From 0b1e2955bfa6236c0bf78eb6c765fb231ebd56e1 Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Tue, 26 Sep 2023 08:08:56 +0000 Subject: [PATCH 01/45] Template update for nf-core/tools version 2.10 --- .devcontainer/devcontainer.json | 1 + .github/CONTRIBUTING.md | 4 +- .github/workflows/linting.yml | 2 +- .github/workflows/release-announcments.yml | 68 +++++++++ CITATIONS.md | 2 +- CODE_OF_CONDUCT.md | 133 ++++++++++++++---- README.md | 21 +-- assets/multiqc_config.yml | 4 +- conf/modules.config | 9 ++ docs/output.md | 5 +- docs/usage.md | 16 ++- lib/NfcoreTemplate.groovy | 16 +++ lib/WorkflowViralrecon.groovy | 2 +- main.nf | 3 + modules.json | 6 +- .../custom/dumpsoftwareversions/main.nf | 2 +- modules/nf-core/fastqc/main.nf | 8 +- modules/nf-core/multiqc/main.nf | 2 +- nextflow.config | 7 +- nextflow_schema.json | 15 -- workflows/viralrecon.nf | 1 + 21 files changed, 251 insertions(+), 76 deletions(-) create mode 100644 .github/workflows/release-announcments.yml diff --git a/.devcontainer/devcontainer.json b/.devcontainer/devcontainer.json index ea27a584..4ecfbfe3 100644 --- a/.devcontainer/devcontainer.json +++ b/.devcontainer/devcontainer.json @@ -2,6 +2,7 @@ "name": "nfcore", "image": "nfcore/gitpod:latest", "remoteUser": "gitpod", + "runArgs": ["--privileged"], // Configure tool-specific properties. "customizations": { diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md index 60ecfabd..0f5ab87b 100644 --- a/.github/CONTRIBUTING.md +++ b/.github/CONTRIBUTING.md @@ -9,7 +9,9 @@ Please use the pre-filled template to save time. However, don't be put off by this template - other more general issues and suggestions are welcome! Contributions to the code are even more welcome ;) -> If you need help using or modifying nf-core/viralrecon then the best place to ask is on the nf-core Slack [#viralrecon](https://nfcore.slack.com/channels/viralrecon) channel ([join our Slack here](https://nf-co.re/join/slack)). +:::info +If you need help using or modifying nf-core/viralrecon then the best place to ask is on the nf-core Slack [#viralrecon](https://nfcore.slack.com/channels/viralrecon) channel ([join our Slack here](https://nf-co.re/join/slack)). +::: ## Contribution workflow diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml index 888cb4bc..b8bdd214 100644 --- a/.github/workflows/linting.yml +++ b/.github/workflows/linting.yml @@ -78,7 +78,7 @@ jobs: - uses: actions/setup-python@v4 with: - python-version: "3.8" + python-version: "3.11" architecture: "x64" - name: Install dependencies diff --git a/.github/workflows/release-announcments.yml b/.github/workflows/release-announcments.yml new file mode 100644 index 00000000..6ad33927 --- /dev/null +++ b/.github/workflows/release-announcments.yml @@ -0,0 +1,68 @@ +name: release-announcements +# Automatic release toot and tweet anouncements +on: + release: + types: [published] + workflow_dispatch: + +jobs: + toot: + runs-on: ubuntu-latest + steps: + - uses: rzr/fediverse-action@master + with: + access-token: ${{ secrets.MASTODON_ACCESS_TOKEN }} + host: "mstdn.science" # custom host if not "mastodon.social" (default) + # GitHub event payload + # https://docs.github.com/en/developers/webhooks-and-events/webhooks/webhook-events-and-payloads#release + message: | + Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}! + + Please see the changelog: ${{ github.event.release.html_url }} + + send-tweet: + runs-on: ubuntu-latest + + steps: + - uses: actions/setup-python@v4 + with: + python-version: "3.10" + - name: Install dependencies + run: pip install tweepy==4.14.0 + - name: Send tweet + shell: python + run: | + import os + import tweepy + + client = tweepy.Client( + access_token=os.getenv("TWITTER_ACCESS_TOKEN"), + access_token_secret=os.getenv("TWITTER_ACCESS_TOKEN_SECRET"), + consumer_key=os.getenv("TWITTER_CONSUMER_KEY"), + consumer_secret=os.getenv("TWITTER_CONSUMER_SECRET"), + ) + tweet = os.getenv("TWEET") + client.create_tweet(text=tweet) + env: + TWEET: | + Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}! + + Please see the changelog: ${{ github.event.release.html_url }} + TWITTER_CONSUMER_KEY: ${{ secrets.TWITTER_CONSUMER_KEY }} + TWITTER_CONSUMER_SECRET: ${{ secrets.TWITTER_CONSUMER_SECRET }} + TWITTER_ACCESS_TOKEN: ${{ secrets.TWITTER_ACCESS_TOKEN }} + TWITTER_ACCESS_TOKEN_SECRET: ${{ secrets.TWITTER_ACCESS_TOKEN_SECRET }} + + bsky-post: + runs-on: ubuntu-latest + steps: + - uses: zentered/bluesky-post-action@v0.0.2 + with: + post: | + Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}! + + Please see the changelog: ${{ github.event.release.html_url }} + env: + BSKY_IDENTIFIER: ${{ secrets.BSKY_IDENTIFIER }} + BSKY_PASSWORD: ${{ secrets.BSKY_PASSWORD }} + # diff --git a/CITATIONS.md b/CITATIONS.md index 6b3ce78e..2f6badf1 100644 --- a/CITATIONS.md +++ b/CITATIONS.md @@ -12,7 +12,7 @@ - [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) - > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. Available online https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. + > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. - [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/) diff --git a/CODE_OF_CONDUCT.md b/CODE_OF_CONDUCT.md index f4fd052f..c089ec78 100644 --- a/CODE_OF_CONDUCT.md +++ b/CODE_OF_CONDUCT.md @@ -1,18 +1,20 @@ -# Code of Conduct at nf-core (v1.0) +# Code of Conduct at nf-core (v1.4) ## Our Pledge -In the interest of fostering an open, collaborative, and welcoming environment, we as contributors and maintainers of nf-core, pledge to making participation in our projects and community a harassment-free experience for everyone, regardless of: +In the interest of fostering an open, collaborative, and welcoming environment, we as contributors and maintainers of nf-core pledge to making participation in our projects and community a harassment-free experience for everyone, regardless of: - Age +- Ability - Body size +- Caste - Familial status - Gender identity and expression - Geographical location - Level of experience - Nationality and national origins - Native language -- Physical and neurological ability +- Neurodiversity - Race or ethnicity - Religion - Sexual identity and orientation @@ -22,80 +24,133 @@ Please note that the list above is alphabetised and is therefore not ranked in a ## Preamble -> Note: This Code of Conduct (CoC) has been drafted by the nf-core Safety Officer and been edited after input from members of the nf-core team and others. "We", in this document, refers to the Safety Officer and members of the nf-core core team, both of whom are deemed to be members of the nf-core community and are therefore required to abide by this Code of Conduct. This document will amended periodically to keep it up-to-date, and in case of any dispute, the most current version will apply. +:::note +This Code of Conduct (CoC) has been drafted by Renuka Kudva, Cris Tuñí, and Michael Heuer, with input from the nf-core Core Team and Susanna Marquez from the nf-core community. "We", in this document, refers to the Safety Officers and members of the nf-core Core Team, both of whom are deemed to be members of the nf-core community and are therefore required to abide by this Code of Conduct. This document will be amended periodically to keep it up-to-date. In case of any dispute, the most current version will apply. +::: -An up-to-date list of members of the nf-core core team can be found [here](https://nf-co.re/about). Our current safety officer is Renuka Kudva. +An up-to-date list of members of the nf-core core team can be found [here](https://nf-co.re/about). + +Our Safety Officers are Saba Nafees, Cris Tuñí, and Michael Heuer. nf-core is a young and growing community that welcomes contributions from anyone with a shared vision for [Open Science Policies](https://www.fosteropenscience.eu/taxonomy/term/8). Open science policies encompass inclusive behaviours and we strive to build and maintain a safe and inclusive environment for all individuals. -We have therefore adopted this code of conduct (CoC), which we require all members of our community and attendees in nf-core events to adhere to in all our workspaces at all times. Workspaces include but are not limited to Slack, meetings on Zoom, Jitsi, YouTube live etc. +We have therefore adopted this CoC, which we require all members of our community and attendees of nf-core events to adhere to in all our workspaces at all times. Workspaces include, but are not limited to, Slack, meetings on Zoom, gather.town, YouTube live etc. -Our CoC will be strictly enforced and the nf-core team reserve the right to exclude participants who do not comply with our guidelines from our workspaces and future nf-core activities. +Our CoC will be strictly enforced and the nf-core team reserves the right to exclude participants who do not comply with our guidelines from our workspaces and future nf-core activities. -We ask all members of our community to help maintain a supportive and productive workspace and to avoid behaviours that can make individuals feel unsafe or unwelcome. Please help us maintain and uphold this CoC. +We ask all members of our community to help maintain supportive and productive workspaces and to avoid behaviours that can make individuals feel unsafe or unwelcome. Please help us maintain and uphold this CoC. -Questions, concerns or ideas on what we can include? Contact safety [at] nf-co [dot] re +Questions, concerns, or ideas on what we can include? Contact members of the Safety Team on Slack or email safety [at] nf-co [dot] re. ## Our Responsibilities -The safety officer is responsible for clarifying the standards of acceptable behavior and are expected to take appropriate and fair corrective action in response to any instances of unacceptable behaviour. +Members of the Safety Team (the Safety Officers) are responsible for clarifying the standards of acceptable behavior and are expected to take appropriate and fair corrective action in response to any instances of unacceptable behaviour. -The safety officer in consultation with the nf-core core team have the right and responsibility to remove, edit, or reject comments, commits, code, wiki edits, issues, and other contributions that are not aligned to this Code of Conduct, or to ban temporarily or permanently any contributor for other behaviors that they deem inappropriate, threatening, offensive, or harmful. +The Safety Team, in consultation with the nf-core core team, have the right and responsibility to remove, edit, or reject comments, commits, code, wiki edits, issues, and other contributions that are not aligned to this CoC, or to ban temporarily or permanently any contributor for other behaviors that they deem inappropriate, threatening, offensive, or harmful. -Members of the core team or the safety officer who violate the CoC will be required to recuse themselves pending investigation. They will not have access to any reports of the violations and be subject to the same actions as others in violation of the CoC. +Members of the core team or the Safety Team who violate the CoC will be required to recuse themselves pending investigation. They will not have access to any reports of the violations and will be subject to the same actions as others in violation of the CoC. -## When are where does this Code of Conduct apply? +## When and where does this Code