f2
--- /dev/null
+++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap
@@ -0,0 +1,16 @@
+{
+    "BAM": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783"
+                ]
+            ]
+        ],
+        "timestamp": "2023-11-14T15:49:22.577133"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/flagstat/tests/tags.yml b/modules/nf-core/samtools/flagstat/tests/tags.yml
new file mode 100644
index 00000000..2d2b7255
--- /dev/null
+++ b/modules/nf-core/samtools/flagstat/tests/tags.yml
@@ -0,0 +1,2 @@
+samtools/flagstat:
+  - modules/nf-core/samtools/flagstat/**
diff --git a/modules/nf-core/samtools/idxstats/environment.yml b/modules/nf-core/samtools/idxstats/environment.yml
new file mode 100644
index 00000000..2401db0f
--- /dev/null
+++ b/modules/nf-core/samtools/idxstats/environment.yml
@@ -0,0 +1,7 @@
+name: samtools_idxstats
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::samtools=1.18
diff --git a/modules/nf-core/samtools/idxstats/main.nf b/modules/nf-core/samtools/idxstats/main.nf
index a7b87d8b..00d916bb 100644
--- a/modules/nf-core/samtools/idxstats/main.nf
+++ b/modules/nf-core/samtools/idxstats/main.nf
@@ -2,10 +2,10 @@ process SAMTOOLS_IDXSTATS {
     tag "$meta.id"
     label 'process_single'
 
-    conda "bioconda::samtools=1.16.1"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' :
-        'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }"
+        'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' :
+        'biocontainers/samtools:1.18--h50ea8bc_1' }"
 
     input:
     tuple val(meta), path(bam), path(bai)
@@ -33,4 +33,16 @@ process SAMTOOLS_IDXSTATS {
         samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
     END_VERSIONS
     """
+
+    stub:
+    def prefix = task.ext.prefix ?: "${meta.id}"
+
+    """
+    touch ${prefix}.idxstats
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
+    END_VERSIONS
+    """
 }
diff --git a/modules/nf-core/samtools/idxstats/meta.yml b/modules/nf-core/samtools/idxstats/meta.yml
index dda87e1e..344e92a3 100644
--- a/modules/nf-core/samtools/idxstats/meta.yml
+++ b/modules/nf-core/samtools/idxstats/meta.yml
@@ -48,3 +48,5 @@ output:
       pattern: "versions.yml"
 authors:
   - "@drpatelh"
+maintainers:
+  - "@drpatelh"
diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test b/modules/nf-core/samtools/idxstats/tests/main.nf.test
new file mode 100644
index 00000000..f6c92150
--- /dev/null
+++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test
@@ -0,0 +1,36 @@
+nextflow_process {
+
+    name "Test Process SAMTOOLS_IDXSTATS"
+    script "../main.nf"
+    process "SAMTOOLS_IDXSTATS"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "samtools"
+    tag "samtools/idxstats"
+
+    test("BAM") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+                    file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out.idxstats).match() },
+                { assert path(process.out.versions.get(0)).getText().contains("samtools") }
+            )
+        }
+    }
+}
diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap
new file mode 100644
index 00000000..4c6c12bd
--- /dev/null
+++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap
@@ -0,0 +1,16 @@
+{
+    "BAM": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2"
+                ]
+            ]
+        ],
+        "timestamp": "2023-11-14T15:52:19.875194"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/idxstats/tests/tags.yml b/modules/nf-core/samtools/idxstats/tests/tags.yml
new file mode 100644
index 00000000..d3057c61
--- /dev/null
+++ b/modules/nf-core/samtools/idxstats/tests/tags.yml
@@ -0,0 +1,2 @@
+samtools/idxstats:
+  - modules/nf-core/samtools/idxstats/**
diff --git a/modules/nf-core/samtools/index/environment.yml b/modules/nf-core/samtools/index/environment.yml
new file mode 100644
index 00000000..296ed99e
--- /dev/null
+++ b/modules/nf-core/samtools/index/environment.yml
@@ -0,0 +1,7 @@
+name: samtools_index
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::samtools=1.18
diff --git a/modules/nf-core/samtools/index/main.nf b/modules/nf-core/samtools/index/main.nf
index 8b95687a..8ad18fdc 100644
--- a/modules/nf-core/samtools/index/main.nf
+++ b/modules/nf-core/samtools/index/main.nf
@@ -2,10 +2,10 @@ process SAMTOOLS_INDEX {
     tag "$meta.id"
     label 'process_low'
 
-    conda "bioconda::samtools=1.16.1"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' :
-        'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }"
+        'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' :
+        'biocontainers/samtools:1.18--h50ea8bc_1' }"
 
     input:
     tuple val(meta), path(input)
diff --git a/modules/nf-core/samtools/index/meta.yml b/modules/nf-core/samtools/index/meta.yml
index 8bd2fa6f..01a4ee03 100644
--- a/modules/nf-core/samtools/index/meta.yml
+++ b/modules/nf-core/samtools/index/meta.yml
@@ -51,3 +51,7 @@ authors:
   - "@drpatelh"
   - "@ewels"
   - "@maxulysse"
+maintainers:
+  - "@drpatelh"
+  - "@ewels"
+  - "@maxulysse"
diff --git a/modules/nf-core/samtools/index/tests/csi.nextflow.config b/modules/nf-core/samtools/index/tests/csi.nextflow.config
new file mode 100644
index 00000000..0ed260ef
--- /dev/null
+++ b/modules/nf-core/samtools/index/tests/csi.nextflow.config
@@ -0,0 +1,7 @@
+process {
+
+    withName: SAMTOOLS_INDEX {
+        ext.args = '-c'
+    }
+
+}
diff --git a/modules/nf-core/samtools/index/tests/main.nf.test b/modules/nf-core/samtools/index/tests/main.nf.test
new file mode 100644
index 00000000..c76a9169
--- /dev/null
+++ b/modules/nf-core/samtools/index/tests/main.nf.test
@@ -0,0 +1,87 @@
+nextflow_process {
+
+    name "Test Process SAMTOOLS_INDEX"
+    script "../main.nf"
+    process "SAMTOOLS_INDEX"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "samtools"
+    tag "samtools/index"
+
+    test("sarscov2 [BAI]") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out.bai).match("bai") },
+                { assert path(process.out.versions.get(0)).getText().contains("samtools") }
+            )
+        }
+    }
+
+    test("homo_sapiens [CRAI]") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ], // meta map
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram'], checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out.crai).match("crai") },
+                { assert path(process.out.versions.get(0)).getText().contains("samtools") }
+            )
+        }
+    }
+
+    test("homo_sapiens [CSI]") {
+
+        config "./csi.nextflow.config"
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert path(process.out.csi.get(0).get(1)).exists() },
+                { assert path(process.out.versions.get(0)).getText().contains("samtools") }
+            )
+        }
+    }
+}
diff --git a/modules/nf-core/samtools/index/tests/main.nf.test.snap b/modules/nf-core/samtools/index/tests/main.nf.test.snap
new file mode 100644
index 00000000..b3baee7f
--- /dev/null
+++ b/modules/nf-core/samtools/index/tests/main.nf.test.snap
@@ -0,0 +1,28 @@
+{
+    "crai": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029"
+                ]
+            ]
+        ],
+        "timestamp": "2023-11-15T15:17:37.30801"
+    },
+    "bai": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4"
+                ]
+            ]
+        ],
+        "timestamp": "2023-11-15T15:17:30.869234"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/index/tests/tags.yml b/modules/nf-core/samtools/index/tests/tags.yml
new file mode 100644
index 00000000..e0f58a7a
--- /dev/null
+++ b/modules/nf-core/samtools/index/tests/tags.yml
@@ -0,0 +1,2 @@
+samtools/index:
+  - modules/nf-core/samtools/index/**
diff --git a/modules/nf-core/samtools/sort/environment.yml b/modules/nf-core/samtools/sort/environment.yml
new file mode 100644
index 00000000..cd50868c
--- /dev/null
+++ b/modules/nf-core/samtools/sort/environment.yml
@@ -0,0 +1,7 @@
+name: samtools_sort
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::samtools=1.18
diff --git a/modules/nf-core/samtools/sort/main.nf b/modules/nf-core/samtools/sort/main.nf
index 84c167cd..4a666d42 100644
--- a/modules/nf-core/samtools/sort/main.nf
+++ b/modules/nf-core/samtools/sort/main.nf
@@ -2,10 +2,10 @@ process SAMTOOLS_SORT {
     tag "$meta.id"
     label 'process_medium'
 
-    conda "bioconda::samtools=1.16.1"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' :
-        'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }"
+        'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' :
+        'biocontainers/samtools:1.18--h50ea8bc_1' }"
 
     input:
     tuple val(meta), path(bam)
@@ -23,7 +23,13 @@ process SAMTOOLS_SORT {
     def prefix = task.ext.prefix ?: "${meta.id}"
     if ("$bam" == "${prefix}.bam") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!"
     """
-    samtools sort $args -@ $task.cpus -o ${prefix}.bam -T $prefix $bam
+    samtools sort \\
+        $args \\
+        -@ $task.cpus \\
+        -o ${prefix}.bam \\
+        -T $prefix \\
+        $bam
+
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
         samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
diff --git a/modules/nf-core/samtools/sort/meta.yml b/modules/nf-core/samtools/sort/meta.yml
index 07328431..2200de72 100644
--- a/modules/nf-core/samtools/sort/meta.yml
+++ b/modules/nf-core/samtools/sort/meta.yml
@@ -46,3 +46,6 @@ output:
 authors:
   - "@drpatelh"
   - "@ewels"
+maintainers:
+  - "@drpatelh"
+  - "@ewels"
diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test b/modules/nf-core/samtools/sort/tests/main.nf.test
new file mode 100644
index 00000000..abb80978
--- /dev/null
+++ b/modules/nf-core/samtools/sort/tests/main.nf.test
@@ -0,0 +1,73 @@
+nextflow_process {
+
+    name "Test Process SAMTOOLS_SORT"
+    script "../main.nf"
+    process "SAMTOOLS_SORT"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "samtools"
+    tag "samtools/sort"
+
+    test("test_samtools_sort") {
+
+        config "./nextflow.config"
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ],
+                    [
+                        file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true)
+                    ]
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("test_samtools_sort_stub") {
+
+        config "./nextflow.config"
+        options "-stub-run"
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ],
+                    [
+                        file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true)
+                    ]
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.bam[0][1]).name,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test.snap b/modules/nf-core/samtools/sort/tests/main.nf.test.snap
new file mode 100644
index 00000000..ff722259
--- /dev/null
+++ b/modules/nf-core/samtools/sort/tests/main.nf.test.snap
@@ -0,0 +1,48 @@
+{
+    "test_samtools_sort": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.sorted.bam:md5,ea6a0fef94eb534e901f107a05a33a06"
+                    ]
+                ],
+                "1": [
+                    
+                ],
+                "2": [
+                    "versions.yml:md5,33b6a403dc19a0d28e4219ccab0a1d80"
+                ],
+                "bam": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.sorted.bam:md5,ea6a0fef94eb534e901f107a05a33a06"
+                    ]
+                ],
+                "csi": [
+                    
+                ],
+                "versions": [
+                    "versions.yml:md5,33b6a403dc19a0d28e4219ccab0a1d80"
+                ]
+            }
+        ],
+        "timestamp": "2023-12-04T11:11:22.005628301"
+    },
+    "test_samtools_sort_stub": {
+        "content": [
+            "test.sorted.bam",
+            [
+                "versions.yml:md5,33b6a403dc19a0d28e4219ccab0a1d80"
+            ]
+        ],
+        "timestamp": "2023-12-04T17:47:22.314445935"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/sort/tests/nextflow.config b/modules/nf-core/samtools/sort/tests/nextflow.config
new file mode 100644
index 00000000..d0f35086
--- /dev/null
+++ b/modules/nf-core/samtools/sort/tests/nextflow.config
@@ -0,0 +1,7 @@
+process {
+
+    withName: SAMTOOLS_SORT {
+        ext.prefix = { "${meta.id}.sorted" }
+    }
+
+}
diff --git a/modules/nf-core/samtools/sort/tests/tags.yml b/modules/nf-core/samtools/sort/tests/tags.yml
new file mode 100644
index 00000000..cd63ea20
--- /dev/null
+++ b/modules/nf-core/samtools/sort/tests/tags.yml
@@ -0,0 +1,3 @@
+samtools/sort:
+  - modules/nf-core/samtools/sort/**
+  - tests/modules/nf-core/samtools/sort/**
diff --git a/modules/nf-core/samtools/stats/environment.yml b/modules/nf-core/samtools/stats/environment.yml
new file mode 100644
index 00000000..b89ce647
--- /dev/null
+++ b/modules/nf-core/samtools/stats/environment.yml
@@ -0,0 +1,7 @@
+name: samtools_stats
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::samtools=1.18
diff --git a/modules/nf-core/samtools/stats/main.nf b/modules/nf-core/samtools/stats/main.nf
index 0a2a3640..7539140a 100644
--- a/modules/nf-core/samtools/stats/main.nf
+++ b/modules/nf-core/samtools/stats/main.nf
@@ -2,14 +2,14 @@ process SAMTOOLS_STATS {
     tag "$meta.id"
     label 'process_single'
 
-    conda "bioconda::samtools=1.16.1"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' :
-        'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }"
+        'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' :
+        'biocontainers/samtools:1.18--h50ea8bc_1' }"
 
     input:
     tuple val(meta), path(input), path(input_index)
-    path fasta
+    tuple val(meta2), path(fasta)
 
     output:
     tuple val(meta), path("*.stats"), emit: stats
diff --git a/modules/nf-core/samtools/stats/meta.yml b/modules/nf-core/samtools/stats/meta.yml
index 1d68a5d8..735ff812 100644
--- a/modules/nf-core/samtools/stats/meta.yml
+++ b/modules/nf-core/samtools/stats/meta.yml
@@ -30,9 +30,14 @@ input:
       type: file
       description: BAI/CRAI file from alignment
       pattern: "*.{bai,crai}"
+  - meta2:
+      type: map
+      description: |
+        Groovy Map containing reference information
+        e.g. [ id:'genome' ]
   - fasta:
-      type: optional file
-      description: Reference file the CRAM was created with
+      type: file
+      description: Reference file the CRAM was created with (optional)
       pattern: "*.{fasta,fa}"
 output:
   - meta:
@@ -51,3 +56,8 @@ output:
 authors:
   - "@drpatelh"
   - "@FriederikeHanssen"
+  - "@ramprasadn"
+maintainers:
+  - "@drpatelh"
+  - "@FriederikeHanssen"
+  - "@ramprasadn"
diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test b/modules/nf-core/samtools/stats/tests/main.nf.test
new file mode 100644
index 00000000..20c3efe1
--- /dev/null
+++ b/modules/nf-core/samtools/stats/tests/main.nf.test
@@ -0,0 +1,78 @@
+nextflow_process {
+
+    name "Test Process SAMTOOLS_STATS"
+    script "../main.nf"
+    process "SAMTOOLS_STATS"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "samtools"
+    tag "samtools/stats"
+
+    test("SAMTOOLS STATS Should run without failures") {
+
+        when {
+            params {
+                
+                outdir = "$outputDir"
+            }
+            process {
+                """
+                // define inputs of the process here.
+                input[0] = [ 
+                                [ id:'test', single_end:false ], // meta map
+                                file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+                                file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+                                
+                            ]
+                input[1] = [[],[]]
+                """
+
+            }
+        }
+
+        then {
+            assertAll(
+            {assert process.success},
+            {assert snapshot(process.out).match()}
+            )
+        }
+
+    }
+
+    test("SAMTOOLS CRAM Should run without failures") {
+
+        when {
+            params {
+                
+                outdir = "$outputDir"
+            }
+            process {
+                """
+                // define inputs of the process here
+                input[0] = [ 
+                                [ id:'test', single_end:false ], // meta map
+                                file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram'], checkIfExists: true),
+                                file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram_crai'], checkIfExists: true)
+                                
+                            ]
+                input[1] =  [ 
+                                [ id:'genome' ],
+                                file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                             ]
+                """
+            }
+
+            
+        }
+
+        then {
+            assertAll(
+            {assert process.success},
+            {assert snapshot(process.out).match()}
+            )
+        }
+
+    }
+
+
+}
diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test.snap b/modules/nf-core/samtools/stats/tests/main.nf.test.snap
new file mode 100644
index 00000000..025c83a5
--- /dev/null
+++ b/modules/nf-core/samtools/stats/tests/main.nf.test.snap
@@ -0,0 +1,64 @@
+{
+    "SAMTOOLS STATS Should run without failures": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.stats:md5,045a48208b1c6f5b8af4347fe31f4def"
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,650a365c6635001436008350ae83337c"
+                ],
+                "stats": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.stats:md5,045a48208b1c6f5b8af4347fe31f4def"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,650a365c6635001436008350ae83337c"
+                ]
+            }
+        ],
+        "timestamp": "2023-12-04T11:07:28.26821485"
+    },
+    "SAMTOOLS CRAM Should run without failures": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.stats:md5,dfbfa130d4a6925ddd1931dcd8354a43"
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,650a365c6635001436008350ae83337c"
+                ],
+                "stats": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": false
+                        },
+                        "test.stats:md5,dfbfa130d4a6925ddd1931dcd8354a43"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,650a365c6635001436008350ae83337c"
+                ]
+            }
+        ],
+        "timestamp": "2023-12-04T11:07:50.356233402"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/stats/tests/tags.yml b/modules/nf-core/samtools/stats/tests/tags.yml
new file mode 100644
index 00000000..7c28e30f
--- /dev/null
+++ b/modules/nf-core/samtools/stats/tests/tags.yml
@@ -0,0 +1,2 @@
+samtools/stats:
+  - modules/nf-core/samtools/stats/**
diff --git a/modules/nf-core/samtools/view/environment.yml b/modules/nf-core/samtools/view/environment.yml
new file mode 100644
index 00000000..99aa69d0
--- /dev/null
+++ b/modules/nf-core/samtools/view/environment.yml
@@ -0,0 +1,7 @@
+name: samtools_view
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::samtools=1.18
diff --git a/modules/nf-core/samtools/view/main.nf b/modules/nf-core/samtools/view/main.nf
index 729c85e5..0b5a2912 100644
--- a/modules/nf-core/samtools/view/main.nf
+++ b/modules/nf-core/samtools/view/main.nf
@@ -2,14 +2,14 @@ process SAMTOOLS_VIEW {
     tag "$meta.id"
     label 'process_low'
 
-    conda "bioconda::samtools=1.16.1"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' :
-        'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }"
+        'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' :
+        'biocontainers/samtools:1.18--h50ea8bc_1' }"
 
     input:
     tuple val(meta), path(input), path(index)
-    path fasta
+    tuple val(meta2), path(fasta)
     path qname
 
     output:
@@ -53,10 +53,19 @@ process SAMTOOLS_VIEW {
     """
 
     stub:
+    def args = task.ext.args ?: ''
     def prefix = task.ext.prefix ?: "${meta.id}"
+    def file_type = args.contains("--output-fmt sam") ? "sam" :
+                    args.contains("--output-fmt bam") ? "bam" :
+                    args.contains("--output-fmt cram") ? "cram" :
+                    input.getExtension()
+    if ("$input" == "${prefix}.${file_type}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!"
+
+    def index = args.contains("--write-index") ? "touch ${prefix}.csi" : ""
+
     """
-    touch ${prefix}.bam
-    touch ${prefix}.cram
+    touch ${prefix}.${file_type}
+    ${index}
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
diff --git a/modules/nf-core/samtools/view/meta.yml b/modules/nf-core/samtools/view/meta.yml
index 2e597d34..3dadafae 100644
--- a/modules/nf-core/samtools/view/meta.yml
+++ b/modules/nf-core/samtools/view/meta.yml
@@ -26,12 +26,17 @@ input:
       description: BAM/CRAM/SAM file
       pattern: "*.{bam,cram,sam}"
   - index:
-      type: optional file
-      description: BAM.BAI/CRAM.CRAI file
-      pattern: "*.{.bai,.crai}"
+      type: file
+      description: BAM.BAI/BAM.CSI/CRAM.CRAI file (optional)
+      pattern: "*.{.bai,.csi,.crai}"
+  - meta2:
+      type: map
+      description: |
+        Groovy Map containing reference information
+        e.g. [ id:'test' ]
   - fasta:
-      type: optional file
-      description: Reference file the CRAM was created with
+      type: file
+      description: Reference file the CRAM was created with (optional)
       pattern: "*.{fasta,fa}"
   - qname:
       type: file
@@ -77,3 +82,8 @@ authors:
   - "@joseespinosa"
   - "@FriederikeHanssen"
   - "@priyanka-surana"
+maintainers:
+  - "@drpatelh"
+  - "@joseespinosa"
+  - "@FriederikeHanssen"
+  - "@priyanka-surana"
diff --git a/modules/nf-core/samtools/view/tests/bam.config b/modules/nf-core/samtools/view/tests/bam.config
new file mode 100644
index 00000000..c10d1081
--- /dev/null
+++ b/modules/nf-core/samtools/view/tests/bam.config
@@ -0,0 +1,3 @@
+process {
+    ext.args = "--output-fmt bam"
+}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/view/tests/bam_index.config b/modules/nf-core/samtools/view/tests/bam_index.config
new file mode 100644
index 00000000..771ae033
--- /dev/null
+++ b/modules/nf-core/samtools/view/tests/bam_index.config
@@ -0,0 +1,3 @@
+process {
+    ext.args = "--output-fmt bam --write-index"
+}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/view/tests/main.nf.test b/modules/nf-core/samtools/view/tests/main.nf.test
new file mode 100644
index 00000000..89ed3555
--- /dev/null
+++ b/modules/nf-core/samtools/view/tests/main.nf.test
@@ -0,0 +1,231 @@
+nextflow_process {
+
+    name "Test Process SAMTOOLS_VIEW"
+    script "../main.nf"
+    process "SAMTOOLS_VIEW"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "samtools"
+    tag "samtools/view"
+
+    test("sarscov2 - [bam, []], [], []") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true),
+                    []
+                ]
+                input[1] = [[],[]]
+                input[2] = []
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.bam[0][1]).name,
+                    process.out.cram,
+                    process.out.sam,
+                    process.out.bai,
+                    process.out.crai,
+                    process.out.csi,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("homo_sapiens - [cram, crai], fasta, []") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id: 'test' ], // meta map
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
+                ]
+                input[1] = [
+                    [ id:'genome' ],
+                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                ]
+                input[2] = []
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.cram[0][1]).name,
+                    process.out.bam,
+                    process.out.sam,
+                    process.out.bai,
+                    process.out.crai,
+                    process.out.csi,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("homo_sapiens - [cram, []], fasta, [] - bam output") {
+
+        config "./bam.config"
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id: 'test' ], // meta map
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
+                    []
+                ]
+                input[1] = [
+                    [ id:'genome' ],
+                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                ]
+                input[2] = []
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.bam[0][1]).name,
+                    process.out.cram,
+                    process.out.sam,
+                    process.out.bai,
+                    process.out.crai,
+                    process.out.csi,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("homo_sapiens - [cram, []], fasta, [] - bam & index output") {
+
+        config "./bam_index.config"
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id: 'test' ], // meta map
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
+                    []
+                ]
+                input[1] = [
+                    [ id:'genome' ],
+                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                ]
+                input[2] = []
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.bam[0][1]).name,
+                    process.out.cram,
+                    process.out.sam,
+                    file(process.out.csi[0][1]).name,
+                    process.out.crai,
+                    process.out.bai,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("homo_sapiens - [cram, []], fasta, qname - bam & index output") {
+
+        config "./bam_index.config"
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id: 'test' ], // meta map
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
+                    []
+                ]
+                input[1] = [
+                    [ id:'genome' ],
+                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                ]
+                input[2] = Channel.of("testN:2817", "testN:2814").collectFile(name: "readnames.list", newLine: true)
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.bam[0][1]).name,
+                    process.out.cram,
+                    process.out.sam,
+                    file(process.out.csi[0][1]).name,
+                    process.out.crai,
+                    process.out.bai,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - [bam, []], [], [] - stub") {
+
+        options "-stub"
+        config "./bam_index.config"
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true),
+                    []
+                ]
+                input[1] = [[],[]]
+                input[2] = []
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    file(process.out.bam[0][1]).name,
+                    process.out.cram,
+                    process.out.sam,
+                    file(process.out.csi[0][1]).name,
+                    process.out.crai,
+                    process.out.bai,
+                    process.out.versions
+                ).match() }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/samtools/view/tests/main.nf.test.snap b/modules/nf-core/samtools/view/tests/main.nf.test.snap
new file mode 100644
index 00000000..83427491
--- /dev/null
+++ b/modules/nf-core/samtools/view/tests/main.nf.test.snap
@@ -0,0 +1,140 @@
+{
+    "homo_sapiens - [cram, []], fasta, [] - bam output": {
+        "content": [
+            "test.bam",
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b"
+            ]
+        ],
+        "timestamp": "2023-12-04T17:41:17.563069206"
+    },
+    "sarscov2 - [bam, []], [], []": {
+        "content": [
+            "test.bam",
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b"
+            ]
+        ],
+        "timestamp": "2023-12-04T17:41:03.206994564"
+    },
+    "homo_sapiens - [cram, []], fasta, qname - bam & index output": {
+        "content": [
+            "test.bam",
+            [
+                
+            ],
+            [
+                
+            ],
+            "test.bam.csi",
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b"
+            ]
+        ],
+        "timestamp": "2023-12-04T17:44:39.165289759"
+    },
+    "homo_sapiens - [cram, []], fasta, [] - bam & index output": {
+        "content": [
+            "test.bam",
+            [
+                
+            ],
+            [
+                
+            ],
+            "test.bam.csi",
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b"
+            ]
+        ],
+        "timestamp": "2023-12-04T17:44:32.25731224"
+    },
+    "sarscov2 - [bam, []], [], [] - stub": {
+        "content": [
+            "test.bam",
+            [
+                
+            ],
+            [
+                
+            ],
+            "test.csi",
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b"
+            ]
+        ],
+        "timestamp": "2023-12-04T17:44:45.81037195"
+    },
+    "homo_sapiens - [cram, crai], fasta, []": {
+        "content": [
+            "test.cram",
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                
+            ],
+            [
+                "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b"
+            ]
+        ],
+        "timestamp": "2023-12-04T17:41:10.730011823"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/view/tests/tags.yml b/modules/nf-core/samtools/view/tests/tags.yml
new file mode 100644
index 00000000..4fdf1dd1
--- /dev/null
+++ b/modules/nf-core/samtools/view/tests/tags.yml
@@ -0,0 +1,2 @@
+samtools/view:
+  - "modules/nf-core/samtools/view/**"
diff --git a/modules/nf-core/spades/environment.yml b/modules/nf-core/spades/environment.yml
new file mode 100644
index 00000000..12315814
--- /dev/null
+++ b/modules/nf-core/spades/environment.yml
@@ -0,0 +1,7 @@
+name: spades
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::spades=3.15.5
diff --git a/modules/nf-core/spades/main.nf b/modules/nf-core/spades/main.nf
index 2c58069c..010525e9 100644
--- a/modules/nf-core/spades/main.nf
+++ b/modules/nf-core/spades/main.nf
@@ -2,10 +2,10 @@ process SPADES {
     tag "$meta.id"
     label 'process_high'
 