of Conduct apply? -Participation in the nf-core community is contingent on following these guidelines in all our workspaces and events. This includes but is not limited to the following listed alphabetically and therefore in no order of preference: +Participation in the nf-core community is contingent on following these guidelines in all our workspaces and events, such as hackathons, workshops, bytesize, and collaborative workspaces on gather.town. These guidelines include, but are not limited to, the following (listed alphabetically and therefore in no order of preference): - Communicating with an official project email address. - Communicating with community members within the nf-core Slack channel. - Participating in hackathons organised by nf-core (both online and in-person events). -- Participating in collaborative work on GitHub, Google Suite, community calls, mentorship meetings, email correspondence. -- Participating in workshops, training, and seminar series organised by nf-core (both online and in-person events). This applies to events hosted on web-based platforms such as Zoom, Jitsi, YouTube live etc. +- Participating in collaborative work on GitHub, Google Suite, community calls, mentorship meetings, email correspondence, and on the nf-core gather.town workspace. +- Participating in workshops, training, and seminar series organised by nf-core (both online and in-person events). This applies to events hosted on web-based platforms such as Zoom, gather.town, Jitsi, YouTube live etc. - Representing nf-core on social media. This includes both official and personal accounts. ## nf-core cares 😊 -nf-core's CoC and expectations of respectful behaviours for all participants (including organisers and the nf-core team) include but are not limited to the following (listed in alphabetical order): +nf-core's CoC and expectations of respectful behaviours for all participants (including organisers and the nf-core team) include, but are not limited to, the following (listed in alphabetical order): - Ask for consent before sharing another community member’s personal information (including photographs) on social media. - Be respectful of differing viewpoints and experiences. We are all here to learn from one another and a difference in opinion can present a good learning opportunity. -- Celebrate your accomplishments at events! (Get creative with your use of emojis 🎉 🥳 💯 🙌 !) +- Celebrate your accomplishments! (Get creative with your use of emojis 🎉 🥳 💯 🙌 !) - Demonstrate empathy towards other community members. (We don’t all have the same amount of time to dedicate to nf-core. If tasks are pending, don’t hesitate to gently remind members of your team. If you are leading a task, ask for help if you feel overwhelmed.) - Engage with and enquire after others. (This is especially important given the geographically remote nature of the nf-core community, so let’s do this the best we can) - Focus on what is best for the team and the community. (When in doubt, ask) -- Graciously accept constructive criticism, yet be unafraid to question, deliberate, and learn. +- Accept feedback, yet be unafraid to question, deliberate, and learn. - Introduce yourself to members of the community. (We’ve all been outsiders and we know that talking to strangers can be hard for some, but remember we’re interested in getting to know you and your visions for open science!) -- Show appreciation and **provide clear feedback**. (This is especially important because we don’t see each other in person and it can be harder to interpret subtleties. Also remember that not everyone understands a certain language to the same extent as you do, so **be clear in your communications to be kind.**) +- Show appreciation and **provide clear feedback**. (This is especially important because we don’t see each other in person and it can be harder to interpret subtleties. Also remember that not everyone understands a certain language to the same extent as you do, so **be clear in your communication to be kind.**) - Take breaks when you feel like you need them. -- Using welcoming and inclusive language. (Participants are encouraged to display their chosen pronouns on Zoom or in communication on Slack.) +- Use welcoming and inclusive language. (Participants are encouraged to display their chosen pronouns on Zoom or in communication on Slack) ## nf-core frowns on 😕 -The following behaviours from any participants within the nf-core community (including the organisers) will be considered unacceptable under this code of conduct. Engaging or advocating for any of the following could result in expulsion from nf-core workspaces. +The following behaviours from any participants within the nf-core community (including the organisers) will be considered unacceptable under this CoC. Engaging or advocating for any of the following could result in expulsion from nf-core workspaces: - Deliberate intimidation, stalking or following and sustained disruption of communication among participants of the community. This includes hijacking shared screens through actions such as using the annotate tool in conferencing software such as Zoom. - “Doxing” i.e. posting (or threatening to post) another person’s personal identifying information online. - Spamming or trolling of individuals on social media. -- Use of sexual or discriminatory imagery, comments, or jokes and unwelcome sexual attention. -- Verbal and text comments that reinforce social structures of domination related to gender, gender identity and expression, sexual orientation, ability, physical appearance, body size, race, age, religion or work experience. +- Use of sexual or discriminatory imagery, comments, jokes, or unwelcome sexual attention. +- Verbal and text comments that reinforce social structures of domination related to gender, gender identity and expression, sexual orientation, ability, physical appearance, body size, race, age, religion, or work experience. ### Online Trolling -The majority of nf-core interactions and events are held online. Unfortunately, holding events online comes with the added issue of online trolling. This is unacceptable, reports of such behaviour will be taken very seriously, and perpetrators will be excluded from activities immediately. +The majority of nf-core interactions and events are held online. Unfortunately, holding events online comes with the risk of online trolling. This is unacceptable — reports of such behaviour will be taken very seriously and perpetrators will be excluded from activities immediately. -All community members are required to ask members of the group they are working within for explicit consent prior to taking screenshots of individuals during video calls. +All community members are **required** to ask members of the group they are working with for explicit consent prior to taking screenshots of individuals during video calls. -## Procedures for Reporting CoC violations +## Procedures for reporting CoC violations If someone makes you feel uncomfortable through their behaviours or actions, report it as soon as possible. -You can reach out to members of the [nf-core core team](https://nf-co.re/about) and they will forward your concerns to the safety officer(s). +You can reach out to members of the Safety Team (Saba Nafees, Cris Tuñí, and Michael Heuer) on Slack. Alternatively, contact a member of the nf-core core team [nf-core core team](https://nf-co.re/about), and they will forward your concerns to the Safety Team. + +Issues directly concerning members of the Core Team or the Safety Team will be dealt with by other members of the core team and the safety manager — possible conflicts of interest will be taken into account. nf-core is also in discussions about having an ombudsperson and details will be shared in due course. + +All reports will be handled with the utmost discretion and confidentiality. + +You can also report any CoC violations to safety [at] nf-co [dot] re. In your email report, please do your best to include: + +- Your contact information. +- Identifying information (e.g. names, nicknames, pseudonyms) of the participant who has violated the Code of Conduct. +- The behaviour that was in violation and the circumstances surrounding the incident. +- The approximate time of the behaviour (if different than the time the report was made). +- Other people involved in the incident, if applicable. +- If you believe the incident is ongoing. +- If there is a publicly available record (e.g. mailing list record, a screenshot). +- Any additional information. + +After you file a report, one or more members of our Safety Team will contact you to follow up on your report. + +## Who will read and handle reports + +All reports will be read and handled by the members of the Safety Team at nf-core. + +If members of the Safety Team are deemed to have a conflict of interest with a report, they will be required to recuse themselves as per our Code of Conduct and will not have access to any follow-ups. + +To keep this first report confidential from any of the Safety Team members, please submit your first report by direct messaging on Slack/direct email to any of the nf-core members you are comfortable disclosing the information to, and be explicit about which member(s) you do not consent to sharing the information with. + +## Reviewing reports + +After receiving the report, members of the Safety Team will review the incident report to determine whether immediate action is required, for example, whether there is immediate threat to participants’ safety. + +The Safety Team, in consultation with members of the nf-core core team, will assess the information to determine whether the report constitutes a Code of Conduct violation, for them to decide on a course of action. + +In the case of insufficient information, one or more members of the Safety Team may contact the reporter, the reportee, or any other attendees to obtain more information. -Issues directly concerning members of the core team will be dealt with by other members of the core team and the safety manager, and possible conflicts of interest will be taken into account. nf-core is also in discussions about having an ombudsperson, and details will be shared in due course. +Once additional information is gathered, the Safety Team will collectively review and decide on the best course of action to take, if any. The Safety Team reserves the right to not act on a report. -All reports will be handled with utmost discretion and confidentially. +## Confidentiality + +All reports, and any additional information included, are only shared with the team of safety officers (and possibly members of the core team, in case the safety officer is in violation of the CoC). We will respect confidentiality requests for the purpose of protecting victims of abuse. + +We will not name harassment victims, beyond discussions between the safety officer and members of the nf-core team, without the explicit consent of the individuals involved. + +## Enforcement + +Actions taken by the nf-core’s Safety Team may include, but are not limited to: + +- Asking anyone to stop a behaviour. +- Asking anyone to leave the event and online spaces either temporarily, for the remainder of the event, or permanently. +- Removing access to the gather.town and Slack, either temporarily or