-    conda "bioconda::spades=3.15.5"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/spades:3.15.5--h95f258a_1' :
-        'quay.io/biocontainers/spades:3.15.5--h95f258a_1' }"
+        'biocontainers/spades:3.15.5--h95f258a_1' }"
 
     input:
     tuple val(meta), path(illumina), path(pacbio), path(nanopore)
diff --git a/modules/nf-core/spades/meta.yml b/modules/nf-core/spades/meta.yml
index 701de1a7..99c482cd 100644
--- a/modules/nf-core/spades/meta.yml
+++ b/modules/nf-core/spades/meta.yml
@@ -84,8 +84,11 @@ output:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-
 authors:
   - "@JoseEspinosa"
   - "@drpatelh"
   - "@d4straub"
+maintainers:
+  - "@JoseEspinosa"
+  - "@drpatelh"
+  - "@d4straub"
diff --git a/modules/nf-core/tabix/bgzip/environment.yml b/modules/nf-core/tabix/bgzip/environment.yml
new file mode 100644
index 00000000..4fe40c56
--- /dev/null
+++ b/modules/nf-core/tabix/bgzip/environment.yml
@@ -0,0 +1,7 @@
+name: tabix_bgzip
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::tabix=1.11
diff --git a/modules/nf-core/tabix/bgzip/main.nf b/modules/nf-core/tabix/bgzip/main.nf
index 6dd4e202..7772e9ad 100644
--- a/modules/nf-core/tabix/bgzip/main.nf
+++ b/modules/nf-core/tabix/bgzip/main.nf
@@ -2,10 +2,10 @@ process TABIX_BGZIP {
     tag "$meta.id"
     label 'process_single'
 
-    conda "bioconda::tabix=1.11"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/tabix:1.11--hdfd78af_0' :
-        'quay.io/biocontainers/tabix:1.11--hdfd78af_0' }"
+        'biocontainers/tabix:1.11--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(input)
diff --git a/modules/nf-core/tabix/bgzip/meta.yml b/modules/nf-core/tabix/bgzip/meta.yml
index c3ea2107..621d49ea 100644
--- a/modules/nf-core/tabix/bgzip/meta.yml
+++ b/modules/nf-core/tabix/bgzip/meta.yml
@@ -45,3 +45,8 @@ authors:
   - "@drpatelh"
   - "@maxulysse"
   - "@nvnieuwk"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
+  - "@maxulysse"
+  - "@nvnieuwk"
diff --git a/modules/nf-core/tabix/tabix/environment.yml b/modules/nf-core/tabix/tabix/environment.yml
new file mode 100644
index 00000000..7167fb87
--- /dev/null
+++ b/modules/nf-core/tabix/tabix/environment.yml
@@ -0,0 +1,7 @@
+name: tabix_tabix
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::tabix=1.11
diff --git a/modules/nf-core/tabix/tabix/main.nf b/modules/nf-core/tabix/tabix/main.nf
index 9a404db9..c304a8a3 100644
--- a/modules/nf-core/tabix/tabix/main.nf
+++ b/modules/nf-core/tabix/tabix/main.nf
@@ -2,10 +2,10 @@ process TABIX_TABIX {
     tag "$meta.id"
     label 'process_single'
 
-    conda "bioconda::tabix=1.11"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/tabix:1.11--hdfd78af_0' :
-        'quay.io/biocontainers/tabix:1.11--hdfd78af_0' }"
+        'biocontainers/tabix:1.11--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(tab)
diff --git a/modules/nf-core/tabix/tabix/meta.yml b/modules/nf-core/tabix/tabix/meta.yml
index fcc6e524..ae5b4f43 100644
--- a/modules/nf-core/tabix/tabix/meta.yml
+++ b/modules/nf-core/tabix/tabix/meta.yml
@@ -43,3 +43,7 @@ authors:
   - "@joseespinosa"
   - "@drpatelh"
   - "@maxulysse"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
+  - "@maxulysse"
diff --git a/modules/nf-core/unicycler/environment.yml b/modules/nf-core/unicycler/environment.yml
new file mode 100644
index 00000000..bf5c977b
--- /dev/null
+++ b/modules/nf-core/unicycler/environment.yml
@@ -0,0 +1,7 @@
+name: unicycler
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::unicycler=0.4.8
diff --git a/modules/nf-core/unicycler/main.nf b/modules/nf-core/unicycler/main.nf
index 8981c433..58d60cbe 100644
--- a/modules/nf-core/unicycler/main.nf
+++ b/modules/nf-core/unicycler/main.nf
@@ -2,10 +2,10 @@ process UNICYCLER {
     tag "$meta.id"
     label 'process_high'
 
-    conda "bioconda::unicycler=0.4.8"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/unicycler:0.4.8--py38h8162308_3' :
-        'quay.io/biocontainers/unicycler:0.4.8--py38h8162308_3' }"
+        'biocontainers/unicycler:0.4.8--py38h8162308_3' }"
 
     input:
     tuple val(meta), path(shortreads), path(longreads)
diff --git a/modules/nf-core/unicycler/meta.yml b/modules/nf-core/unicycler/meta.yml
index 918faaf8..406b1470 100644
--- a/modules/nf-core/unicycler/meta.yml
+++ b/modules/nf-core/unicycler/meta.yml
@@ -58,3 +58,7 @@ authors:
   - "@JoseEspinosa"
   - "@drpatelh"
   - "@d4straub"
+maintainers:
+  - "@JoseEspinosa"
+  - "@drpatelh"
+  - "@d4straub"
diff --git a/modules/nf-core/untar/environment.yml b/modules/nf-core/untar/environment.yml
new file mode 100644
index 00000000..d6917da3
--- /dev/null
+++ b/modules/nf-core/untar/environment.yml
@@ -0,0 +1,9 @@
+name: untar
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - conda-forge::sed=4.7
+  - conda-forge::grep=3.11
+  - conda-forge::tar=1.34
diff --git a/modules/nf-core/untar/main.nf b/modules/nf-core/untar/main.nf
index 3384847a..8a75bb95 100644
--- a/modules/nf-core/untar/main.nf
+++ b/modules/nf-core/untar/main.nf
@@ -2,10 +2,10 @@ process UNTAR {
     tag "$archive"
     label 'process_single'
 
-    conda "conda-forge::sed=4.7 bioconda::grep=3.4 conda-forge::tar=1.34"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/ubuntu:20.04' :
-        'ubuntu:20.04' }"
+        'nf-core/ubuntu:20.04' }"
 
     input:
     tuple val(meta), path(archive)
diff --git a/modules/nf-core/untar/meta.yml b/modules/nf-core/untar/meta.yml
index ea7a3f38..a9a2110f 100644
--- a/modules/nf-core/untar/meta.yml
+++ b/modules/nf-core/untar/meta.yml
@@ -3,6 +3,7 @@ description: Extract files.
 keywords:
   - untar
   - uncompress
+  - extract
 tools:
   - untar:
       description: |
@@ -38,3 +39,8 @@ authors:
   - "@drpatelh"
   - "@matthdsm"
   - "@jfy133"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
+  - "@matthdsm"
+  - "@jfy133"
diff --git a/modules/nf-core/untar/tests/main.nf.test b/modules/nf-core/untar/tests/main.nf.test
new file mode 100644
index 00000000..d40db13d
--- /dev/null
+++ b/modules/nf-core/untar/tests/main.nf.test
@@ -0,0 +1,77 @@
+nextflow_process {
+
+    name "Test Process UNTAR"
+    script "../main.nf"
+    process "UNTAR"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "untar"
+
+    test("test_untar") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [ [], file(params.test_data['sarscov2']['genome']['kraken2_tar_gz'], checkIfExists: true) ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out.untar).match("test_untar") },
+            )
+        }
+
+    }
+
+    test("test_untar_different_output_path") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [ [], file(params.test_data['homo_sapiens']['illumina']['test_flowcell'], checkIfExists: true) ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out.untar).match("test_untar_different_output_path") },
+            )
+        }
+
+    }
+
+    test("test_untar_onlyfiles") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            process {
+                """
+                input[0] = [ [], file(params.test_data['generic']['tar']['tar_gz'], checkIfExists: true) ]
+                """
+            }
+        }
+
+        then {
+            assertAll (
+                { assert process.success },
+                { assert snapshot(process.out.untar).match("test_untar_onlyfiles") },
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/untar/tests/main.nf.test.snap b/modules/nf-core/untar/tests/main.nf.test.snap
new file mode 100644
index 00000000..146c8678
--- /dev/null
+++ b/modules/nf-core/untar/tests/main.nf.test.snap
@@ -0,0 +1,513 @@
+{
+    "test_untar_different_output_path": {
+        "content": [
+            [
+                [
+                    [
+                        
+                    ],
+                    [
+                        [
+                            [
+                                [
+                                    [
+                                        [
+                                            "s_1_1101.bcl:md5,ad01889e2ff43e2f194224e20bdb600c",
+                                            "s_1_1101.stats:md5,4bbbf103454b37fbc3138fadf1b4446b"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,565384bbe67a694dfd690bae6d1d30c2",
+                                            "s_1_1101.stats:md5,55e5abd8f129ff38ef169873547abdb8"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,650fa58a630a9148835ba79e323d4237",
+                                            "s_1_1101.stats:md5,77403669ca1b05340c390dff64425c1e"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,54471c9e97299cd141e202e204637702",
+                                            "s_1_1101.stats:md5,67b14c9a89b7f8556674a7524d5cfb2d"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,74e4f929fc7476c380fd9d741ddb6700",
+                                            "s_1_1101.stats:md5,5730a4c35463eaa12a06b6758710b98c"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,c785f472f4350c120c02c888c8189590",
+                                            "s_1_1101.stats:md5,fee4ec63895ea81007e06ee6a36ba5e0"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,b7ea50bb25f08d43c301741d77050a9b",
+                                            "s_1_1101.stats:md5,fa7c68f3122c74d14364e6f7b011af70"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,9d5087dc4bcae39d66486363d4f68ecf",
+                                            "s_1_1101.stats:md5,23cdceee4d82c4b8e7c60018b9276ace"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,581e0c5ee94e8f2de14b2b1d8e777530",
+                                            "s_1_1101.stats:md5,9a3536d573c97f66bb56b49463612607"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,296fc026bb34c67bbe2b44845fe0d1de",
+                                            "s_1_1101.stats:md5,a7f57a7770fb9c5ae2a0fb1ef403ec4f"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,2a3ca15531556c36d10d132a9e051de8",
+                                            "s_1_1101.stats:md5,2d0bcdb0a1b51d3d79e415db2ab2d3b1"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,1150d46a2ccd4ac58aee0585d3e4ffd7",
+                                            "s_1_1101.stats:md5,2e97550bd5b5864ffd0565bb7a3f6d40"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,0b85c4b3da0de95e7b862d849c5333ae",
+                                            "s_1_1101.stats:md5,6eab9746fbeb783b0cd70398f44e0c1a"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,e0e9c91f4698804d7a6d1058ef68b34f",
+                                            "s_1_1101.stats:md5,790022cdc7878a02b2ebd166e1ddf0a7"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,38cd0ad4de359e651c8ac0d5777ea625",
+                                            "s_1_1101.stats:md5,a1b1d5ea5371d326abb029774483c5e6"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,b0ddc05c4012ccba24e712a1cfec748f",
+                                            "s_1_1101.stats:md5,af3d232f839d720f76f40ba06caa2987"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,af32fcc5dc3b836cf7a5ba3db85a75dd",
+                                            "s_1_1101.stats:md5,f93f2c09bd4e486c74a5f6e2040f7296"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,54b7428e037ca87816107647d4a3d9db",
+                                            "s_1_1101.stats:md5,e5ac77a72cd7bed5e9bf03cccda0e48c"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,fc8b4eacd493bf3d0b20bc23998dc7ff",
+                                            "s_1_1101.stats:md5,190315e159e2f4bc4c057ded7470dc52"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,9484ecffda489927fce424ac6a44fa9d",
+                                            "s_1_1101.stats:md5,0825feeb457ecc9efcf6f8526ba32311"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,eec59e21036e31c95ce1e847bfb0a9c4",
+                                            "s_1_1101.stats:md5,9acc13f63c98e5a8445e7be70d49222b"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,a9fb24476f87cba4fba68e2b3c3f2c07",
+                                            "s_1_1101.stats:md5,dc0aa7db9790733291c3e6480ca2a0fc"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,ed950b3e82c500927c2e236c9df005c6",
+                                            "s_1_1101.stats:md5,dccb71ec47d1f9d33a192da6d5660a45"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,b3e992025e995ca56b5ea2820144ef47",
+                                            "s_1_1101.stats:md5,a6a829bf2cffb26ac5d9dc3012057699"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,89edc726a5a4e0b4ff8ca3899ed0232b",
+                                            "s_1_1101.stats:md5,5b9b4fd8110577a59b82d0c419519d29"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,4dc696149169f232c451225f563cb5cd",
+                                            "s_1_1101.stats:md5,d3514a71ea3adc60e2943c6b8f6e2598"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,35b992d0318afb7c825ceaa31b0755e6",
+                                            "s_1_1101.stats:md5,2826093acc175c16c3795de7c4ca8f07"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,7bc927f56a362e49c00b5d76ee048901",
+                                            "s_1_1101.stats:md5,e47d862b795fd6b88a31d7d482ab22f6"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,84742233ff2a651626fe9036f27f7cb2",
+                                            "s_1_1101.stats:md5,b78fad11d3c50bc76b722cdc03e3028b"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,3935341c86263a7938e8c49620ef39f8",
+                                            "s_1_1101.stats:md5,cc6585b2daac5354073d150874da9704"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,3627f4fd548bf6e64aaf08fba3a342be",
+                                            "s_1_1101.stats:md5,120ae4831ae004ff7d16728aef36e82f"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,07631014bc35124149fabd80ef19f933",
+                                            "s_1_1101.stats:md5,eadd63d91f47cc6db6b6f0a967a23927"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,a1149c80415dc2f34d768eeb397c43fb",
+                                            "s_1_1101.stats:md5,ca89a9def67611a9151c6ce685b7cce1"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,eb5f71d4741d2f40618756bc72eaf8b4",
+                                            "s_1_1101.stats:md5,90f48501e735e5915b843478e23d1ae2"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,9bf270fe3f6add1a591ebc24fff10078",
+                                            "s_1_1101.stats:md5,a4e429671d4098034293c638aa655e16"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,219bedcbd24bae54fe4cf05dae05282c",
+                                            "s_1_1101.stats:md5,dd97525b65b68207137d51fcf19132c7"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,5163bc00a68fd57ae50cae0b76350892",
+                                            "s_1_1101.stats:md5,b606a5368eff1f012f3ea5d11ccdf2e0"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,fc429195a5af59a59e0cc4c48e6c05ea",
+                                            "s_1_1101.stats:md5,d809aa19698053f90d639da4dcad8008"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,383340219a1dd77076a092a64a71a7e4",
+                                            "s_1_1101.stats:md5,b204a5cf256378679ffc906c15cc1bae"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,0c369540d3e24696cf1f9c55bab69315",
+                                            "s_1_1101.stats:md5,a2bc69a4031a22ce9621dcc623a0bf4b"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,3127abc8016ba8eb954f8f8015dff387",
+                                            "s_1_1101.stats:md5,5deafff31150b7bf757f814e49a53bc2"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,045f40c82de676bafec3d59f91376a7a",
+                                            "s_1_1101.stats:md5,890700edc20687c090ef52248c7884b1"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,78af269aa2b39a1d765703f0a4739a86",
+                                            "s_1_1101.stats:md5,303cf457aa1543a8208544f694cbc531"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,0ab8c781959b783b62888e9274364a46",
+                                            "s_1_1101.stats:md5,2605b0e8322f83aa4d0dae5da4ec7a7a"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,d0cf823ffe352e8b3f75d589544ab617",
+                                            "s_1_1101.stats:md5,efa3c0e01e3db71e12fd961cb2d03739"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,db4ca4ab7a01e03c246f9160c3758d82",
+                                            "s_1_1101.stats:md5,f61550d9e4a90df6b860e68f41f82f60"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,1af39a2c7e5ff20ece91cb8160b51d17",
+                                            "s_1_1101.stats:md5,d0e20879afcaf6dfcd88c73f1c5c78cf"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,4cf7123bb0fffcd79266df03aef01665",
+                                            "s_1_1101.stats:md5,29bff4075109a121b087116b58d7e927"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,aa9980428cb60cd6320f4b48f4dd0d74",
+                                            "s_1_1101.stats:md5,6b0e20bde93133117a8d1a6df3d6f37b"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,0f6e440374e15b9b491d52fb83a8adfe",
+                                            "s_1_1101.stats:md5,55cb5eb0ecdabd23dca39ab8c4607598"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,2c645d7bdaddaa403f6e304d36df9e4b",
+                                            "s_1_1101.stats:md5,53acf33d21f832779b400c2447386ce4"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,3bbf0863b423b770c879203644420206",
+                                            "s_1_1101.stats:md5,579bdc7293cac8c3d7407249cacf4c25"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,6658a08409e81d29cfeb2d096b491985",
+                                            "s_1_1101.stats:md5,bb559ffbea46d612f9933cefa84c4c03"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,1700d9a13d3d4f7643af2943ef838acb",
+                                            "s_1_1101.stats:md5,f01cb6050ebfb15da1e0399ebd791eb4"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,1ac7aa9ffae25eb103f755f33e4a39c6",
+                                            "s_1_1101.stats:md5,0b9d45d7929ccf336d5e5b95373ed3c2"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,812a97af2e983a53226e18c75190b06c",
+                                            "s_1_1101.stats:md5,d2410c7b0e506dab2972e77e2398de1e"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,c981e8e4dcc434956c2b86159da268bc",
+                                            "s_1_1101.stats:md5,e9c826e85361ce673f1f248786c9a611"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,88e09e99a0a4ef3357b203a41b22f77c",
+                                            "s_1_1101.stats:md5,ef06f2e5ad667bbd383f9ed6a05b7b42"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,461c8b146fc8a7938be38689978ecd09",
+                                            "s_1_1101.stats:md5,65115693935da66f9791b27136e22fb0"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,c7b827df5ce20e0f21916fe60860ca3f",
+                                            "s_1_1101.stats:md5,87be73613aeb507847f94d3cac5bb30a"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,7c4cc3dc9c8a1b0f15917b282dfb40ce",
+                                            "s_1_1101.stats:md5,bdd9181fa89debbfafe7b6ea3e064065"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,19f4debaf91e118aca8934517179ac33",
+                                            "s_1_1101.stats:md5,1143082719e136241d21b14a6b19b8a2"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,38aa256ad2d697d84b0b2c0e876a3eba",
+                                            "s_1_1101.stats:md5,64dd82f03df23f7f437eede2671ed4fe"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,b7929970378949571fed922c1b8cab32",
+                                            "s_1_1101.stats:md5,3d6d7985a41629fe196e4342d7fe36aa"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,fb2ed0bf6e89d79624ee78754e773491",
+                                            "s_1_1101.stats:md5,f34940810ff255aee79953496a12716d"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,4f8a8311f5f9c3a7629c1a973a7b280e",
+                                            "s_1_1101.stats:md5,4fd7cd28c09f4e152e7c2ad1ab541cd2"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,9eb46c903d0344e25af51f88cc311d60",
+                                            "s_1_1101.stats:md5,df3abd5f620d9e7f99496098d9fd3f7f"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,3ecbc17f3660e2014b58d7fe70ae62d5",
+                                            "s_1_1101.stats:md5,8e89a13c85a6d6ab3ccd251b66d1f165"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,5d59cc2499a77791233a64f73fe82894",
+                                            "s_1_1101.stats:md5,32ec99cd400f4b80cb26e2fa8e07ece0"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,1c052da47b9ae8554388f0fa3aade482",
+                                            "s_1_1101.stats:md5,d23f438772673688aa7bc92421dc6dce"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,1a52bd4f23130c0c96bc967ccd448a2b",
+                                            "s_1_1101.stats:md5,9b597e3388d59ef1f61aba30ac90ea79"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,8a1e84b79cf3f80794c20e3a0cc84688",
+                                            "s_1_1101.stats:md5,9561f7b6ef4b1849afc72b2bb49792bd"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,75c00111051f3fa95d04286823cb9109",
+                                            "s_1_1101.stats:md5,1fe786cdf8181767deafbd60b3c76610"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,529255d8deee0873ed5565e6d1a2ebda",
+                                            "s_1_1101.stats:md5,3fa7f467e97a75880f32d17b7429d316"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,ea4d960e3d9355d2149da71b88a21df4",
+                                            "s_1_1101.stats:md5,2540fe65586e8e800c1ddd8cddd1e8cd"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,0dfe1fd92a2dce2f23119aa483429744",
+                                            "s_1_1101.stats:md5,78257b2169fb9f0cf40966e06e847e86"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,f692ddc9aa3ab849271d07c666d0b3b9",
+                                            "s_1_1101.stats:md5,aa2ec6a3e3a9c116e34fe74a21e6459e"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,29cc4c239eae7c871c9a1adf92ebdb98",
+                                            "s_1_1101.stats:md5,263184813090acd740a5bf25304aed3a"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,e005af6a84925e326afbfe264241f047",
+                                            "s_1_1101.stats:md5,b6fb20868eebaffcc19daa694a449795"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,02f1a699b1ba9967accccf99a7af3d24",
+                                            "s_1_1101.stats:md5,4f007efacecaf26dc0e0231aede28754"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,df308c72a2dcc655cd95e98f5457187a",
+                                            "s_1_1101.stats:md5,130c4b07f4c14030bab012824cbe34da"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,f3ce10d8d2406b72355023bfa8c96822",
+                                            "s_1_1101.stats:md5,2638f4db393ed5b699ec2ce59ff0ec19"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,cc2f6d675ad1593ff96f734b172d249e",
+                                            "s_1_1101.stats:md5,f5b13f1e1ababc9e1a7a73b0b993cbf1"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,7938a0b21448305a951b023b1845b3a7",
+                                            "s_1_1101.stats:md5,fcd57511adabfc3ba1ac045165330006"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,44879bc6a38df1fee8def61868115041",
+                                            "s_1_1101.stats:md5,517e20e4b58a8023a37f9af62e0e2036"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,8749611e62406a7d2f34c610a55e56af",
+                                            "s_1_1101.stats:md5,8ccf24b3676ef84f2e513be8f2a9f3d1"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,a9846a037611cda3721958088f714c0e",
+                                            "s_1_1101.stats:md5,6438fa5a1892f328cab1605a95d80a3b"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,d6c4a2a726496476eb826532f974ed5f",
+                                            "s_1_1101.stats:md5,8c2c65b5e8b00dbf61ada65252aeb266"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,be3dde6cae7dd85855a6bf295ebfacfe",
+                                            "s_1_1101.stats:md5,93bc13f3b0749b2b8d8bcb0b1199f4f0"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,7c64514735a6cf1565b60647edd17d20",
+                                            "s_1_1101.stats:md5,4a0aa6c49b24f876415e5878cef7f805"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,3983b4043bc9df4b505202a5134ccf03",
+                                            "s_1_1101.stats:md5,1c9d9a8558adc1279ca27c96bc1b9758"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,a0b8d77f116ec95975f9253dcb768136",
+                                            "s_1_1101.stats:md5,c3992b786756e7ec42f65ef4b13b50d4"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,43c95ba35d06bb7c57fbd16f3d1cfd6c",
+                                            "s_1_1101.stats:md5,3cb69d04698c39f97f962e5bf1eea7f0"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,3dbeea0cad7052f19f53ff6f19dd4d90",
+                                            "s_1_1101.stats:md5,58bbc8254f0f5f4a244531e8e9c12a04"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,da56d088996376c898d855b6cd0a7dfc",
+                                            "s_1_1101.stats:md5,9f2d78af6908ce1576b89cdc059844ff"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,7b641a5565f095e9a6ffcad9e4305033",
+                                            "s_1_1101.stats:md5,3ada06c59b4fb41b83ab6abd0979e9fc"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,a3843d397a01d51657825bb652c191e5",
+                                            "s_1_1101.stats:md5,19341e52a4bfc7d9d48e9d2acc68c519"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,048e3ebfc8efeb8012def6b741c9060d",
+                                            "s_1_1101.stats:md5,88bd38deca1e87d700effab1fd099565"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,b340db0e07e829dd5da22371916a1a9e",
+                                            "s_1_1101.stats:md5,e44cfaddcc4ffb968e5b1a2f41ac48a5"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,e6011ec6eabbc2b8792deb283c621ce0",
+                                            "s_1_1101.stats:md5,090875dcd1a431af24bc631333f089c4"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,a08f216e3352345031ed100ec4245082",
+                                            "s_1_1101.stats:md5,97b949ef4b96219e1369f673cf5f8a6c"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,b43337c76fb037dfcf5f8f7bcb3618e5",
+                                            "s_1_1101.stats:md5,ddef585805e79951f69d23ab7354f69b"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,8c61fd004104397b360855e058bbf1bf",
+                                            "s_1_1101.stats:md5,0f8d253816d594dcfea3ccf48c826401"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,594d06310d328b188aa0b3edfff22cb2",
+                                            "s_1_1101.stats:md5,3160bf271b39aeb7590e4fd2984710ba"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,4c9eada67c9d55437211d83e111961d5",
+                                            "s_1_1101.stats:md5,2901b46ab16ec4863d30e4c84ec29c97"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,e03971ae5282f0accc0c1b7374d9ef1b",
+                                            "s_1_1101.stats:md5,60d2a19ce59bf70a21a28555484cead8"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,e1c6f7a06e63d149895d3e48e63df155",
+                                            "s_1_1101.stats:md5,44beb10af847ea3dddaf06dda7031126"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,960a99bf29a8f9d936e9b8582d46c9c6",
+                                            "s_1_1101.stats:md5,544cd1a7aaaa841914b40ece43399334"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,5706679f349fd4a6b6313bc2c41c7a42",
+                                            "s_1_1101.stats:md5,627eea844b26dae033848c2f9f69177b"
+                                        ],
+                                        [
+                                            "s_1_1101.bcl:md5,21da5abc4b0402bbac14b5ab998b0b4f",
+                                            "s_1_1101.stats:md5,515bd140b095ad90473ca7a9a69877ab"
+                                        ],
+                                        "s_1_1101.control:md5,08a72e2198ae95150718e8adf011d105",
+                                        "s_1_1101.filter:md5,3a72bc73b323c8cb0ac5bfeb62d98989"
+                                    ]
+                                ],
+                                [
+                                    "s_1_1101.locs:md5,0827ea802e5257cc5b20e757a33d4c98"
+                                ],
+                                "RTAConfiguration.xml:md5,c7d6e257bc374f142dc64b9d2281d4c9",
+                                "config.xml:md5,9a4cc7ec01fefa2f1ce9bcb45bbad6e9"
+                            ]
+                        ],
+                        [
+                            "ControlMetricsOut.bin:md5,6d77b38d0793a6e1ce1e85706e488953",
+                            "CorrectedIntMetricsOut.bin:md5,2bbf84d3be72734addaa2fe794711434",
+                            "ErrorMetricsOut.bin:md5,38c88def138e9bb832539911affdb286",
+                            "ExtractionMetricsOut.bin:md5,7497c3178837eea8f09350b5cd252e99",
+                            "IndexMetricsOut.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+                            "QMetricsOut.bin:md5,7e9f198d53ebdfbb699a5f94cf1ed51c",
+                            "TileMetricsOut.bin:md5,83891751ec1c91a425a524b476b6ca3c"
+                        ],
+                        "RunInfo.xml:md5,03038959f4dd181c86bc97ae71fe270a"
+                    ]
+                ]
+            ]
+        ],
+        "timestamp": "2023-10-18T11:56:39.562418"
+    },
+    "test_untar_onlyfiles": {
+        "content": [
+            [
+                [
+                    [
+                        
+                    ],
+                    [
+                        "hello.txt:md5,e59ff97941044f85df5297e1c302d260"
+                    ]
+                ]
+            ]
+        ],
+        "timestamp": "2023-10-18T11:56:46.878844"
+    },
+    "test_untar": {
+        "content": [
+            [
+                [
+                    [
+                        
+                    ],
+                    [
+                        "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9",
+                        "opts.k2d:md5,a033d00cf6759407010b21700938f543",
+                        "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c"
+                    ]
+                ]
+            ]
+        ],
+        "timestamp": "2023-10-18T11:56:08.16574"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/untar/tests/tags.yml b/modules/nf-core/untar/tests/tags.yml
new file mode 100644
index 00000000..feb6f15c
--- /dev/null
+++ b/modules/nf-core/untar/tests/tags.yml
@@ -0,0 +1,2 @@
+untar:
+  - modules/nf-core/untar/**
diff --git a/modules/nf-core/vcflib/vcfuniq/environment.yml b/modules/nf-core/vcflib/vcfuniq/environment.yml
new file mode 100644
index 00000000..dff6ed89
--- /dev/null
+++ b/modules/nf-core/vcflib/vcfuniq/environment.yml
@@ -0,0 +1,7 @@
+name: vcflib_vcfuniq
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::vcflib=1.0.3
diff --git a/modules/nf-core/vcflib/vcfuniq/main.nf b/modules/nf-core/vcflib/vcfuniq/main.nf
index 6b09dc4d..15899b0a 100644
--- a/modules/nf-core/vcflib/vcfuniq/main.nf
+++ b/modules/nf-core/vcflib/vcfuniq/main.nf
@@ -3,10 +3,10 @@ process VCFLIB_VCFUNIQ {
     label 'process_low'
 