permanently. +- Communicating to all participants to reinforce our expectations for conduct and remind what is unacceptable behaviour; this may be public for practical reasons. +- Communicating to all participants that an incident has taken place and how we will act or have acted — this may be for the purpose of letting event participants know we are aware of and dealing with the incident. +- Banning anyone from participating in nf-core-managed spaces, future events, and activities, either temporarily or permanently. +- No action. ## Attribution and Acknowledgements @@ -106,6 +161,22 @@ All reports will be handled with utmost discretion and confidentially. ## Changelog -### v1.0 - March 12th, 2021 +### v1.4 - February 8th, 2022 + +- Included a new member of the Safety Team. Corrected a typographical error in the text. + +### v1.3 - December 10th, 2021 + +- Added a statement that the CoC applies to nf-core gather.town workspaces. Corrected typographical errors in the text. + +### v1.2 - November 12th, 2021 + +- Removed information specific to reporting CoC violations at the Hackathon in October 2021. + +### v1.1 - October 14th, 2021 + +- Updated with names of new Safety Officers and specific information for the hackathon in October 2021. + +### v1.0 - March 15th, 2021 - Complete rewrite from original [Contributor Covenant](http://contributor-covenant.org/) CoC. diff --git a/README.md b/README.md index af8cbb4a..f0dfb41f 100644 --- a/README.md +++ b/README.md @@ -1,6 +1,7 @@ # ![nf-core/viralrecon](docs/images/nf-core-viralrecon_logo_light.png#gh-light-mode-only) ![nf-core/viralrecon](docs/images/nf-core-viralrecon_logo_dark.png#gh-dark-mode-only) -[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/viralrecon/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX) +[![GitHub Actions CI Status](https://github.com/nf-core/viralrecon/workflows/nf-core%20CI/badge.svg)](https://github.com/nf-core/viralrecon/actions?query=workflow%3A%22nf-core+CI%22) +[![GitHub Actions Linting Status](https://github.com/nf-core/viralrecon/workflows/nf-core%20linting/badge.svg)](https://github.com/nf-core/viralrecon/actions?query=workflow%3A%22nf-core+linting%22)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/viralrecon/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX) [![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A523.04.0-23aa62.svg)](https://www.nextflow.io/) [![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/) @@ -29,10 +30,11 @@ ## Usage -> **Note** -> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how -> to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) -> with `-profile test` before running the workflow on actual data. +:::note +If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how +to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) +with `-profile test` before running the workflow on actual data. +::: - + diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml index 1f72bc4a..81691534 100644 --- a/assets/multiqc_config.yml +++ b/assets/multiqc_config.yml @@ -1,5 +1,5 @@ report_comment: > - This report has been generated by the nf-core/viralrecon + This report has been generated by the nf-core/viralrecon analysis pipeline. For information about how to interpret these results, please see the documentation. report_section_order: diff --git a/assets/slackreport.json b/assets/slackreport.json index 0301397d..8e3fa24d 100644 --- a/assets/slackreport.json +++ b/assets/slackreport.json @@ -3,7 +3,7 @@ { "fallback": "Plain-text summary of the attachment.", "color": "<% if (success) { %>good<% } else { %>danger<%} %>", - "author_name": "nf-core/viralrecon v${version} - ${runName}", + "author_name": "nf-core/viralrecon ${version} - ${runName}", "author_icon": "https://www.nextflow.io/docs/latest/_static/favicon.ico", "text": "<% if (success) { %>Pipeline completed successfully!<% } else { %>Pipeline completed with errors<% } %>", "fields": [ diff --git a/conf/modules.config b/conf/modules.config index 39e81386..d91c6aba 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -39,7 +39,7 @@ process { } withName: 'MULTIQC' { - ext.args = params.multiqc_title ? "--title \"$params.multiqc_title\"" : '' + ext.args = { params.multiqc_title ? "--title \"$params.multiqc_title\"" : '' } publishDir = [ path: { "${params.outdir}/multiqc" }, mode: params.publish_dir_mode, diff --git a/docs/usage.md b/docs/usage.md index 38a631cb..971db3da 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -20,7 +20,7 @@ You will need to create a samplesheet with information about the samples you wou The `sample` identifiers have to be the same when you have re-sequenced the same sample more than once e.g. to increase sequencing depth. The pipeline will concatenate the raw reads before performing any downstream analysis. Below is an example for the same sample sequenced across 3 lanes: -```console +```csv title="samplesheet.csv" sample,fastq_1,fastq_2 CONTROL_REP1,AEG588A1_S1_L002_R1_001.fastq.gz,AEG588A1_S1_L002_R2_001.fastq.gz CONTROL_REP1,AEG588A1_S1_L003_R1_001.fastq.gz,AEG588A1_S1_L003_R2_001.fastq.gz @@ -33,7 +33,7 @@ The pipeline will auto-detect whether a sample is single- or paired-end using th A final samplesheet file consisting of both single- and paired-end data may look something like the one below. This is for 6 samples, where `TREATMENT_REP3` has been sequenced twice. -```console +```csv title="samplesheet.csv" sample,fastq_1,fastq_2 CONTROL_REP1,AEG588A1_S1_L002_R1_001.fastq.gz,AEG588A1_S1_L002_R2_001.fastq.gz CONTROL_REP2,AEG588A2_S2_L002_R1_001.fastq.gz,AEG588A2_S2_L002_R2_001.fastq.gz diff --git a/lib/NfcoreTemplate.groovy b/lib/NfcoreTemplate.groovy index 01b8653d..e248e4c3 100755 --- a/lib/NfcoreTemplate.groovy +++ b/lib/NfcoreTemplate.groovy @@ -4,6 +4,7 @@ import org.yaml.snakeyaml.Yaml import groovy.json.JsonOutput +import nextflow.extension.FilesEx class NfcoreTemplate { @@ -141,12 +142,14 @@ class NfcoreTemplate { try { if (params.plaintext_email) { throw GroovyException('Send plaintext e-mail, not HTML') } // Try to send HTML e-mail using sendmail + def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html") + sendmail_tf.withWriter { w -> w << sendmail_html } [ 'sendmail', '-t' ].execute() << sendmail_html log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (sendmail)-" } catch (all) { // Catch failures and try with plaintext def mail_cmd = [ 'mail', '-s', subject, '--content-type=text/html', email_address ] - if ( mqc_report.size() <= max_multiqc_email_size.toBytes() ) { + if ( mqc_report != null && mqc_report.size() <= max_multiqc_email_size.toBytes() ) { mail_cmd += [ '-A', mqc_report ] } mail_cmd.execute() << email_html @@ -155,14 +158,16 @@ class NfcoreTemplate { } // Write summary e-mail HTML to a file - def output_d = new File("${params.outdir}/pipeline_info/") - if (!output_d.exists()) { - output_d.mkdirs() - } - def output_hf = new File(output_d, "pipeline_report.html") + def output_hf = new File(workflow.launchDir.toString(), ".pipeline_report.html") output_hf.withWriter { w -> w << email_html } - def output_tf = new File(output_d, "pipeline_report.txt") + FilesEx.copyTo(output_hf.toPath(), "${params.outdir}/pipeline_info/pipeline_report.html"); + output_hf.delete() + + // Write summary e-mail TXT to a file + def output_tf = new File(workflow.launchDir.toString(), ".pipeline_report.txt") output_tf.withWriter { w -> w << email_txt } + FilesEx.copyTo(output_tf.toPath(), "${params.outdir}/pipeline_info/pipeline_report.txt"); + output_tf.delete() } // @@ -227,15 +232,14 @@ class NfcoreTemplate { // Dump pipeline parameters in a json file // public static void dump_parameters(workflow, params) { - def output_d = new File("${params.outdir}/pipeline_info/") - if (!output_d.exists()) { - output_d.mkdirs() - } - def timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') - def output_pf = new File(output_d, "params_${timestamp}.json") + def filename = "params_${timestamp}.json" + def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") def jsonStr = JsonOutput.toJson(params) - output_pf.text = JsonOutput.prettyPrint(jsonStr) + temp_pf.text = JsonOutput.prettyPrint(jsonStr) + + FilesEx.copyTo(temp_pf.toPath(), "${params.outdir}/pipeline_info/params_${timestamp}.json") + temp_pf.delete() } // diff --git a/modules.json b/modules.json index 4c684b64..54683237 100644 --- a/modules.json +++ b/modules.json @@ -7,17 +7,17 @@ "nf-core": { "custom/dumpsoftwareversions": { "branch": "master", - "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", + "git_sha": "bba7e362e4afead70653f84d8700588ea28d0f9e", "installed_by": ["modules"] }, "fastqc": { "branch": "master", - "git_sha": "bd8092b67b5103bdd52e300f75889442275c3117", + "git_sha": "65ad3e0b9a4099592e1102e92e10455dc661cf53", "installed_by": ["modules"] }, "multiqc": { "branch": "master", - "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", + "git_sha": "4ab13872435962dadc239979554d13709e20bf29", "installed_by": ["modules"] } } diff --git a/modules/nf-core/custom/dumpsoftwareversions/environment.yml b/modules/nf-core/custom/dumpsoftwareversions/environment.yml new file mode 100644 index 00000000..f0c63f69 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/environment.yml @@ -0,0 +1,7 @@ +name: custom_dumpsoftwareversions +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::multiqc=1.17 diff --git a/modules/nf-core/custom/dumpsoftwareversions/main.nf b/modules/nf-core/custom/dumpsoftwareversions/main.nf index ebc87273..7685b33c 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/main.nf +++ b/modules/nf-core/custom/dumpsoftwareversions/main.nf @@ -2,10 +2,10 @@ process CUSTOM_DUMPSOFTWAREVERSIONS { label 'process_single' // Requires `pyyaml` which does not have a dedicated container but is in the MultiQC container - conda "bioconda::multiqc=1.14" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.14--pyhdfd78af_0' : - 'biocontainers/multiqc:1.14--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.17--pyhdfd78af_0' : + 'biocontainers/multiqc:1.17--pyhdfd78af_0' }" input: path versions diff --git a/modules/nf-core/custom/dumpsoftwareversions/meta.yml b/modules/nf-core/custom/dumpsoftwareversions/meta.yml index c32657de..5f15a5fd 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/meta.yml +++ b/modules/nf-core/custom/dumpsoftwareversions/meta.yml @@ -1,4 +1,4 @@ -# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/yaml-schema.json +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json name: custom_dumpsoftwareversions description: Custom module used to dump software versions within the nf-core pipeline template keywords: @@ -16,7 +16,6 @@ input: type: file description: YML file containing software versions pattern: "*.yml" - output: - yml: type: file @@ -30,7 +29,9 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@drpatelh" - "@grst" +maintainers: + - "@drpatelh" + - "@grst" diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test new file mode 100644 index 00000000..eec1db10 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test @@ -0,0 +1,38 @@ +nextflow_process { + + name "Test Process CUSTOM_DUMPSOFTWAREVERSIONS" + script "../main.nf" + process "CUSTOM_DUMPSOFTWAREVERSIONS" + tag "modules" + tag "modules_nfcore" + tag "custom" + tag "dumpsoftwareversions" + tag "custom/dumpsoftwareversions" + + test("Should run without failures") { + when { + process { + """ + def tool1_version = ''' + TOOL1: + tool1: 0.11.9 + '''.stripIndent() + + def tool2_version = ''' + TOOL2: + tool2: 1.9 + '''.stripIndent() + + input[0] = Channel.of(tool1_version, tool2_version).collectFile() + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap new file mode 100644 index 00000000..4274ed57 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap @@ -0,0 +1,27 @@ +{ + "Should run without failures": { + "content": [ + { + "0": [ + "software_versions.yml:md5,1c851188476409cda5752ce971b20b58" + ], + "1": [ + "software_versions_mqc.yml:md5,2570f4ba271ad08357b0d3d32a9cf84d" + ], + "2": [ + "versions.yml:md5,3843ac526e762117eedf8825b40683df" + ], + "mqc_yml": [ + "software_versions_mqc.yml:md5,2570f4ba271ad08357b0d3d32a9cf84d" + ], + "versions": [ + "versions.yml:md5,3843ac526e762117eedf8825b40683df" + ], + "yml": [ + "software_versions.yml:md5,1c851188476409cda5752ce971b20b58" + ] + } + ], + "timestamp": "2023-11-03T14:43:22.157011" + } +} diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml new file mode 100644 index 00000000..405aa24a --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml @@ -0,0 +1,2 @@ +custom/dumpsoftwareversions: + - modules/nf-core/custom/dumpsoftwareversions/** diff --git a/modules/nf-core/fastqc/environment.yml b/modules/nf-core/fastqc/environment.yml new file mode 100644 index 00000000..1787b38a --- /dev/null +++ b/modules/nf-core/fastqc/environment.yml @@ -0,0 +1,7 @@ +name: fastqc +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::fastqc=0.12.1 diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf index 249f9064..9e19a74c 100644 --- a/modules/nf-core/fastqc/main.nf +++ b/modules/nf-core/fastqc/main.nf @@ -2,10 +2,10 @@ process FASTQC { tag "$meta.id" label 'process_medium' - conda "bioconda::fastqc=0.11.9" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/fastqc:0.11.9--0' : - 'biocontainers/fastqc:0.11.9--0' }" + 'https://depot.galaxyproject.org/singularity/fastqc:0.12.1--hdfd78af_0' : + 'biocontainers/fastqc:0.12.1--hdfd78af_0' }" input: tuple val(meta), path(reads) @@ -37,7 +37,7 @@ process FASTQC { cat <<-END_VERSIONS > versions.yml "${task.process}": - fastqc: \$( fastqc --version | sed -e "s/FastQC v//g" ) + fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' ) END_VERSIONS """ @@ -49,7 +49,7 @@ process FASTQC { cat <<-END_VERSIONS > versions.yml "${task.process}": - fastqc: \$( fastqc --version | sed -e "s/FastQC v//g" ) + fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' ) END_VERSIONS """ } diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml index 4da5bb5a..ee5507e0 100644 --- a/modules/nf-core/fastqc/meta.yml +++ b/modules/nf-core/fastqc/meta.yml @@ -50,3 +50,8 @@ authors: - "@grst" - "@ewels" - "@FelixKrueger" +maintainers: + - "@drpatelh" + - "@grst" + - "@ewels" + - "@FelixKrueger" diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test new file mode 100644 index 00000000..b9e8f926 --- /dev/null +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -0,0 +1,109 @@ +nextflow_process { + + name "Test Process FASTQC" + script "../main.nf" + process "FASTQC" + tag "modules" + tag "modules_nfcore" + tag "fastqc" + + test("Single-Read") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id: 'test', single_end:true ], + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. + // looks like this:
Mon 2 Oct 2023
test.gz
+ // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 + { assert process.out.html.get(0).get(1) ==~ ".*/test_fastqc.html" }, + { assert path(process.out.html.get(0).get(1)).getText().contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match("versions") }, + { assert process.out.zip.get(0).get(1) ==~ ".*/test_fastqc.zip" } + ) + } + } +// TODO +// // +// // Test with paired-end data +// // +// workflow test_fastqc_paired_end { +// input = [ +// [id: 'test', single_end: false], // meta map +// [ +// file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), +// file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) +// ] +// ] + +// FASTQC ( input ) +// } + +// // +// // Test with interleaved data +// // +// workflow test_fastqc_interleaved { +// input = [ +// [id: 'test', single_end: false], // meta map +// file(params.test_data['sarscov2']['illumina']['test_interleaved_fastq_gz'], checkIfExists: true) +// ] + +// FASTQC ( input ) +// } + +// // +// // Test with bam data +// // +// workflow test_fastqc_bam { +// input = [ +// [id: 'test', single_end: false], // meta map +// file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) +// ] + +// FASTQC ( input ) +// } + +// // +// // Test with multiple samples +// // +// workflow test_fastqc_multiple { +// input = [ +// [id: 'test', single_end: false], // meta map +// [ +// file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), +// file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true), +// file(params.test_data['sarscov2']['illumina']['test2_1_fastq_gz'], checkIfExists: true), +// file(params.test_data['sarscov2']['illumina']['test2_2_fastq_gz'], checkIfExists: true) +// ] +// ] + +// FASTQC ( input ) +// } + +// // +// // Test with custom prefix +// // +// workflow test_fastqc_custom_prefix { +// input = [ +// [ id:'mysample', single_end:true ], // meta map +// file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) +// ] + +// FASTQC ( input ) +// } +} diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap new file mode 100644 index 00000000..636a32ce --- /dev/null +++ b/modules/nf-core/fastqc/tests/main.nf.test.snap @@ -0,0 +1,10 @@ +{ + "versions": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "timestamp": "2023-10-09T23:40:54+0000" + } +} \ No newline at end of file diff --git a/modules/nf-core/fastqc/tests/tags.yml b/modules/nf-core/fastqc/tests/tags.yml new file mode 100644 index 00000000..7834294b --- /dev/null +++ b/modules/nf-core/fastqc/tests/tags.yml @@ -0,0 +1,2 @@ +fastqc: + - modules/nf-core/fastqc/** diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml new file mode 100644 index 00000000..bc0bdb5b --- /dev/null +++ b/modules/nf-core/multiqc/environment.yml @@ -0,0 +1,7 @@ +name: multiqc +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::multiqc=1.18 diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index 1fc387be..00cc48d2 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -1,10 +1,10 @@ process MULTIQC { label 'process_single' - conda "bioconda::multiqc=1.14" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.14--pyhdfd78af_0' : - 'biocontainers/multiqc:1.14--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.18--pyhdfd78af_0' : + 'biocontainers/multiqc:1.18--pyhdfd78af_0' }" input: path multiqc_files, stageAs: "?/*" @@ -25,12 +25,14 @@ process MULTIQC { def args = task.ext.args ?: '' def config = multiqc_config ? "--config $multiqc_config" : '' def extra_config = extra_multiqc_config ? "--config $extra_multiqc_config" : '' + def logo = multiqc_logo ? /--cl-config 'custom_logo: "${multiqc_logo}"'/ : '' """ multiqc \\ --force \\ $args \\ $config \\ $extra_config \\ + $logo \\ . cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/multiqc/meta.yml b/modules/nf-core/multiqc/meta.yml index f93b5ee5..f1aa660e 100644 --- a/modules/nf-core/multiqc/meta.yml +++ b/modules/nf-core/multiqc/meta.yml @@ -1,5 +1,5 @@ -# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/yaml-schema.json -name: MultiQC +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json +name: multiqc description: Aggregate results from bioinformatics analyses across many samples into a single report keywords: - QC @@ -13,7 +13,6 @@ tools: homepage: https://multiqc.info/ documentation: https://multiqc.info/docs/ licence: ["GPL-3.0-or-later"] - input: - multiqc_files: type: file @@ -31,7 +30,6 @@ input: type: file description: Optional logo file for MultiQC pattern: "*.{png}" - output: - report: type: file @@ -54,3 +52,8 @@ authors: - "@bunop" - "@drpatelh" - "@jfy133" +maintainers: + - "@abhi18av" + - "@bunop" + - "@drpatelh" + - "@jfy133" diff --git a/modules/nf-core/multiqc/tests/main.nf.test b/modules/nf-core/multiqc/tests/main.nf.test new file mode 100644 index 00000000..c2dad217 --- /dev/null +++ b/modules/nf-core/multiqc/tests/main.nf.test @@ -0,0 +1,63 @@ +nextflow_process { + + name "Test Process MULTIQC" + script "../main.nf" + process "MULTIQC" + tag "modules" + tag "modules_nfcore" + tag "multiqc" + + test("MULTIQC: FASTQC") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz_fastqc_zip'], checkIfExists: true)]) + input[1] = [] + input[2] = [] + input[3] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.report.get(0)).exists() }, + { assert path(process.out.data.get(0)).exists() }, + { assert path(process.out.versions.get(0)).getText().contains("multiqc") } + ) + } + + } + + test("MULTIQC: FASTQC and a config file") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz_fastqc_zip'], checkIfExists: true)]) + input[1] = Channel.of(file("https://github.com/nf-core/tools/raw/dev/nf_core/pipeline-template/assets/multiqc_config.yml", checkIfExists: true)) + input[2] = [] + input[3] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.report.get(0)).exists() }, + { assert path(process.out.data.get(0)).exists() }, + { assert path(process.out.versions.get(0)).getText().contains("multiqc") } + ) + } + + } +} diff --git a/modules/nf-core/multiqc/tests/tags.yml b/modules/nf-core/multiqc/tests/tags.yml new file mode 100644 index 00000000..bea6c0d3 --- /dev/null +++ b/modules/nf-core/multiqc/tests/tags.yml @@ -0,0 +1,2 @@ +multiqc: + - modules/nf-core/multiqc/** diff --git a/nextflow.config b/nextflow.config index 6a499fb3..33ba5afb 100644 --- a/nextflow.config +++ b/nextflow.config @@ -14,7 +14,7 @@ params { input = null // References genome = null - igenomes_base = 's3://ngi-igenomes/igenomes' + igenomes_base = 's3://ngi-igenomes/igenomes/' igenomes_ignore = false @@ -82,6 +82,7 @@ profiles { dumpHashes = true process.beforeScript = 'echo $HOSTNAME' cleanup = false + nextflow.enable.configProcessNamesValidation = true } conda { conda.enabled = true @@ -104,13 +105,13 @@ profiles { } docker { docker.enabled = true - docker.userEmulation = true conda.enabled = false singularity.enabled = false podman.enabled = false shifter.enabled = false charliecloud.enabled = false apptainer.enabled = false + runOptions = '-u $(id -u):$(id -g)' } arm { docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64' @@ -181,7 +182,7 @@ singularity.registry = 'quay.io' // Nextflow plugins plugins { - id 'nf-validation' // Validation of pipeline parameters and creation of an input channel from a sample sheet + id 'nf-validation@1.1.3' // Validation of pipeline parameters and creation of an input channel from a sample sheet } // Load igenomes.config if required @@ -204,6 +205,9 @@ env { // Capture exit codes from upstream processes when piping process.shell = ['/bin/bash', '-euo', 'pipefail'] +// Disable process selector warnings by default. Use debug profile to enable warnings. +nextflow.enable.configProcessNamesValidation = false + def trace_timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') timeline { enabled = true From 20dc34d416a2a1355fd769e65e9c56a6af2c78d0 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Sara=20Monz=C3=B3n?