     // WARN: Version information not provided by tool on CLI. Please update version string below when bumping container versions.
-    conda "bioconda::vcflib=1.0.3"
+    conda "${moduleDir}/environment.yml"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/vcflib:1.0.3--hecb563c_1':
-        'quay.io/biocontainers/vcflib:1.0.3--hecb563c_1' }"
+        'biocontainers/vcflib:1.0.3--hecb563c_1' }"
 
     input:
     tuple val(meta), path(vcf), path(tbi)
diff --git a/modules/nf-core/vcflib/vcfuniq/meta.yml b/modules/nf-core/vcflib/vcfuniq/meta.yml
index 8b5e9e89..8adf6b62 100644
--- a/modules/nf-core/vcflib/vcfuniq/meta.yml
+++ b/modules/nf-core/vcflib/vcfuniq/meta.yml
@@ -11,7 +11,6 @@ tools:
       documentation: https://github.com/vcflib/vcflib#USAGE
       doi: "10.1101/2021.05.21.445151"
       licence: ["MIT"]
-
 input:
   - meta:
       type: map
@@ -26,7 +25,6 @@ input:
       type: file
       description: Index of VCF file
       pattern: "*.vcf.gz.tbi"
-
 output:
   - meta:
       type: map
@@ -41,6 +39,7 @@ output:
       type: file
       description: Compressed VCF file
       pattern: "*.vcf.gz"
-
 authors:
   - "@drpatelh"
+maintainers:
+  - "@drpatelh"
diff --git a/nextflow.config b/nextflow.config
index 561769ff..3f244421 100644
--- a/nextflow.config
+++ b/nextflow.config
@@ -153,6 +153,7 @@ profiles {
         dumpHashes             = true
         process.beforeScript   = 'echo $HOSTNAME'
         cleanup                = false
+        nextflow.enable.configProcessNamesValidation = true
     }
     conda {
         conda.enabled          = true
@@ -178,19 +179,16 @@ profiles {
     }
     docker {
         docker.enabled         = true
-        docker.userEmulation   = true
         conda.enabled          = false
         singularity.enabled    = false
         podman.enabled         = false
         shifter.enabled        = false
         charliecloud.enabled   = false
         apptainer.enabled      = false
+        docker.runOptions      = '-u $(id -u):$(id -g)'
     }
     arm {
-        docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64'
-    }
-    arm {
-        docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64'
+        docker.runOptions      = '-u $(id -u):$(id -g) --platform=linux/amd64'
     }
     singularity {
         singularity.enabled    = true
@@ -231,6 +229,7 @@ profiles {
     }
     apptainer {
         apptainer.enabled      = true
+        apptainer.autoMounts   = true
         conda.enabled          = false
         docker.enabled         = false
         singularity.enabled    = false
@@ -240,8 +239,8 @@ profiles {
     }
     gitpod {
         executor.name          = 'local'
-        executor.cpus          = 16
-        executor.memory        = 60.GB
+        executor.cpus          = 4
+        executor.memory        = 8.GB
     }
     test               { includeConfig 'conf/test.config'               }
     test_sispa         { includeConfig 'conf/test_sispa.config'         }
@@ -255,14 +254,14 @@ profiles {
 // Set default registry for Apptainer, Docker, Podman and Singularity independent of -profile
 // Will not be used unless Apptainer / Docker / Podman / Singularity are enabled
 // Set to your registry if you have a mirror of containers
-// apptainer.registry   = 'quay.io'
-// docker.registry      = 'quay.io'
-// podman.registry      = 'quay.io'
-// singularity.registry = 'quay.io'
+apptainer.registry   = 'quay.io'
+docker.registry      = 'quay.io'
+podman.registry      = 'quay.io'
+singularity.registry = 'quay.io'
 
 // Nextflow plugins
 plugins {
-    id 'nf-validation' // Validation of pipeline parameters and creation of an input channel from a sample sheet
+    id 'nf-validation@1.1.3' // Validation of pipeline parameters and creation of an input channel from a sample sheet
 }
 
 // Export these variables to prevent local Python/R libraries from conflicting with those in the container
@@ -279,6 +278,9 @@ env {
 // Capture exit codes from upstream processes when piping
 process.shell = ['/bin/bash', '-euo', 'pipefail']
 
+// Disable process selector warnings by default. Use debug profile to enable warnings.
+nextflow.enable.configProcessNamesValidation = false
+
 def trace_timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss')
 timeline {
     enabled = true
diff --git a/subworkflows/local/assembly_qc.nf b/subworkflows/local/assembly_qc.nf
index 6ca9fc78..ac98c56b 100644
--- a/subworkflows/local/assembly_qc.nf
+++ b/subworkflows/local/assembly_qc.nf
@@ -47,12 +47,15 @@ workflow ASSEMBLY_QC {
     ch_quast_results = Channel.empty()
     ch_quast_tsv     = Channel.empty()
     if (!params.skip_assembly_quast) {
+        scaffolds
+            .collect{ it[1] }
+            .map { scaffolds_collect -> tuple([id: "quast"], scaffolds_collect) }
+            .set { ch_to_quast }
+
         QUAST (
-            scaffolds.collect{ it[1] },
-            fasta,
-            gff,
-            true,
-            params.gff
+            ch_to_quast,
+            fasta.map { [ [:], it ] },
+            gff
         )
         ch_quast_results = QUAST.out.results
         ch_quast_tsv     = QUAST.out.tsv
diff --git a/subworkflows/local/consensus_qc.nf b/subworkflows/local/consensus_qc.nf
index 3e686f6f..f498a9be 100644
--- a/subworkflows/local/consensus_qc.nf
+++ b/subworkflows/local/consensus_qc.nf
@@ -24,12 +24,15 @@ workflow CONSENSUS_QC {
     ch_quast_results = Channel.empty()
     ch_quast_tsv     = Channel.empty()
     if (!params.skip_variants_quast) {
+    consensus
+        .collect{ it[1] }
+        .map { consensus_collect -> tuple([id: "quast"], consensus_collect) }
+        .set { ch_to_quast }
+
         QUAST (
-            consensus.collect{ it[1] },
-            fasta,
-            gff,
-            true,
-            params.gff
+            ch_to_quast,
+            fasta.map { [ [:], it ] },
+            gff
         )
         ch_quast_results = QUAST.out.results
         ch_quast_tsv     = QUAST.out.tsv
diff --git a/subworkflows/local/prepare_genome_illumina.nf b/subworkflows/local/prepare_genome_illumina.nf
index 4b7c1dda..f55aef83 100644
--- a/subworkflows/local/prepare_genome_illumina.nf
+++ b/subworkflows/local/prepare_genome_illumina.nf
@@ -206,7 +206,7 @@ workflow PREPARE_GENOME {
                 }
             } else {
                 BLAST_MAKEBLASTDB (
-                    ch_fasta
+                    ch_fasta.map { [ [:], it ] }
                 )
                 ch_blast_db = BLAST_MAKEBLASTDB.out.db
                 ch_versions = ch_versions.mix(BLAST_MAKEBLASTDB.out.versions)
diff --git a/subworkflows/local/snpeff_snpsift.nf b/subworkflows/local/snpeff_snpsift.nf
index 92a6a669..a3c6c7f7 100644
--- a/subworkflows/local/snpeff_snpsift.nf
+++ b/subworkflows/local/snpeff_snpsift.nf
@@ -28,9 +28,9 @@ workflow SNPEFF_SNPSIFT {
 
     VCF_BGZIP_TABIX_STATS (
         SNPEFF_ANN.out.vcf,
-        [],
-        [],
-        []
+        [ [:], [] ],
+        [ [:], [] ],
+        [ [:], [] ]
     )
     ch_versions = ch_versions.mix(VCF_BGZIP_TABIX_STATS.out.versions)
 
diff --git a/subworkflows/local/variants_bcftools.nf b/subworkflows/local/variants_bcftools.nf
index 103ba725..e4a78c72 100644
--- a/subworkflows/local/variants_bcftools.nf
+++ b/subworkflows/local/variants_bcftools.nf
@@ -26,7 +26,7 @@ workflow VARIANTS_BCFTOOLS {
     //
     BCFTOOLS_MPILEUP (
         bam.map{ meta, bam_file -> [ meta, bam_file, [] ] },
-        fasta,
+        fasta.map { [ [:], it ] },
         params.save_mpileup
     )
     ch_versions = ch_versions.mix(BCFTOOLS_MPILEUP.out.versions.first())
@@ -57,15 +57,15 @@ workflow VARIANTS_BCFTOOLS {
     //
     BCFTOOLS_NORM (
         ch_vcf.join(ch_tbi, by: [0]),
-        fasta
+        fasta.map { [ [:], it ] }
     )
     ch_versions = ch_versions.mix(BCFTOOLS_NORM.out.versions.first())
 
     VCF_TABIX_STATS (
         BCFTOOLS_NORM.out.vcf,
-        [],
-        [],
-        []
+        [ [:], [] ],
+        [ [:], [] ],
+        [ [:], [] ]
     )
     ch_versions = ch_versions.mix(VCF_TABIX_STATS.out.versions)
 
diff --git a/subworkflows/local/variants_ivar.nf b/subworkflows/local/variants_ivar.nf
index 26e460aa..eceab2bd 100644
--- a/subworkflows/local/variants_ivar.nf
+++ b/subworkflows/local/variants_ivar.nf
@@ -60,9 +60,9 @@ workflow VARIANTS_IVAR {
 
     VCF_TABIX_STATS (
         BCFTOOLS_SORT.out.vcf,
-        [],
-        [],
-        []
+        [ [:], [] ],
+        [ [:], [] ],
+        [ [:], [] ]
     )
     ch_versions = ch_versions.mix(VCF_TABIX_STATS.out.versions)
 
diff --git a/subworkflows/local/variants_long_table.nf b/subworkflows/local/variants_long_table.nf
index a3ad6b0b..e0919055 100644
--- a/subworkflows/local/variants_long_table.nf
+++ b/subworkflows/local/variants_long_table.nf
@@ -25,14 +25,14 @@ workflow VARIANTS_LONG_TABLE {
     ch_versions = ch_versions.mix(BCFTOOLS_QUERY.out.versions.first())
 
     MAKE_VARIANTS_LONG_TABLE (
-        BCFTOOLS_QUERY.out.txt.collect{it[1]},
+        BCFTOOLS_QUERY.out.output.collect{it[1]},
         snpsift.collect{it[1]}.ifEmpty([]),
         pangolin.collect{it[1]}.ifEmpty([])
     )
     ch_versions = ch_versions.mix(MAKE_VARIANTS_LONG_TABLE.out.versions)
 
     emit:
-    query_table = BCFTOOLS_QUERY.out.txt           // channel: [ val(meta), [ txt ] ]
+    query_table = BCFTOOLS_QUERY.out.output           // channel: [ val(meta), [ txt ] ]
     long_table  = MAKE_VARIANTS_LONG_TABLE.out.csv // channel: [ val(meta), [ csv ] ]
 
     versions    = ch_versions    // channel: [ versions.yml ]
diff --git a/subworkflows/local/vcf_tabix_stats.nf b/subworkflows/local/vcf_tabix_stats.nf
index c99321ae..2198fc95 100644
--- a/subworkflows/local/vcf_tabix_stats.nf
+++ b/subworkflows/local/vcf_tabix_stats.nf
@@ -25,7 +25,9 @@ workflow VCF_TABIX_STATS {
         vcf.join(TABIX_TABIX.out.tbi, by: [0]),
         regions,
         targets,
-        samples
+        samples,
+        [ [:], [] ],
+        [ [:], [] ]
     )
     ch_versions = ch_versions.mix(BCFTOOLS_STATS.out.versions.first())
 
diff --git a/subworkflows/nf-core/bam_markduplicates_picard/meta.yml b/subworkflows/nf-core/bam_markduplicates_picard/meta.yml
index 822c6132..fe63068e 100644
--- a/subworkflows/nf-core/bam_markduplicates_picard/meta.yml
+++ b/subworkflows/nf-core/bam_markduplicates_picard/meta.yml
@@ -1,3 +1,4 @@
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json
 name: "bam_markduplicates_picard"
 description: Picard MarkDuplicates, index BAM file and run samtools stats, flagstat and idxstats
 keywords:
@@ -5,14 +6,13 @@ keywords:
   - bam
   - sam
   - cram
-
-modules:
+components:
   - picard/markduplicates
   - samtools/index
   - samtools/stats
   - samtools/idxstats
   - samtools/flagstat
-
+  - bam_stats_samtools
 input:
   - ch_bam:
       description: |
@@ -58,3 +58,6 @@ output:
 authors:
   - "@dmarron"
   - "@drpatelh"
+maintainers:
+  - "@dmarron"
+  - "@drpatelh"
diff --git a/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test
new file mode 100644
index 00000000..e721f30c
--- /dev/null
+++ b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test
@@ -0,0 +1,92 @@
+nextflow_workflow {
+
+    name "Test Workflow BAM_MARKDUPLICATES_PICARD"
+    script "../main.nf"
+    workflow "BAM_MARKDUPLICATES_PICARD"
+
+    tag "picard"
+    tag "picard/markduplicates"
+    tag "subworkflows"
+    tag "subworkflows_nfcore"
+    tag "bam_markduplicates_picard"
+    tag "subworkflows/bam_markduplicates_picard"
+    tag "subworkflows/bam_stats_samtools"
+    tag "bam_stats_samtools"
+    tag "samtools"
+    tag "samtools/flagstat"
+    tag "samtools/idxstats"
+    tag "samtools/index"
+    tag "samtools/stats"
+    
+    test("homo_sapiens - bam") {
+
+        when {
+            workflow {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true)
+                ]
+                input[1] = [ 
+                    [ id:'genome' ],
+                    file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                ]
+                input[2] = [ 
+                    [ id:'genome' ],
+                    file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success},
+                { assert snapshot(
+                    path(workflow.out.bam[0][1]),
+                    path(workflow.out.bai[0][1]),
+                    path(workflow.out.flagstat[0][1]),
+                    path(workflow.out.idxstats[0][1]),
+                    path(workflow.out.stats[0][1]),
+                ).match("homo_sapiens - bam")  },
+                { assert path(workflow.out.metrics.get(0).get(1)).getText().contains("97") }
+            )
+        }
+    }
+
+    test("homo_sapiens - cram") {
+
+        when {
+            workflow {
+                """
+                input[0] = [
+                    [ id:'test', single_end:false ], // meta map
+                    file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true)
+                ]
+                input[1] = [ [ id:'genome' ],
+                    file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                ]
+                input[2]   = [ 
+                    [ id:'genome' ],
+                    file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success},
+                { assert snapshot(
+                    path(workflow.out.bam[0][1]),
+                    path(workflow.out.bai[0][1]),
+                    path(workflow.out.flagstat[0][1]),
+                    path(workflow.out.idxstats[0][1]),
+                    path(workflow.out.stats[0][1]),
+                ).match("homo_sapiens - cram")  },
+                { assert path(workflow.out.metrics.get(0).get(1)).getText().contains("0.999986") }
+            )
+        }
+    }
+
+}
diff --git a/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap
new file mode 100644
index 00000000..b1907385
--- /dev/null
+++ b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap
@@ -0,0 +1,22 @@
+{
+    "homo_sapiens - cram": {
+        "content": [
+            "test.bam:md5,6641dc05efa8384a061f378d86d922cd",
+            "test.bam.bai:md5,c41c60d8a94adebe53b6df80b6e90d38",
+            "test.flagstat:md5,93b0ef463df947ede1f42ff60396c34d",
+            "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15",
+            "test.stats:md5,0035ac8900d85e9a790f4c1f48b76947"
+        ],
+        "timestamp": "2023-12-05T17:45:12.484869"
+    },
+    "homo_sapiens - bam": {
+        "content": [
+            "test.bam:md5,3091fe6ba1b7530f382fe40b9fd8f45b",
+            "test.bam.bai:md5,4d3ae8d013444b55e17aa0149a2ab404",
+            "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783",
+            "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2",
+            "test.stats:md5,e32e7e49dce1fbe327a89e0fb7bc01b1"
+        ],
+        "timestamp": "2023-12-05T17:43:58.582652"
+    }
+}
\ No newline at end of file
diff --git a/subworkflows/nf-core/bam_markduplicates_picard/tests/tags.yml b/subworkflows/nf-core/bam_markduplicates_picard/tests/tags.yml
new file mode 100644
index 00000000..10b85270
--- /dev/null
+++ b/subworkflows/nf-core/bam_markduplicates_picard/tests/tags.yml
@@ -0,0 +1,2 @@
+subworkflows/bam_markduplicates_picard:
+  - subworkflows/nf-core/bam_markduplicates_picard/**
diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/main.nf b/subworkflows/nf-core/bam_sort_stats_samtools/main.nf
index 617871fe..fc1c652b 100644
--- a/subworkflows/nf-core/bam_sort_stats_samtools/main.nf
+++ b/subworkflows/nf-core/bam_sort_stats_samtools/main.nf
@@ -9,7 +9,7 @@ include { BAM_STATS_SAMTOOLS } from '../bam_stats_samtools/main'
 workflow BAM_SORT_STATS_SAMTOOLS {
     take:
     ch_bam   // channel: [ val(meta), [ bam ] ]
-    ch_fasta // channel: [ fasta ]
+    ch_fasta // channel: [ val(meta), path(fasta) ]
 
     main:
 
diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml b/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml
index 131065be..e01f9ccf 100644
--- a/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml
+++ b/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml
@@ -1,3 +1,4 @@
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json
 name: bam_sort_stats_samtools
 description: Sort SAM/BAM/CRAM file
 keywords:
@@ -5,12 +6,13 @@ keywords:
   - bam
   - sam
   - cram
-modules:
+components:
   - samtools/sort
   - samtools/index
   - samtools/stats
   - samtools/idxstats
   - samtools/flagstat
+  - bam_stats_samtools
 input:
   - meta:
       type: map
@@ -63,3 +65,6 @@ output:
 authors:
   - "@drpatelh"
   - "@ewels"
+maintainers:
+  - "@drpatelh"
+  - "@ewels"
diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test
new file mode 100644
index 00000000..59b749d8
--- /dev/null
+++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test
@@ -0,0 +1,78 @@
+nextflow_workflow {
+
+    name "Test Workflow BAM_SORT_STATS_SAMTOOLS"
+    script "../main.nf"
+    workflow "BAM_SORT_STATS_SAMTOOLS"
+    tag "subworkflows"
+    tag "subworkflows_nfcore"
+    tag "subworkflows/bam_sort_stats_samtools"
+    tag "bam_sort_stats_samtools"
+    tag "subworkflows/bam_stats_samtools"
+    tag "bam_stats_samtools"
+    tag "samtools"
+    tag "samtools/index"
+    tag "samtools/sort"
+    tag "samtools/stats"
+    tag "samtools/idxstats"
+    tag "samtools/flagstat"
+
+    test("test_bam_sort_stats_samtools_single_end") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            workflow {
+                """
+                input[0] = [ [ id:'test', single_end:false ], // meta map
+                        file(params.test_data['sarscov2']['illumina']['test_single_end_bam'], checkIfExists: true)
+                        ]
+                input[1] = [ [ id:'genome' ],
+                        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                        ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success},
+                { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"},
+                { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"},
+                { assert snapshot(workflow.out.stats).match("test_bam_sort_stats_samtools_single_end_stats") },
+                { assert snapshot(workflow.out.flagstat).match("test_bam_sort_stats_samtools_single_end_flagstats") },
+                { assert snapshot(workflow.out.idxstats).match("test_bam_sort_stats_samtools_single_end_idxstats") }
+            )
+        }
+    }
+
+    test("test_bam_sort_stats_samtools_paired_end") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            workflow {
+                """
+                input[0] = [ [ id:'test', single_end:false ], // meta map
+                        file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true)
+                        ]
+                input[1] = [ [ id:'genome' ],
+                        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                        ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success},
+                { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"},
+                { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"},
+                { assert snapshot(workflow.out.stats).match("test_bam_sort_stats_samtools_paired_end_stats") },
+                { assert snapshot(workflow.out.flagstat).match("test_bam_sort_stats_samtools_paired_end_flagstats") },
+                { assert snapshot(workflow.out.idxstats).match("test_bam_sort_stats_samtools_paired_end_idxstats") }
+            )
+        }
+    }
+}
diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap
new file mode 100644
index 00000000..77afbf17
--- /dev/null
+++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap
@@ -0,0 +1,86 @@
+{
+    "test_bam_sort_stats_samtools_paired_end_flagstats": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783"
+                ]
+            ]
+        ],
+        "timestamp": "2023-10-22T20:25:03.687121177"
+    },
+    "test_bam_sort_stats_samtools_paired_end_idxstats": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2"
+                ]
+            ]
+        ],
+        "timestamp": "2023-10-22T20:25:03.709648916"
+    },
+    "test_bam_sort_stats_samtools_single_end_stats": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.stats:md5,f281507081517414eb1a04b2d9c855b2"
+                ]
+            ]
+        ],
+        "timestamp": "2023-12-04T11:06:50.951881479"
+    },
+    "test_bam_sort_stats_samtools_paired_end_stats": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.stats:md5,e32e7e49dce1fbe327a89e0fb7bc01b1"
+                ]
+            ]
+        ],
+        "timestamp": "2023-12-04T11:06:59.253905951"
+    },
+    "test_bam_sort_stats_samtools_single_end_idxstats": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20"
+                ]
+            ]
+        ],
+        "timestamp": "2023-10-22T20:25:58.451364604"
+    },
+    "test_bam_sort_stats_samtools_single_end_flagstats": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53"
+                ]
+            ]
+        ],
+        "timestamp": "2023-10-22T20:25:58.416859285"
+    }
+}
\ No newline at end of file
diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml b/subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml
new file mode 100644
index 00000000..30b69d6a
--- /dev/null
+++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml
@@ -0,0 +1,2 @@
+subworkflows/bam_sort_stats_samtools:
+  - subworkflows/nf-core/bam_sort_stats_samtools/**
diff --git a/subworkflows/nf-core/bam_stats_samtools/main.nf b/subworkflows/nf-core/bam_stats_samtools/main.nf
index c9d7c8b7..44d4c010 100644
--- a/subworkflows/nf-core/bam_stats_samtools/main.nf
+++ b/subworkflows/nf-core/bam_stats_samtools/main.nf
@@ -9,7 +9,7 @@ include { SAMTOOLS_FLAGSTAT } from '../../../modules/nf-core/samtools/flagstat/m
 workflow BAM_STATS_SAMTOOLS {
     take:
     ch_bam_bai // channel: [ val(meta), path(bam), path(bai) ]
-    ch_fasta   // channel: [ path(fasta) ]
+    ch_fasta   // channel: [ val(meta), path(fasta) ]
 
     main:
     ch_versions = Channel.empty()
diff --git a/subworkflows/nf-core/bam_stats_samtools/meta.yml b/subworkflows/nf-core/bam_stats_samtools/meta.yml
index b6072686..809bf736 100644
--- a/subworkflows/nf-core/bam_stats_samtools/meta.yml
+++ b/subworkflows/nf-core/bam_stats_samtools/meta.yml
@@ -1,3 +1,4 @@
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json
 name: bam_stats_samtools
 description: Produces comprehensive statistics from SAM/BAM/CRAM file
 keywords:
@@ -6,7 +7,7 @@ keywords:
   - bam
   - sam
   - cram
-modules:
+components:
   - samtools/stats
   - samtools/idxstats
   - samtools/flagstat
@@ -38,3 +39,5 @@ output:
         Structure: [ path(versions.yml) ]
 authors:
   - "@drpatelh"
+maintainers:
+  - "@drpatelh"
diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test
new file mode 100644
index 00000000..97210890
--- /dev/null
+++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test
@@ -0,0 +1,102 @@
+nextflow_workflow {
+
+    name "Test Workflow BAM_STATS_SAMTOOLS"
+    script "../main.nf"
+    workflow "BAM_STATS_SAMTOOLS"
+    tag "subworkflows"
+    tag "subworkflows_nfcore"
+    tag "bam_stats_samtools"
+    tag "subworkflows/bam_stats_samtools"
+    tag "samtools"
+    tag "samtools/flagstat"
+    tag "samtools/idxstats"
+    tag "samtools/stats"
+
+    test("test_bam_stats_samtools_single_end") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            workflow {
+                """
+                    input[0] = [ [ id:'test', single_end:true ], // meta map
+                                file(params.test_data['sarscov2']['illumina']['test_single_end_sorted_bam'], checkIfExists: true),
+                                file(params.test_data['sarscov2']['illumina']['test_single_end_sorted_bam_bai'], checkIfExists: true)
+                        ]
+                    input[1] = [ [ id:'genome' ],
+                            file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                            ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success},
+                { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_single_end_stats") },
+                { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_single_end_flagstats") },
+                { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_single_end_idxstats") }
+            )
+        }
+    }
+
+    test("test_bam_stats_samtools_paired_end") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            workflow {
+                """
+                    input[0] = [ [ id:'test', single_end:true ], // meta map
+                                file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+                                file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+                        ]
+                    input[1] = [ [ id:'genome' ],
+                            file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                            ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_stats") },
+                { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_flagstats") },
+                { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_idxstats") }
+            )
+        }
+    }
+
+    test("test_bam_stats_samtools_paired_end_cram") {
+
+        when {
+            params {
+                outdir   = "$outputDir"
+            }
+            workflow {
+                """
+                     input[0] = [ [ id:'test', single_end:false ], // meta map
+                                file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
+                                file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
+                                ]
+                    input[1] = [ [ id:'genome' ],
+                            file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+                            ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success},
+                { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_cram_stats") },
+                { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_cram_flagstats") },
+                { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_cram_idxstats") }
+            )
+        }
+    }
+
+}
diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap
new file mode 100644
index 00000000..d3af1376
--- /dev/null
+++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap
@@ -0,0 +1,128 @@
+{
+    "test_bam_stats_samtools_paired_end_cram_flagstats": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.flagstat:md5,a53f3d26e2e9851f7d528442bbfe9781"
+                ]
+            ]
+        ],
+        "timestamp": "2023-11-06T09:31:26.194017574"
+    },
+    "test_bam_stats_samtools_paired_end_stats": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.stats:md5,49e2b43344ff92bc4c02463a58f7ba4a"
+                ]
+            ]
+        ],
+        "timestamp": "2023-12-04T11:07:13.965061942"
+    },
+    "test_bam_stats_samtools_paired_end_flagstats": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783"
+                ]
+            ]
+        ],
+        "timestamp": "2023-11-06T09:31:11.668517251"
+    },
+    "test_bam_stats_samtools_single_end_flagstats": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53"
+                ]
+            ]
+        ],
+        "timestamp": "2023-11-06T09:26:10.340046381"
+    },
+    "test_bam_stats_samtools_paired_end_cram_idxstats": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15"
+                ]
+            ]
+        ],
+        "timestamp": "2023-11-06T09:31:26.207052003"
+    },
+    "test_bam_stats_samtools_single_end_stats": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.stats:md5,5a6667d97806e5002731e9cf23674fad"
+                ]
+            ]
+        ],
+        "timestamp": "2023-12-04T11:07:06.676820877"
+    },
+    "test_bam_stats_samtools_paired_end_idxstats": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2"
+                ]
+            ]
+        ],
+        "timestamp": "2023-11-06T09:31:11.68246157"
+    },
+    "test_bam_stats_samtools_single_end_idxstats": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": true
+                    },
+                    "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20"
+                ]
+            ]
+        ],
+        "timestamp": "2023-11-06T09:26:10.349439801"
+    },
+    "test_bam_stats_samtools_paired_end_cram_stats": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.stats:md5,2cf2fe93596ee3d74f946097b204a629"
+                ]
+            ]
+        ],
+        "timestamp": "2023-12-04T11:07:22.30295557"
+    }
+}
\ No newline at end of file
diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml b/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml
new file mode 100644
index 00000000..ec2f2d68
--- /dev/null
+++ b/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml
@@ -0,0 +1,2 @@
+subworkflows/bam_stats_samtools:
+  - subworkflows/nf-core/bam_stats_samtools/**
diff --git a/subworkflows/nf-core/bam_variant_demix_boot_freyja/meta.yml b/subworkflows/nf-core/bam_variant_demix_boot_freyja/meta.yml
index 2515b4fb..3afe864a 100644
--- a/subworkflows/nf-core/bam_variant_demix_boot_freyja/meta.yml
+++ b/subworkflows/nf-core/bam_variant_demix_boot_freyja/meta.yml
@@ -1,16 +1,15 @@
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json
 name: "bam_variant_demix_boot_freyja"
 description: Recover relative lineage abundances from mixed SARS-CoV-2 samples from a sequencing dataset (BAM aligned to the Hu-1 reference)
 keywords:
   - bam
   - variants
   - cram
-
-modules:
+components:
   - freyja/variants
   - freyja/demix
   - freyja/update
   - freyja/boot
-
 input:
   - ch_bam:
       type: file
@@ -38,7 +37,6 @@ input:
       description: |
         Structure: path(lineages_meta)
         File containing lineage metadata that correspond to barcodes
-
 output:
   - meta:
       type: map
@@ -72,15 +70,15 @@ output:
         a csv file that includes the lineages present but summarized by constellation and their corresponding abundances
   - barcodes:
       type: file
-      description: path(barcodes)
-        a csv file that includes the lineages present but summarized by constellation and their corresponding abundances
+      description: path(barcodes) a csv file that includes the lineages present but summarized by constellation and their corresponding abundances
   - lineages_meta:
       type: file
-      description: path(lineages_meta)
-        a csv file that includes the lineages present but summarized by constellation and their corresponding abundances
+      description: path(lineages_meta) a csv file that includes the lineages present but summarized by constellation and their corresponding abundances
   - versions:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
 authors:
   - "@Joon-Klaps"
+maintainers:
+  - "@Joon-Klaps"
diff --git a/subworkflows/nf-core/fastq_align_bowtie2/main.nf b/subworkflows/nf-core/fastq_align_bowtie2/main.nf
index eaf4ac5e..ba4420f7 100644
--- a/subworkflows/nf-core/fastq_align_bowtie2/main.nf
+++ b/subworkflows/nf-core/fastq_align_bowtie2/main.nf
@@ -21,18 +21,18 @@ workflow FASTQ_ALIGN_BOWTIE2 {
     // Map reads with Bowtie2
     //
     BOWTIE2_ALIGN ( ch_reads, ch_index, save_unaligned, sort_bam )
-    ch_versions = ch_versions.mix(BOWTIE2_ALIGN.out.versions.first())
+    ch_versions = ch_versions.mix(BOWTIE2_ALIGN.out.versions)
 