= Date: Tue, 19 Dec 2023 20:20:40 +0100 Subject: [PATCH 18/45] updated modules --- modules.json | 123 +- modules/nf-core/abacas/environment.yml | 7 + modules/nf-core/abacas/main.nf | 4 +- modules/nf-core/abacas/meta.yml | 10 +- modules/nf-core/abacas/tests/main.nf.test | 46 + .../nf-core/abacas/tests/main.nf.test.snap | 24 + modules/nf-core/abacas/tests/nextflow.config | 9 + modules/nf-core/abacas/tests/tags.yml | 2 + .../nf-core/artic/guppyplex/environment.yml | 7 + modules/nf-core/artic/guppyplex/main.nf | 4 +- modules/nf-core/artic/guppyplex/meta.yml | 7 +- modules/nf-core/artic/minion/environment.yml | 7 + modules/nf-core/artic/minion/main.nf | 4 +- modules/nf-core/artic/minion/meta.yml | 5 +- modules/nf-core/bandage/image/environment.yml | 7 + modules/nf-core/bandage/image/main.nf | 4 +- modules/nf-core/bandage/image/meta.yml | 2 + .../bcftools/consensus/environment.yml | 7 + modules/nf-core/bcftools/consensus/main.nf | 6 +- modules/nf-core/bcftools/consensus/meta.yml | 3 + .../nf-core/bcftools/filter/environment.yml | 7 + modules/nf-core/bcftools/filter/main.nf | 32 +- modules/nf-core/bcftools/filter/meta.yml | 3 + .../nf-core/bcftools/mpileup/environment.yml | 7 + modules/nf-core/bcftools/mpileup/main.nf | 8 +- modules/nf-core/bcftools/mpileup/meta.yml | 7 + .../bcftools/mpileup/tests/main.nf.test | 116 ++ .../bcftools/mpileup/tests/main.nf.test.snap | 112 ++ .../bcftools/mpileup/tests/nextflow.config | 4 + .../nf-core/bcftools/mpileup/tests/tags.yml | 2 + modules/nf-core/bcftools/norm/environment.yml | 7 + modules/nf-core/bcftools/norm/main.nf | 8 +- modules/nf-core/bcftools/norm/meta.yml | 9 + .../nf-core/bcftools/query/environment.yml | 7 + modules/nf-core/bcftools/query/main.nf | 29 +- modules/nf-core/bcftools/query/meta.yml | 6 +- .../nf-core/bcftools/query/tests/main.nf.test | 101 ++ .../bcftools/query/tests/main.nf.test.snap | 43 + .../bcftools/query/tests/nextflow.config | 3 + modules/nf-core/bcftools/query/tests/tags.yml | 2 + modules/nf-core/bcftools/sort/environment.yml | 7 + modules/nf-core/bcftools/sort/main.nf | 7 +- modules/nf-core/bcftools/sort/meta.yml | 5 +- .../nf-core/bcftools/stats/environment.yml | 7 + modules/nf-core/bcftools/stats/main.nf | 20 +- modules/nf-core/bcftools/stats/meta.yml | 16 + .../nf-core/bedtools/getfasta/environment.yml | 7 + modules/nf-core/bedtools/getfasta/main.nf | 6 +- modules/nf-core/bedtools/getfasta/meta.yml | 4 +- .../bedtools/maskfasta/environment.yml | 7 + modules/nf-core/bedtools/maskfasta/main.nf | 6 +- modules/nf-core/bedtools/maskfasta/meta.yml | 4 +- .../nf-core/bedtools/merge/environment.yml | 7 + modules/nf-core/bedtools/merge/main.nf | 17 +- modules/nf-core/bedtools/merge/meta.yml | 6 + modules/nf-core/blast/blastn/environment.yml | 7 + modules/nf-core/blast/blastn/main.nf | 44 +- modules/nf-core/blast/blastn/meta.yml | 20 +- .../nf-core/blast/blastn/tests/main.nf.test | 71 + .../blast/blastn/tests/main.nf.test.snap | 18 + .../blast/blastn/tests/nextflow.config | 5 + modules/nf-core/blast/blastn/tests/tags.yml | 2 + .../nf-core/blast/makeblastdb/environment.yml | 7 + modules/nf-core/blast/makeblastdb/main.nf | 54 +- modules/nf-core/blast/makeblastdb/meta.yml | 16 +- .../blast/makeblastdb/tests/main.nf.test | 92 ++ .../blast/makeblastdb/tests/main.nf.test.snap | 86 ++ .../blast/makeblastdb/tests/nextflow.config | 5 + .../nf-core/blast/makeblastdb/tests/tags.yml | 2 + modules/nf-core/bowtie2/align/environment.yml | 9 + modules/nf-core/bowtie2/align/main.nf | 46 +- modules/nf-core/bowtie2/align/meta.yml | 9 +- .../bowtie2/align/tests/large_index.config | 5 + .../nf-core/bowtie2/align/tests/main.nf.test | 561 ++++++++ .../bowtie2/align/tests/main.nf.test.snap | 263 ++++ .../nf-core/bowtie2/align/tests/sam.config | 5 + .../nf-core/bowtie2/align/tests/sam2.config | 5 + modules/nf-core/bowtie2/align/tests/tags.yml | 2 + modules/nf-core/bowtie2/build/environment.yml | 7 + modules/nf-core/bowtie2/build/main.nf | 18 +- modules/nf-core/bowtie2/build/meta.yml | 3 + .../nf-core/bowtie2/build/tests/main.nf.test | 31 + .../bowtie2/build/tests/main.nf.test.snap | 45 + modules/nf-core/bowtie2/build/tests/tags.yml | 2 + modules/nf-core/cat/fastq/environment.yml | 7 + modules/nf-core/cat/fastq/main.nf | 2 +- modules/nf-core/cat/fastq/meta.yml | 7 +- modules/nf-core/cat/fastq/tests/main.nf.test | 143 ++ .../nf-core/cat/fastq/tests/main.nf.test.snap | 78 ++ modules/nf-core/cat/fastq/tests/tags.yml | 2 + .../dumpsoftwareversions/environment.yml | 7 + .../custom/dumpsoftwareversions/main.nf | 6 +- .../custom/dumpsoftwareversions/meta.yml | 7 +- .../dumpsoftwareversions/tests/main.nf.test | 38 + .../tests/main.nf.test.snap | 27 + .../dumpsoftwareversions/tests/tags.yml | 2 + .../custom/getchromsizes/environment.yml | 7 + modules/nf-core/custom/getchromsizes/main.nf | 4 +- modules/nf-core/custom/getchromsizes/meta.yml | 7 +- .../custom/getchromsizes/tests/main.nf.test | 60 + .../getchromsizes/tests/main.nf.test.snap | 124 ++ .../custom/getchromsizes/tests/tags.yml | 2 + modules/nf-core/fastp/environment.yml | 7 + modules/nf-core/fastp/main.nf | 12 +- modules/nf-core/fastp/meta.yml | 4 +- modules/nf-core/fastp/tests/main.nf.test | 485 +++++++ modules/nf-core/fastp/tests/main.nf.test.snap | 52 + modules/nf-core/fastp/tests/nextflow.config | 6 + modules/nf-core/fastp/tests/tags.yml | 2 + modules/nf-core/fastqc/environment.yml | 7 + modules/nf-core/fastqc/main.nf | 10 +- modules/nf-core/fastqc/meta.yml | 5 + modules/nf-core/fastqc/tests/main.nf.test | 109 ++ .../nf-core/fastqc/tests/main.nf.test.snap | 10 + modules/nf-core/fastqc/tests/tags.yml | 2 + modules/nf-core/freyja/boot/environment.yml | 7 + modules/nf-core/freyja/boot/main.nf | 7 +- modules/nf-core/freyja/boot/meta.yml | 30 +- .../nf-core/freyja/boot/tests/main.nf.test | 61 + .../freyja/boot/tests/main.nf.test.snap | 10 + .../nf-core/freyja/boot/tests/nextflow.config | 8 + modules/nf-core/freyja/boot/tests/tags.yml | 2 + modules/nf-core/freyja/demix/environment.yml | 7 + modules/nf-core/freyja/demix/main.nf | 7 +- modules/nf-core/freyja/demix/meta.yml | 27 +- .../nf-core/freyja/demix/tests/main.nf.test | 60 + .../freyja/demix/tests/main.nf.test.snap | 10 + .../freyja/demix/tests/nextflow.config | 8 + modules/nf-core/freyja/demix/tests/tags.yml | 2 + modules/nf-core/freyja/update/environment.yml | 7 + modules/nf-core/freyja/update/main.nf | 7 +- modules/nf-core/freyja/update/meta.yml | 9 +- .../nf-core/freyja/update/tests/main.nf.test | 34 + .../freyja/update/tests/main.nf.test.snap | 10 + modules/nf-core/freyja/update/tests/tags.yml | 2 + .../nf-core/freyja/variants/environment.yml | 7 + modules/nf-core/freyja/variants/main.nf | 7 +- modules/nf-core/freyja/variants/meta.yml | 10 +- .../freyja/variants/tests/main.nf.test | 35 + .../freyja/variants/tests/main.nf.test.snap | 35 + .../nf-core/freyja/variants/tests/tags.yml | 2 + modules/nf-core/gunzip/environment.yml | 7 + modules/nf-core/gunzip/main.nf | 12 +- modules/nf-core/gunzip/meta.yml | 5 + modules/nf-core/gunzip/tests/main.nf.test | 35 + .../nf-core/gunzip/tests/main.nf.test.snap | 31 + modules/nf-core/gunzip/tests/tags.yml | 2 + .../nf-core/ivar/consensus/environment.yml | 7 + modules/nf-core/ivar/consensus/main.nf | 4 +- modules/nf-core/ivar/consensus/meta.yml | 3 + modules/nf-core/ivar/trim/environment.yml | 7 + modules/nf-core/ivar/trim/main.nf | 4 +- modules/nf-core/ivar/trim/meta.yml | 3 + modules/nf-core/ivar/variants/environment.yml | 7 + modules/nf-core/ivar/variants/main.nf | 4 +- modules/nf-core/ivar/variants/meta.yml | 3 + .../nf-core/kraken2/kraken2/environment.yml | 8 + modules/nf-core/kraken2/kraken2/main.nf | 4 +- modules/nf-core/kraken2/kraken2/meta.yml | 7 +- .../kraken2/kraken2/tests/main.nf.test | 142 ++ .../kraken2/kraken2/tests/main.nf.test.snap | 62 + .../nf-core/kraken2/kraken2/tests/tags.yml | 3 + modules/nf-core/minia/environment.yml | 7 + modules/nf-core/minia/main.nf | 4 +- modules/nf-core/minia/meta.yml | 3 + modules/nf-core/mosdepth/environment.yml | 8 + modules/nf-core/mosdepth/main.nf | 15 +- modules/nf-core/mosdepth/meta.yml | 14 +- modules/nf-core/mosdepth/tests/main.nf.test | 260 ++++ .../nf-core/mosdepth/tests/main.nf.test.snap | 1145 +++++++++++++++++ .../nf-core/mosdepth/tests/quantized.config | 3 + modules/nf-core/mosdepth/tests/tags.yml | 2 + .../nf-core/mosdepth/tests/threshold.config | 3 + modules/nf-core/mosdepth/tests/window.config | 3 + modules/nf-core/nanoplot/environment.yml | 7 + modules/nf-core/nanoplot/main.nf | 7 +- modules/nf-core/nanoplot/meta.yml | 3 + modules/nf-core/nanoplot/tests/main.nf.test | 71 + .../nf-core/nanoplot/tests/main.nf.test.snap | 34 + modules/nf-core/nanoplot/tests/tags.yaml | 2 + .../nextclade/datasetget/environment.yml | 7 + modules/nf-core/nextclade/datasetget/main.nf | 4 +- modules/nf-core/nextclade/datasetget/meta.yml | 7 +- modules/nf-core/nextclade/run/environment.yml | 7 + modules/nf-core/nextclade/run/main.nf | 4 +- modules/nf-core/nextclade/run/meta.yml | 7 +- modules/nf-core/pangolin/environment.yml | 7 + modules/nf-core/pangolin/main.nf | 4 +- modules/nf-core/pangolin/meta.yml | 3 + .../collectmultiplemetrics/environment.yml | 7 + .../picard/collectmultiplemetrics/main.nf | 8 +- .../picard/collectmultiplemetrics/meta.yml | 2 + .../picard/markduplicates/environment.yml | 7 + modules/nf-core/picard/markduplicates/main.nf | 14 +- .../nf-core/picard/markduplicates/meta.yml | 15 + .../picard/markduplicates/tests/main.nf.test | 111 ++ .../markduplicates/tests/main.nf.test.snap | 44 + .../markduplicates/tests/nextflow.config | 6 + .../picard/markduplicates/tests/tags.yml | 2 + modules/nf-core/plasmidid/environment.yml | 7 + modules/nf-core/plasmidid/main.nf | 4 +- modules/nf-core/plasmidid/meta.yml | 7 +- modules/nf-core/pycoqc/environment.yml | 7 + modules/nf-core/pycoqc/main.nf | 4 +- modules/nf-core/pycoqc/meta.yml | 6 +- modules/nf-core/pycoqc/tests/main.nf.test | 43 + .../nf-core/pycoqc/tests/main.nf.test.snap | 642 +++++++++ modules/nf-core/pycoqc/tests/nextflow.config | 9 + modules/nf-core/pycoqc/tests/tags.yml | 2 + modules/nf-core/quast/environment.yml | 7 + modules/nf-core/quast/main.nf | 121 +- modules/nf-core/quast/meta.yml | 31 +- .../nf-core/samtools/flagstat/environment.yml | 7 + modules/nf-core/samtools/flagstat/main.nf | 17 +- modules/nf-core/samtools/flagstat/meta.yml | 2 + .../samtools/flagstat/tests/main.nf.test | 36 + .../samtools/flagstat/tests/main.nf.test.snap | 16 + .../nf-core/samtools/flagstat/tests/tags.yml | 2 + .../nf-core/samtools/idxstats/environment.yml | 7 + modules/nf-core/samtools/idxstats/main.nf | 18 +- modules/nf-core/samtools/idxstats/meta.yml | 2 + .../samtools/idxstats/tests/main.nf.test | 36 + .../samtools/idxstats/tests/main.nf.test.snap | 16 + .../nf-core/samtools/idxstats/tests/tags.yml | 2 + .../nf-core/samtools/index/environment.yml | 7 + modules/nf-core/samtools/index/main.nf | 6 +- modules/nf-core/samtools/index/meta.yml | 4 + .../samtools/index/tests/csi.nextflow.config | 7 + .../nf-core/samtools/index/tests/main.nf.test | 87 ++ .../samtools/index/tests/main.nf.test.snap | 28 + modules/nf-core/samtools/index/tests/tags.yml | 2 + modules/nf-core/samtools/sort/environment.yml | 7 + modules/nf-core/samtools/sort/main.nf | 14 +- modules/nf-core/samtools/sort/meta.yml | 3 + .../nf-core/samtools/sort/tests/main.nf.test | 73 ++ .../samtools/sort/tests/main.nf.test.snap | 48 + .../samtools/sort/tests/nextflow.config | 7 + modules/nf-core/samtools/sort/tests/tags.yml | 3 + .../nf-core/samtools/stats/environment.yml | 7 + modules/nf-core/samtools/stats/main.nf | 8 +- modules/nf-core/samtools/stats/meta.yml | 14 +- .../nf-core/samtools/stats/tests/main.nf.test | 78 ++ .../samtools/stats/tests/main.nf.test.snap | 64 + modules/nf-core/samtools/stats/tests/tags.yml | 2 + modules/nf-core/samtools/view/environment.yml | 7 + modules/nf-core/samtools/view/main.nf | 21 +- modules/nf-core/samtools/view/meta.yml | 20 +- .../nf-core/samtools/view/tests/bam.config | 3 + .../samtools/view/tests/bam_index.config | 3 + .../nf-core/samtools/view/tests/main.nf.test | 231 ++++ .../samtools/view/tests/main.nf.test.snap | 140 ++ modules/nf-core/samtools/view/tests/tags.yml | 2 + modules/nf-core/spades/environment.yml | 7 + modules/nf-core/spades/main.nf | 4 +- modules/nf-core/spades/meta.yml | 5 +- modules/nf-core/tabix/bgzip/environment.yml | 7 + modules/nf-core/tabix/bgzip/main.nf | 4 +- modules/nf-core/tabix/bgzip/meta.yml | 5 + modules/nf-core/tabix/tabix/environment.yml | 7 + modules/nf-core/tabix/tabix/main.nf | 4 +- modules/nf-core/tabix/tabix/meta.yml | 4 + modules/nf-core/unicycler/environment.yml | 7 + modules/nf-core/unicycler/main.nf | 4 +- modules/nf-core/unicycler/meta.yml | 4 + modules/nf-core/untar/environment.yml | 9 + modules/nf-core/untar/main.nf | 2 +- modules/nf-core/untar/meta.yml | 6 + modules/nf-core/untar/tests/main.nf.test | 77 ++ modules/nf-core/untar/tests/main.nf.test.snap | 513 ++++++++ modules/nf-core/untar/tests/tags.yml | 2 + .../nf-core/vcflib/vcfuniq/environment.yml | 7 + modules/nf-core/vcflib/vcfuniq/main.nf | 4 +- modules/nf-core/vcflib/vcfuniq/meta.yml | 5 +- .../bam_markduplicates_picard/meta.yml | 9 +- .../tests/main.nf.test | 92 ++ .../tests/main.nf.test.snap | 22 + .../bam_markduplicates_picard/tests/tags.yml | 2 + .../nf-core/bam_sort_stats_samtools/main.nf | 2 +- .../nf-core/bam_sort_stats_samtools/meta.yml | 7 +- .../tests/main.nf.test | 78 ++ .../tests/main.nf.test.snap | 86 ++ .../bam_sort_stats_samtools/tests/tags.yml | 2 + .../nf-core/bam_stats_samtools/main.nf | 2 +- .../nf-core/bam_stats_samtools/meta.yml | 5 +- .../bam_stats_samtools/tests/main.nf.test | 102 ++ .../tests/main.nf.test.snap | 128 ++ .../nf-core/bam_stats_samtools/tests/tags.yml | 2 + .../bam_variant_demix_boot_freyja/meta.yml | 14 +- .../nf-core/fastq_align_bowtie2/main.nf | 10 +- .../nf-core/fastq_align_bowtie2/meta.yml | 10 +- 290 files changed, 9009 insertions(+), 434 deletions(-) create mode 100644 modules/nf-core/abacas/environment.yml create mode 100644 modules/nf-core/abacas/tests/main.nf.test create mode 100644 modules/nf-core/abacas/tests/main.nf.test.snap create mode 100644 modules/nf-core/abacas/tests/nextflow.config create mode 100644 modules/nf-core/abacas/tests/tags.yml create mode 100644 modules/nf-core/artic/guppyplex/environment.yml create mode 100644 modules/nf-core/artic/minion/environment.yml create mode 100644 modules/nf-core/bandage/image/environment.yml create mode 100644 modules/nf-core/bcftools/consensus/environment.yml create mode 100644 modules/nf-core/bcftools/filter/environment.yml create mode 100644 modules/nf-core/bcftools/mpileup/environment.yml create mode 100644 modules/nf-core/bcftools/mpileup/tests/main.nf.test create mode 100644 modules/nf-core/bcftools/mpileup/tests/main.nf.test.snap create mode 100644 modules/nf-core/bcftools/mpileup/tests/nextflow.config create mode 100644 modules/nf-core/bcftools/mpileup/tests/tags.yml create mode 100644 modules/nf-core/bcftools/norm/environment.yml create mode 100644 modules/nf-core/bcftools/query/environment.yml create mode 100644 modules/nf-core/bcftools/query/tests/main.nf.test create mode 100644 modules/nf-core/bcftools/query/tests/main.nf.test.snap create mode 100644 modules/nf-core/bcftools/query/tests/nextflow.config create mode 100644 modules/nf-core/bcftools/query/tests/tags.yml create mode 100644 modules/nf-core/bcftools/sort/environment.yml create mode 100644 modules/nf-core/bcftools/stats/environment.yml create mode 100644 modules/nf-core/bedtools/getfasta/environment.yml create mode 100644 modules/nf-core/bedtools/maskfasta/environment.yml create mode 100644 modules/nf-core/bedtools/merge/environment.yml create mode 100644 modules/nf-core/blast/blastn/environment.yml create mode 100644 modules/nf-core/blast/blastn/tests/main.nf.test create mode 100644 modules/nf-core/blast/blastn/tests/main.nf.test.snap create mode 100644 modules/nf-core/blast/blastn/tests/nextflow.config create mode 100644 modules/nf-core/blast/blastn/tests/tags.yml create mode 100644 modules/nf-core/blast/makeblastdb/environment.yml create mode 100644 modules/nf-core/blast/makeblastdb/tests/main.nf.test create mode 100644 modules/nf-core/blast/makeblastdb/tests/main.nf.test.snap create mode 100644 modules/nf-core/blast/makeblastdb/tests/nextflow.config create mode 100644 modules/nf-core/blast/makeblastdb/tests/tags.yml create mode 100644 modules/nf-core/bowtie2/align/environment.yml create mode 100644 modules/nf-core/bowtie2/align/tests/large_index.config create mode 100644 modules/nf-core/bowtie2/align/tests/main.nf.test create mode 100644 modules/nf-core/bowtie2/align/tests/main.nf.test.snap create mode 100644 modules/nf-core/bowtie2/align/tests/sam.config create mode 100644 modules/nf-core/bowtie2/align/tests/sam2.config create mode 100644 modules/nf-core/bowtie2/align/tests/tags.yml create mode 100644 modules/nf-core/bowtie2/build/environment.yml create mode 100644 modules/nf-core/bowtie2/build/tests/main.nf.test create mode 100644 modules/nf-core/bowtie2/build/tests/main.nf.test.snap create mode 100644 modules/nf-core/bowtie2/build/tests/tags.yml create mode 100644 modules/nf-core/cat/fastq/environment.yml create mode 100644 modules/nf-core/cat/fastq/tests/main.nf.test create mode 100644 modules/nf-core/cat/fastq/tests/main.nf.test.snap create mode 100644 modules/nf-core/cat/fastq/tests/tags.yml create mode 100644 modules/nf-core/custom/dumpsoftwareversions/environment.yml create mode 100644 modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test create mode 100644 modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap create mode 100644 modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml create mode 100644 modules/nf-core/custom/getchromsizes/environment.yml create mode 100644 modules/nf-core/custom/getchromsizes/tests/main.nf.test create mode 100644 modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap create mode 100644 modules/nf-core/custom/getchromsizes/tests/tags.yml create mode 100644 modules/nf-core/fastp/environment.yml create mode 100644 modules/nf-core/fastp/tests/main.nf.test create mode 100644 modules/nf-core/fastp/tests/main.nf.test.snap create mode 100644 modules/nf-core/fastp/tests/nextflow.config create mode 100644 modules/nf-core/fastp/tests/tags.yml create mode 100644 modules/nf-core/fastqc/environment.yml create mode 100644 modules/nf-core/fastqc/tests/main.nf.test create mode 100644 modules/nf-core/fastqc/tests/main.nf.test.snap create mode 100644 modules/nf-core/fastqc/tests/tags.yml create mode 100644 modules/nf-core/freyja/boot/environment.yml create mode 100644 modules/nf-core/freyja/boot/tests/main.nf.test create mode 100644 modules/nf-core/freyja/boot/tests/main.nf.test.snap create mode 100644 modules/nf-core/freyja/boot/tests/nextflow.config create mode 100644 modules/nf-core/freyja/boot/tests/tags.yml create mode 100644 modules/nf-core/freyja/demix/environment.yml create mode 100644 modules/nf-core/freyja/demix/tests/main.nf.test create mode 100644 modules/nf-core/freyja/demix/tests/main.nf.test.snap create mode 100644 modules/nf-core/freyja/demix/tests/nextflow.config create mode 100644 modules/nf-core/freyja/demix/tests/tags.yml create mode 100644 modules/nf-core/freyja/update/environment.yml create mode 100644 modules/nf-core/freyja/update/tests/main.nf.test create mode 100644 modules/nf-core/freyja/update/tests/main.nf.test.snap create mode 100644 modules/nf-core/freyja/update/tests/tags.yml create mode 100644 modules/nf-core/freyja/variants/environment.yml create mode 100644 modules/nf-core/freyja/variants/tests/main.nf.test create mode 100644 modules/nf-core/freyja/variants/tests/main.nf.test.snap create mode 100644 modules/nf-core/freyja/variants/tests/tags.yml create mode 100644 modules/nf-core/gunzip/environment.yml create mode 100644 modules/nf-core/gunzip/tests/main.nf.test create mode 100644 modules/nf-core/gunzip/tests/main.nf.test.snap create mode 100644 modules/nf-core/gunzip/tests/tags.yml create mode 100644 modules/nf-core/ivar/consensus/environment.yml create mode 100644 modules/nf-core/ivar/trim/environment.yml create mode 100644 modules/nf-core/ivar/variants/environment.yml create mode 100644 modules/nf-core/kraken2/kraken2/environment.yml create mode 100644 modules/nf-core/kraken2/kraken2/tests/main.nf.test create mode 100644 modules/nf-core/kraken2/kraken2/tests/main.nf.test.snap create mode 100644 modules/nf-core/kraken2/kraken2/tests/tags.yml create mode 100644 modules/nf-core/minia/environment.yml create mode 100644 modules/nf-core/mosdepth/environment.yml create mode 100644 modules/nf-core/mosdepth/tests/main.nf.test create mode 100644 modules/nf-core/mosdepth/tests/main.nf.test.snap create mode 100644 modules/nf-core/mosdepth/tests/quantized.config create mode 100644 modules/nf-core/mosdepth/tests/tags.yml create mode 100644 modules/nf-core/mosdepth/tests/threshold.config create mode 100644 modules/nf-core/mosdepth/tests/window.config create mode 100644 modules/nf-core/nanoplot/environment.yml create mode 100644 modules/nf-core/nanoplot/tests/main.nf.test create mode 100644 modules/nf-core/nanoplot/tests/main.nf.test.snap create mode 100644 modules/nf-core/nanoplot/tests/tags.yaml create mode 100644 modules/nf-core/nextclade/datasetget/environment.yml create mode 100644 modules/nf-core/nextclade/run/environment.yml create mode 100644 modules/nf-core/pangolin/environment.yml create mode 100644 modules/nf-core/picard/collectmultiplemetrics/environment.yml create mode 100644 modules/nf-core/picard/markduplicates/environment.yml create mode 100644 modules/nf-core/picard/markduplicates/tests/main.nf.test create mode 100644 modules/nf-core/picard/markduplicates/tests/main.nf.test.snap create mode 100644 modules/nf-core/picard/markduplicates/tests/nextflow.config create mode 100644 modules/nf-core/picard/markduplicates/tests/tags.yml create mode 100644 modules/nf-core/plasmidid/environment.yml create mode 100644 modules/nf-core/pycoqc/environment.yml create mode 100644 modules/nf-core/pycoqc/tests/main.nf.test create mode 100644 modules/nf-core/pycoqc/tests/main.nf.test.snap create mode 100644 modules/nf-core/pycoqc/tests/nextflow.config create mode 100644 modules/nf-core/pycoqc/tests/tags.yml create mode 100644 modules/nf-core/quast/environment.yml create mode 100644 modules/nf-core/samtools/flagstat/environment.yml create mode 100644 modules/nf-core/samtools/flagstat/tests/main.nf.test create mode 100644 modules/nf-core/samtools/flagstat/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/flagstat/tests/tags.yml create mode 100644 modules/nf-core/samtools/idxstats/environment.yml create mode 100644 modules/nf-core/samtools/idxstats/tests/main.nf.test create mode 100644 modules/nf-core/samtools/idxstats/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/idxstats/tests/tags.yml create mode 100644 modules/nf-core/samtools/index/environment.yml create mode 100644 modules/nf-core/samtools/index/tests/csi.nextflow.config create mode 100644 modules/nf-core/samtools/index/tests/main.nf.test create mode 100644 modules/nf-core/samtools/index/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/index/tests/tags.yml create mode 100644 modules/nf-core/samtools/sort/environment.yml create mode 100644 modules/nf-core/samtools/sort/tests/main.nf.test create mode 100644 modules/nf-core/samtools/sort/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/sort/tests/nextflow.config create mode 100644 modules/nf-core/samtools/sort/tests/tags.yml create mode 100644 modules/nf-core/samtools/stats/environment.yml create mode 100644 modules/nf-core/samtools/stats/tests/main.nf.test create mode 100644 modules/nf-core/samtools/stats/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/stats/tests/tags.yml create mode 100644 modules/nf-core/samtools/view/environment.yml create mode 100644 modules/nf-core/samtools/view/tests/bam.config create mode 100644 modules/nf-core/samtools/view/tests/bam_index.config create mode 100644 modules/nf-core/samtools/view/tests/main.nf.test create mode 100644 modules/nf-core/samtools/view/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/view/tests/tags.yml create mode 100644 modules/nf-core/spades/environment.yml create mode 100644 modules/nf-core/tabix/bgzip/environment.yml create mode 100644 modules/nf-core/tabix/tabix/environment.yml create mode 100644 modules/nf-core/unicycler/environment.yml create mode 100644 modules/nf-core/untar/environment.yml create mode 100644 modules/nf-core/untar/tests/main.nf.test create mode 100644 modules/nf-core/untar/tests/main.nf.test.snap create mode 100644 modules/nf-core/untar/tests/tags.yml create mode 100644 modules/nf-core/vcflib/vcfuniq/environment.yml create mode 100644 subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test create mode 100644 subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap create mode 100644 subworkflows/nf-core/bam_markduplicates_picard/tests/tags.yml create mode 100644 subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test create mode 100644 subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap create mode 100644 subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml create mode 100644 subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test create mode 100644 subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap create mode 100644 subworkflows/nf-core/bam_stats_samtools/tests/tags.yml diff --git a/modules.json b/modules.json index 58f57ccc..286c15ac 100644 --- a/modules.json +++ b/modules.json @@ -7,278 +7,277 @@ "nf-core": { "abacas": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "3304b04f6022222e217bd17bc117f0babc8cbd6a", "installed_by": ["modules"] }, "artic/guppyplex": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "artic/minion": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "bandage/image": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "bcftools/consensus": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", "installed_by": ["modules"] }, "bcftools/filter": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", "installed_by": ["modules"] }, "bcftools/mpileup": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", "installed_by": ["modules"] }, "bcftools/norm": { "branch": "master", - "git_sha": "bcad95fb35e567ad25840d3297c3e17eff211a3a", + "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", "installed_by": ["modules"] }, "bcftools/query": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", "installed_by": ["modules"] }, "bcftools/sort": { "branch": "master", - "git_sha": "4a21e4cca35e72ec059abd67f790e0b192ce5d81", + "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", "installed_by": ["modules"] }, "bcftools/stats": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", "installed_by": ["modules"] }, "bedtools/getfasta": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", "installed_by": ["modules"] }, "bedtools/maskfasta": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", "installed_by": ["modules"] }, "bedtools/merge": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", "installed_by": ["modules"] }, "blast/blastn": { "branch": "master", - "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180", + "git_sha": "f0d13ae7e1f9b24a705764f8673af859268d7077", "installed_by": ["modules"] }, "blast/makeblastdb": { "branch": "master", - "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "bowtie2/align": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "3c77ca9aac783e76c3614a06db3bfe4fef619bde", "installed_by": ["fastq_align_bowtie2"] }, "bowtie2/build": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "1fea64f5132a813ec97c1c6d3a74e0aee7142b6d", "installed_by": ["modules"] }, "cat/fastq": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "custom/dumpsoftwareversions": { "branch": "master", - "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", - "installed_by": ["modules"], - "patch": "modules/nf-core/custom/dumpsoftwareversions/custom-dumpsoftwareversions.diff" + "git_sha": "bba7e362e4afead70653f84d8700588ea28d0f9e", + "installed_by": ["modules"] }, "custom/getchromsizes": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "fastp": { "branch": "master", - "git_sha": "20a508676f40d0fd3f911ac595af91ec845704c4", + "git_sha": "3c77ca9aac783e76c3614a06db3bfe4fef619bde", "installed_by": ["modules"] }, "fastqc": { "branch": "master", - "git_sha": "bd8092b67b5103bdd52e300f75889442275c3117", + "git_sha": "65ad3e0b9a4099592e1102e92e10455dc661cf53", "installed_by": ["modules"] }, "freyja/boot": { "branch": "master", - "git_sha": "281c744ed84352c24697f0916c7744853ce83927", + "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", "installed_by": ["bam_variant_demix_boot_freyja"] }, "freyja/demix": { "branch": "master", - "git_sha": "4bb5cb441e89811385d18a90809ecf36c9daafd8", + "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", "installed_by": ["bam_variant_demix_boot_freyja"] }, "freyja/update": { "branch": "master", - "git_sha": "4bb5cb441e89811385d18a90809ecf36c9daafd8", + "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", "installed_by": ["bam_variant_demix_boot_freyja"] }, "freyja/variants": { "branch": "master", - "git_sha": "4bb5cb441e89811385d18a90809ecf36c9daafd8", + "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", "installed_by": ["bam_variant_demix_boot_freyja"] }, "gunzip": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "ivar/consensus": { "branch": "master", - "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "ivar/trim": { "branch": "master", - "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "ivar/variants": { "branch": "master", - "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "kraken2/kraken2": { "branch": "master", - "git_sha": "7c695e0147df1157413e06246d9b0094617d3e6b", + "git_sha": "d6549f46c3c1c3fe3def110f3d18059a68a65cc6", "installed_by": ["modules"] }, "minia": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "mosdepth": { "branch": "master", - "git_sha": "def5f182583df0c20f43ec3d4355e8ebd341aaa9", + "git_sha": "69e3eb17fb31b772b18f134d6e8f8b93ee980e65", "installed_by": ["modules"] }, "nanoplot": { "branch": "master", - "git_sha": "3822e04e49b6d89b7092feb3480d744cb5d9986b", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "nextclade/datasetget": { "branch": "master", - "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "nextclade/run": { "branch": "master", - "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "pangolin": { "branch": "master", - "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "picard/collectmultiplemetrics": { "branch": "master", - "git_sha": "75027bf77472b1f4fd2cdd7e46f83119dfb0f2c6", + "git_sha": "20b0918591d4ba20047d7e13e5094bcceba81447", "installed_by": ["modules"] }, "picard/markduplicates": { "branch": "master", - "git_sha": "75027bf77472b1f4fd2cdd7e46f83119dfb0f2c6", + "git_sha": "20b0918591d4ba20047d7e13e5094bcceba81447", "installed_by": ["bam_markduplicates_picard"] }, "plasmidid": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "pycoqc": { "branch": "master", - "git_sha": "cb8a5428685f490d0295563b1b0c3a239bbe1927", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "quast": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "samtools/flagstat": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", "installed_by": ["bam_stats_samtools"] }, "samtools/idxstats": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", "installed_by": ["bam_stats_samtools"] }, "samtools/index": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", "installed_by": ["bam_markduplicates_picard", "bam_sort_stats_samtools"] }, "samtools/sort": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", "installed_by": ["bam_sort_stats_samtools"] }, "samtools/stats": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", "installed_by": ["bam_stats_samtools"] }, "samtools/view": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", "installed_by": ["modules"] }, "spades": { "branch": "master", - "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "tabix/bgzip": { "branch": "master", - "git_sha": "90294980a903ecebd99ac31d8b6c66af48fa8259", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "tabix/tabix": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "unicycler": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "untar": { "branch": "master", - "git_sha": "cc1f997fab6d8fde5dc0e6e2a310814df5b53ce7", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "vcflib/vcfuniq": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] } } @@ -287,27 +286,27 @@ "nf-core": { "bam_markduplicates_picard": { "branch": "master", - "git_sha": "dedc0e31087f3306101c38835d051bf49789445a", + "git_sha": "eeb9d37c6c8b0ab864b8fe68aa6531c5b2beba01", "installed_by": ["subworkflows"] }, "bam_sort_stats_samtools": { "branch": "master", - "git_sha": "dedc0e31087f3306101c38835d051bf49789445a", + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", "installed_by": ["fastq_align_bowtie2"] }, "bam_stats_samtools": { "branch": "master", - "git_sha": "dedc0e31087f3306101c38835d051bf49789445a", + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", "installed_by": ["bam_markduplicates_picard", "bam_sort_stats_samtools"] }, "bam_variant_demix_boot_freyja": { "branch": "master", - "git_sha": "dedc0e31087f3306101c38835d051bf49789445a", + "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f", "installed_by": ["subworkflows"] }, "fastq_align_bowtie2": { "branch": "master", - "git_sha": "dedc0e31087f3306101c38835d051bf49789445a", + "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f", "installed_by": ["subworkflows"] } } diff --git a/modules/nf-core/abacas/environment.yml b/modules/nf-core/abacas/environment.yml new file mode 100644 index 00000000..c1379190 --- /dev/null +++ b/modules/nf-core/abacas/environment.yml @@ -0,0 +1,7 @@ +name: abacas +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::abacas=1.3.1 diff --git a/modules/nf-core/abacas/main.nf b/modules/nf-core/abacas/main.nf index beabc45b..d0b04415 100644 --- a/modules/nf-core/abacas/main.nf +++ b/modules/nf-core/abacas/main.nf @@ -2,10 +2,10 @@ process ABACAS { tag "$meta.id" label 'process_medium' - conda "bioconda::abacas=1.3.1" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/abacas:1.3.1--pl526_0' : - 'quay.io/biocontainers/abacas:1.3.1--pl526_0' }" + 'biocontainers/abacas:1.3.1--pl526_0' }" input: tuple val(meta), path(scaffold) diff --git a/modules/nf-core/abacas/meta.yml b/modules/nf-core/abacas/meta.yml index 3bab9b22..bef9868c 100644 --- a/modules/nf-core/abacas/meta.yml +++ b/modules/nf-core/abacas/meta.yml @@ -12,10 +12,8 @@ tools: contigs based on a reference sequence. homepage: http://abacas.sourceforge.net/documentation.html documentation: http://abacas.sourceforge.net/documentation.html - doi: "10.1093/bioinformatics/btp347" licence: ["GPL v2-or-later"] - input: - meta: type: map @@ -30,7 +28,6 @@ input: type: file description: FASTA reference file pattern: "*.