     //
     // Sort, index BAM file and run samtools stats, flagstat and idxstats
     //
-    BAM_SORT_STATS_SAMTOOLS ( BOWTIE2_ALIGN.out.bam, ch_fasta )
+    BAM_SORT_STATS_SAMTOOLS ( BOWTIE2_ALIGN.out.aligned, ch_fasta )
     ch_versions = ch_versions.mix(BAM_SORT_STATS_SAMTOOLS.out.versions)
 
     emit:
-    bam_orig         = BOWTIE2_ALIGN.out.bam          // channel: [ val(meta), bam   ]
-    log_out          = BOWTIE2_ALIGN.out.log          // channel: [ val(meta), log   ]
-    fastq            = BOWTIE2_ALIGN.out.fastq        // channel: [ val(meta), fastq ]
+    bam_orig         = BOWTIE2_ALIGN.out.aligned      // channel: [ val(meta), aligned ]
+    log_out          = BOWTIE2_ALIGN.out.log          // channel: [ val(meta), log     ]
+    fastq            = BOWTIE2_ALIGN.out.fastq        // channel: [ val(meta), fastq   ]
 
     bam              = BAM_SORT_STATS_SAMTOOLS.out.bam      // channel: [ val(meta), [ bam ] ]
     bai              = BAM_SORT_STATS_SAMTOOLS.out.bai      // channel: [ val(meta), [ bai ] ]
diff --git a/subworkflows/nf-core/fastq_align_bowtie2/meta.yml b/subworkflows/nf-core/fastq_align_bowtie2/meta.yml
index ad378077..58023a89 100644
--- a/subworkflows/nf-core/fastq_align_bowtie2/meta.yml
+++ b/subworkflows/nf-core/fastq_align_bowtie2/meta.yml
@@ -1,3 +1,4 @@
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json
 name: fastq_align_bowtie2
 description: Align reads to a reference genome using bowtie2 then sort with samtools
 keywords:
@@ -5,13 +6,14 @@ keywords:
   - fasta
   - genome
   - reference
-modules:
+components:
   - bowtie2/align
   - samtools/sort
   - samtools/index
   - samtools/stats
   - samtools/idxstats
   - samtools/flagstat
+  - bam_sort_stats_samtools
 input:
   - meta:
       type: map
@@ -33,9 +35,10 @@ input:
         Save reads that do not map to the reference (true) or discard them (false)
         (default: false)
   - sort_bam:
+      type: boolean
       description: |
         Save reads that do not map to the reference (true) or discard them (false)
-        (default: false)
+      default: false
   - ch_fasta:
       type: file
       description: Reference fasta file
@@ -58,6 +61,7 @@ output:
       type: file
       description: Alignment log
       pattern: "*.log"
-# TODO Add samtools outputs
 authors:
   - "@drpatelh"
+maintainers:
+  - "@drpatelh"
diff --git a/workflows/illumina.nf b/workflows/illumina.nf
index b38fe9b6..d25f4979 100644
--- a/workflows/illumina.nf
+++ b/workflows/illumina.nf
@@ -294,7 +294,7 @@ workflow ILLUMINA {
             PREPARE_GENOME.out.bowtie2_index,
             params.save_unaligned,
             false,
-            PREPARE_GENOME.out.fasta
+            PREPARE_GENOME.out.fasta.map { [ [:], it ] }
         )
         ch_bam                      = FASTQ_ALIGN_BOWTIE2.out.bam
         ch_bai                      = FASTQ_ALIGN_BOWTIE2.out.bai
@@ -352,7 +352,7 @@ workflow ILLUMINA {
         BAM_TRIM_PRIMERS_IVAR (
             ch_bam.join(ch_bai, by: [0]),
             PREPARE_GENOME.out.primer_bed,
-            PREPARE_GENOME.out.fasta
+            PREPARE_GENOME.out.fasta.map { [ [:], it ] }
         )
         ch_bam                        = BAM_TRIM_PRIMERS_IVAR.out.bam
         ch_bai                        = BAM_TRIM_PRIMERS_IVAR.out.bai
@@ -367,7 +367,7 @@ workflow ILLUMINA {
     if (!params.skip_variants && !params.skip_markduplicates) {
         BAM_MARKDUPLICATES_PICARD (
             ch_bam,
-            PREPARE_GENOME.out.fasta,
+            PREPARE_GENOME.out.fasta.map { [ [:], it ] },
             PREPARE_GENOME.out.fai
         )
         ch_bam                             = BAM_MARKDUPLICATES_PICARD.out.bam
@@ -395,9 +395,10 @@ workflow ILLUMINA {
     ch_amplicon_heatmap_multiqc = Channel.empty()
     if (!params.skip_variants && !params.skip_mosdepth) {
         MOSDEPTH_GENOME (
-            ch_bam.join(ch_bai, by: [0]),
+            ch_bam
+                .join(ch_bai, by: [0])
+                .map { meta, bam, bai -> [ meta, bam, bai, [] ] },
             [ [:], [] ],
-            [ [:], [] ]
         )
         ch_mosdepth_multiqc = MOSDEPTH_GENOME.out.global_txt
         ch_versions         = ch_versions.mix(MOSDEPTH_GENOME.out.versions.first().ifEmpty(null))
@@ -409,9 +410,10 @@ workflow ILLUMINA {
 
         if (params.protocol == 'amplicon') {
             MOSDEPTH_AMPLICON (
-                ch_bam.join(ch_bai, by: [0]),
-                PREPARE_GENOME.out.primer_collapsed_bed.map { [ [:], it ] },
-                [ [:], [] ]
+                ch_bam
+                    .join(ch_bai, by: [0])
+                    .join(PREPARE_GENOME.out.primer_collapsed_bed),
+                [ [:], [] ],
             )
             ch_versions = ch_versions.mix(MOSDEPTH_AMPLICON.out.versions.first().ifEmpty(null))
 
@@ -499,7 +501,7 @@ workflow ILLUMINA {
         CONSENSUS_IVAR (
             ch_bam,
             PREPARE_GENOME.out.fasta,
-            params.gff ? PREPARE_GENOME.out.gff : [],
+            params.gff ? PREPARE_GENOME.out.gff.map { [ [:], it ] } : [ [:], [] ],
             PREPARE_GENOME.out.nextclade_db
         )
 
@@ -518,7 +520,7 @@ workflow ILLUMINA {
             ch_vcf,
             ch_tbi,
             PREPARE_GENOME.out.fasta,
-            params.gff ? PREPARE_GENOME.out.gff : [],
+            params.gff ? PREPARE_GENOME.out.gff.map { [ [:], it ] } : [ [:], [] ],
             PREPARE_GENOME.out.nextclade_db
         )
 
@@ -606,7 +608,7 @@ workflow ILLUMINA {
             params.spades_mode,
             ch_spades_hmm,
             PREPARE_GENOME.out.fasta,
-            params.gff ? PREPARE_GENOME.out.gff : [],
+            params.gff ? PREPARE_GENOME.out.gff.map { [ [:], it ] } : [ [:], [] ],
             PREPARE_GENOME.out.blast_db,
             ch_blast_outfmt6_header
         )
@@ -622,7 +624,7 @@ workflow ILLUMINA {
         ASSEMBLY_UNICYCLER (
             ch_assembly_fastq.map { meta, fastq -> [ meta, fastq, [] ] },
             PREPARE_GENOME.out.fasta,
-            params.gff ? PREPARE_GENOME.out.gff : [],
+            params.gff ? PREPARE_GENOME.out.gff.map { [ [:], it ] } : [ [:], [] ],
             PREPARE_GENOME.out.blast_db,
             ch_blast_outfmt6_header
         )
@@ -638,7 +640,7 @@ workflow ILLUMINA {
         ASSEMBLY_MINIA (
             ch_assembly_fastq,
             PREPARE_GENOME.out.fasta,
-            params.gff ? PREPARE_GENOME.out.gff : [],
+            params.gff ? PREPARE_GENOME.out.gff.map { [ [:], it ] } : [ [:], [] ],
             PREPARE_GENOME.out.blast_db,
             ch_blast_outfmt6_header
         )
@@ -679,13 +681,13 @@ workflow ILLUMINA {
             ch_ivar_counts_multiqc.collect{it[1]}.ifEmpty([]),
             ch_bcftools_stats_multiqc.collect{it[1]}.ifEmpty([]),
             ch_snpeff_multiqc.collect{it[1]}.ifEmpty([]),
-            ch_quast_multiqc.collect().ifEmpty([]),
+            ch_quast_multiqc.collect{it[1]}.ifEmpty([]),
             ch_pangolin_multiqc.collect{it[1]}.ifEmpty([]),
             ch_nextclade_multiqc.collectFile(name: 'nextclade_clade_mqc.tsv').ifEmpty([]),
             ch_cutadapt_multiqc.collect{it[1]}.ifEmpty([]),
-            ch_spades_quast_multiqc.collect().ifEmpty([]),
-            ch_unicycler_quast_multiqc.collect().ifEmpty([]),
-            ch_minia_quast_multiqc.collect().ifEmpty([])
+            ch_spades_quast_multiqc.collect{it[1]}.ifEmpty([]),
+            ch_unicycler_quast_multiqc.collect{it[1]}.ifEmpty([]),
+            ch_minia_quast_multiqc.collect{it[1]}.ifEmpty([])
         )
         multiqc_report = MULTIQC.out.report.toList()
     }
@@ -701,6 +703,7 @@ workflow.onComplete {
     if (params.email || params.email_on_fail) {
         NfcoreTemplate.email(workflow, params, summary_params, projectDir, log, multiqc_report, fail_mapped_reads)
     }
+    NfcoreTemplate.dump_parameters(workflow, params)
     NfcoreTemplate.summary(workflow, params, log, fail_mapped_reads, pass_mapped_reads)
 }
 
diff --git a/workflows/nanopore.nf b/workflows/nanopore.nf
index 35e4266f..698220cd 100644
--- a/workflows/nanopore.nf
+++ b/workflows/nanopore.nf
@@ -347,9 +347,11 @@ workflow NANOPORE {
     //
     BCFTOOLS_STATS (
         VCFLIB_VCFUNIQ.out.vcf.join(TABIX_TABIX.out.tbi, by: [0]),
-        [],
-        [],
-        []
+        [ [:], [] ],
+        [ [:], [] ],
+        [ [:], [] ],
+        [ [:], [] ],
+        [ [:], [] ]
     )
     ch_versions = ch_versions.mix(BCFTOOLS_STATS.out.versions.first().ifEmpty(null))
 
@@ -358,7 +360,7 @@ workflow NANOPORE {
     //
     FILTER_BAM_SAMTOOLS (
         ARTIC_MINION.out.bam.join(ARTIC_MINION.out.bai, by: [0]),
-        []
+        [ [:], [] ]
     )
     ch_versions = ch_versions.mix(FILTER_BAM_SAMTOOLS.out.versions)
 
@@ -370,8 +372,9 @@ workflow NANOPORE {
     if (!params.skip_mosdepth) {
 
         MOSDEPTH_GENOME (
-            ARTIC_MINION.out.bam_primertrimmed.join(ARTIC_MINION.out.bai_primertrimmed, by: [0]),
-            [ [:], [] ],
+            ARTIC_MINION.out.bam_primertrimmed
+                .join(ARTIC_MINION.out.bai_primertrimmed, by: [0])
+                .map { meta, bam, bai -> [ meta, bam, bai, [] ] },
             [ [:], [] ]
         )
         ch_mosdepth_multiqc  = MOSDEPTH_GENOME.out.global_txt
@@ -383,8 +386,7 @@ workflow NANOPORE {
         ch_versions = ch_versions.mix(PLOT_MOSDEPTH_REGIONS_GENOME.out.versions)
 
         MOSDEPTH_AMPLICON (
-            ARTIC_MINION.out.bam_primertrimmed.join(ARTIC_MINION.out.bai_primertrimmed, by: [0]),
-            PREPARE_GENOME.out.primer_collapsed_bed.map { [ [:], it ] }.collect(),
+            ARTIC_MINION.out.bam_primertrimmed.join(ARTIC_MINION.out.bai_primertrimmed, by: [0]).join(PREPARE_GENOME.out.primer_collapsed_bed),
             [ [:], [] ]
         )
         ch_versions = ch_versions.mix(MOSDEPTH_AMPLICON.out.versions.first().ifEmpty(null))
@@ -459,12 +461,14 @@ workflow NANOPORE {
     //
     ch_quast_multiqc = Channel.empty()
     if (!params.skip_variants_quast) {
+        ARTIC_MINION.out.fasta
+            .collect{ it[1] }
+            .map { consensus_collect -> tuple([id: "quast"], consensus_collect) }
+            .set { ch_to_quast }
         QUAST (
-            ARTIC_MINION.out.fasta.collect{ it[1] },
-            PREPARE_GENOME.out.fasta.collect(),
-            params.gff ? PREPARE_GENOME.out.gff : [],
-            true,
-            params.gff
+            ch_to_quast,
+            PREPARE_GENOME.out.fasta.collect().map { [ [:], it ] },
+            params.gff ? PREPARE_GENOME.out.gff.map { [ [:], it ] } : [ [:], [] ],
         )
         ch_quast_multiqc = QUAST.out.tsv
         ch_versions      = ch_versions.mix(QUAST.out.versions)
@@ -557,7 +561,7 @@ workflow NANOPORE {
             FILTER_BAM_SAMTOOLS.out.flagstat.collect{it[1]}.ifEmpty([]),
             BCFTOOLS_STATS.out.stats.collect{it[1]}.ifEmpty([]),
             ch_mosdepth_multiqc.collect{it[1]}.ifEmpty([]),
-            ch_quast_multiqc.collect().ifEmpty([]),
+            ch_quast_multiqc.collect{it[1]}.ifEmpty([]),
             ch_snpeff_multiqc.collect{it[1]}.ifEmpty([]),
             ch_pangolin_multiqc.collect{it[1]}.ifEmpty([]),
             ch_nextclade_multiqc.collectFile(name: 'nextclade_clade_mqc.tsv').ifEmpty([])
@@ -576,6 +580,7 @@ workflow.onComplete {
     if (params.email || params.email_on_fail) {
         NfcoreTemplate.email(workflow, params, summary_params, projectDir, log, multiqc_report)
     }
+    NfcoreTemplate.dump_parameters(workflow, params)
     NfcoreTemplate.summary(workflow, params, log)
 }