{fasta,fa}" - output: - meta: type: map @@ -38,7 +35,7 @@ output: Groovy Map containing sample information e.g. [ id:'test', single_end:false ] - results: - type: files + type: file description: | List containing abacas output files [ 'test.abacas.bin', 'test.abacas.fasta', 'test.abacas.gaps', @@ -47,12 +44,13 @@ output: 'test.abacas.tab', 'test.abacas.unused.contigs.out', 'test.abacas.MULTIFASTA.fa' ] pattern: "*.{abacas}*" - - versions: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/abacas/tests/main.nf.test b/modules/nf-core/abacas/tests/main.nf.test new file mode 100644 index 00000000..86f056ed --- /dev/null +++ b/modules/nf-core/abacas/tests/main.nf.test @@ -0,0 +1,46 @@ +nextflow_process { + + name "Test Process ABACAS" + script "../main.nf" + process "ABACAS" + config "./nextflow.config" + tag "modules" + tag "modules_nfcore" + tag "abacas" + + test("sarscov2 [scaffolds_fasta] [genome_fasta]") { + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['scaffolds_fasta'], checkIfExists: true) + ] + input[1] = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.results[0][1].findAll { + file(it).name != "test.abacas.bin" && + file(it).name != "test.abacas.nucmer.delta" && + file(it).name != "test.abacas.unused.contigs.out" && + file(it).name != "test.abacas.nucmer.filtered.delta" }).match()}, + { assert file(process.out.results[0][1].find { + file(it).name == "test.abacas.bin" }).exists() }, + { assert file(process.out.results[0][1].find { + file(it).name == "test.abacas.nucmer.delta" }).exists() }, + { assert file(process.out.results[0][1].find { + file(it).name == "test.abacas.unused.contigs.out" }).exists() }, + { assert file(process.out.results[0][1].find { + file(it).name == "test.abacas.nucmer.filtered.delta" }).exists() }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + + } + +} diff --git a/modules/nf-core/abacas/tests/main.nf.test.snap b/modules/nf-core/abacas/tests/main.nf.test.snap new file mode 100644 index 00000000..34d7ef68 --- /dev/null +++ b/modules/nf-core/abacas/tests/main.nf.test.snap @@ -0,0 +1,24 @@ +{ + "sarscov2 [scaffolds_fasta] [genome_fasta]": { + "content": [ + [ + "test.abacas.MULTIFASTA.fa:md5,46c899ad70dcef8d14b5829fd8fbab82", + "test.abacas.crunch:md5,9a95358a9bd8ee97d1f2253d95623a17", + "test.abacas.fasta:md5,5e6c403d3850d52f6bde956fa2403b13", + "test.abacas.gaps:md5,5361af445b8d18a85c3af6527a97c89a", + "test.abacas.gaps.tab:md5,193024ec9e5a553573519b218eb06e29", + "test.abacas.nucmer.tiling:md5,0adaa0ce800d92c149a523d447148d95", + "test.abacas.tab:md5,a5b9b452516f519a4201ff809655ef69" + ] + ], + "timestamp": "2023-11-24T23:10:40.830744514" + }, + "versions": { + "content": [ + [ + "versions.yml:md5,dac92f544d3e3ff9e5faae9b332dfab4" + ] + ], + "timestamp": "2023-11-24T23:35:57.275724471" + } +} \ No newline at end of file diff --git a/modules/nf-core/abacas/tests/nextflow.config b/modules/nf-core/abacas/tests/nextflow.config new file mode 100644 index 00000000..17296503 --- /dev/null +++ b/modules/nf-core/abacas/tests/nextflow.config @@ -0,0 +1,9 @@ +process { + + publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } + + withName: ABACAS { + ext.args = '-m -p nucmer' + } + +} diff --git a/modules/nf-core/abacas/tests/tags.yml b/modules/nf-core/abacas/tests/tags.yml new file mode 100644 index 00000000..5751a360 --- /dev/null +++ b/modules/nf-core/abacas/tests/tags.yml @@ -0,0 +1,2 @@ +abacas: + - modules/nf-core/abacas/** diff --git a/modules/nf-core/artic/guppyplex/environment.yml b/modules/nf-core/artic/guppyplex/environment.yml new file mode 100644 index 00000000..19176850 --- /dev/null +++ b/modules/nf-core/artic/guppyplex/environment.yml @@ -0,0 +1,7 @@ +name: artic_guppyplex +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::artic=1.2.3 diff --git a/modules/nf-core/artic/guppyplex/main.nf b/modules/nf-core/artic/guppyplex/main.nf index 9be33484..7259ef44 100644 --- a/modules/nf-core/artic/guppyplex/main.nf +++ b/modules/nf-core/artic/guppyplex/main.nf @@ -2,10 +2,10 @@ process ARTIC_GUPPYPLEX { tag "$meta.id" label 'process_high' - conda "bioconda::artic=1.2.3" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/artic:1.2.3--pyhdfd78af_0' : - 'quay.io/biocontainers/artic:1.2.3--pyhdfd78af_0' }" + 'biocontainers/artic:1.2.3--pyhdfd78af_0' }" input: tuple val(meta), path(fastq_dir) diff --git a/modules/nf-core/artic/guppyplex/meta.yml b/modules/nf-core/artic/guppyplex/meta.yml index e8edc8f3..80a1d999 100644 --- a/modules/nf-core/artic/guppyplex/meta.yml +++ b/modules/nf-core/artic/guppyplex/meta.yml @@ -10,9 +10,7 @@ tools: homepage: https://artic.readthedocs.io/en/latest/ documentation: https://artic.readthedocs.io/en/latest/ tool_dev_url: https://github.com/artic-network/fieldbioinformatics - licence: ["MIT"] - input: - meta: type: map @@ -23,7 +21,6 @@ input: type: directory description: Directory containing the fastq files with demultiplexed reads pattern: "*" - output: - meta: type: map @@ -38,7 +35,9 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/artic/minion/environment.yml b/modules/nf-core/artic/minion/environment.yml new file mode 100644 index 00000000..5123f82c --- /dev/null +++ b/modules/nf-core/artic/minion/environment.yml @@ -0,0 +1,7 @@ +name: artic_minion +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::artic=1.2.3 diff --git a/modules/nf-core/artic/minion/main.nf b/modules/nf-core/artic/minion/main.nf index 429a107d..8559bd75 100644 --- a/modules/nf-core/artic/minion/main.nf +++ b/modules/nf-core/artic/minion/main.nf @@ -2,10 +2,10 @@ process ARTIC_MINION { tag "$meta.id" label 'process_high' - conda "bioconda::artic=1.2.3" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/artic:1.2.3--pyhdfd78af_0' : - 'quay.io/biocontainers/artic:1.2.3--pyhdfd78af_0' }" + 'biocontainers/artic:1.2.3--pyhdfd78af_0' }" input: tuple val(meta), path(fastq) diff --git a/modules/nf-core/artic/minion/meta.yml b/modules/nf-core/artic/minion/meta.yml index 8ccf8434..9092edd3 100644 --- a/modules/nf-core/artic/minion/meta.yml +++ b/modules/nf-core/artic/minion/meta.yml @@ -11,7 +11,6 @@ tools: homepage: https://artic.readthedocs.io/en/latest/ documentation: https://artic.readthedocs.io/en/latest/ tool_dev_url: https://github.com/artic-network/fieldbioinformatics - licence: ["MIT"] input: - meta: @@ -112,7 +111,9 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/bandage/image/environment.yml b/modules/nf-core/bandage/image/environment.yml new file mode 100644 index 00000000..61558105 --- /dev/null +++ b/modules/nf-core/bandage/image/environment.yml @@ -0,0 +1,7 @@ +name: bandage_image +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::bandage=0.8.1 diff --git a/modules/nf-core/bandage/image/main.nf b/modules/nf-core/bandage/image/main.nf index e4da7336..f6801d0a 100644 --- a/modules/nf-core/bandage/image/main.nf +++ b/modules/nf-core/bandage/image/main.nf @@ -2,10 +2,10 @@ process BANDAGE_IMAGE { tag "${meta.id}" label 'process_low' - conda "bioconda::bandage=0.8.1" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/bandage:0.8.1--hc9558a2_2' : - 'quay.io/biocontainers/bandage:0.8.1--hc9558a2_2' }" + 'biocontainers/bandage:0.8.1--hc9558a2_2' }" input: tuple val(meta), path(gfa) diff --git a/modules/nf-core/bandage/image/meta.yml b/modules/nf-core/bandage/image/meta.yml index e68d8c98..94ce8a80 100644 --- a/modules/nf-core/bandage/image/meta.yml +++ b/modules/nf-core/bandage/image/meta.yml @@ -42,3 +42,5 @@ output: pattern: "versions.yml" authors: - "@heuermh" +maintainers: + - "@heuermh" diff --git a/modules/nf-core/bcftools/consensus/environment.yml b/modules/nf-core/bcftools/consensus/environment.yml new file mode 100644 index 00000000..4217d8c1 --- /dev/null +++ b/modules/nf-core/bcftools/consensus/environment.yml @@ -0,0 +1,7 @@ +name: bcftools_consensus +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::bcftools=1.18 diff --git a/modules/nf-core/bcftools/consensus/main.nf b/modules/nf-core/bcftools/consensus/main.nf index a32d94b1..9e167b9f 100644 --- a/modules/nf-core/bcftools/consensus/main.nf +++ b/modules/nf-core/bcftools/consensus/main.nf @@ -2,10 +2,10 @@ process BCFTOOLS_CONSENSUS { tag "$meta.id" label 'process_medium' - conda "bioconda::bcftools=1.16" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bcftools:1.16--hfe4b78e_1': - 'quay.io/biocontainers/bcftools:1.16--hfe4b78e_1' }" + 'https://depot.galaxyproject.org/singularity/bcftools:1.18--h8b25389_0': + 'biocontainers/bcftools:1.18--h8b25389_0' }" input: tuple val(meta), path(vcf), path(tbi), path(fasta) diff --git a/modules/nf-core/bcftools/consensus/meta.yml b/modules/nf-core/bcftools/consensus/meta.yml index 05a93a56..3b43c808 100644 --- a/modules/nf-core/bcftools/consensus/meta.yml +++ b/modules/nf-core/bcftools/consensus/meta.yml @@ -47,3 +47,6 @@ output: authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/bcftools/filter/environment.yml b/modules/nf-core/bcftools/filter/environment.yml new file mode 100644 index 00000000..b2698757 --- /dev/null +++ b/modules/nf-core/bcftools/filter/environment.yml @@ -0,0 +1,7 @@ +name: bcftools_filter +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::bcftools=1.18 diff --git a/modules/nf-core/bcftools/filter/main.nf b/modules/nf-core/bcftools/filter/main.nf index 4e02009d..1a40cb93 100644 --- a/modules/nf-core/bcftools/filter/main.nf +++ b/modules/nf-core/bcftools/filter/main.nf @@ -2,17 +2,17 @@ process BCFTOOLS_FILTER { tag "$meta.id" label 'process_medium' - conda "bioconda::bcftools=1.16" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bcftools:1.16--hfe4b78e_1': - 'quay.io/biocontainers/bcftools:1.16--hfe4b78e_1' }" + 'https://depot.galaxyproject.org/singularity/bcftools:1.18--h8b25389_0': + 'biocontainers/bcftools:1.18--h8b25389_0' }" input: tuple val(meta), path(vcf) output: - tuple val(meta), path("*.gz"), emit: vcf - path "versions.yml" , emit: versions + tuple val(meta), path("*.${extension}"), emit: vcf + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when @@ -20,9 +20,19 @@ process BCFTOOLS_FILTER { script: def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" + + extension = args.contains("--output-type b") || args.contains("-Ob") ? "bcf.gz" : + args.contains("--output-type u") || args.contains("-Ou") ? "bcf" : + args.contains("--output-type z") || args.contains("-Oz") ? "vcf.gz" : + args.contains("--output-type v") || args.contains("-Ov") ? "vcf" : + "vcf" + + if ("$vcf" == "${prefix}.${extension}") error "Input and output names are the same, set prefix in module configuration to disambiguate!" + """ bcftools filter \\ - --output ${prefix}.vcf.gz \\ + --output ${prefix}.${extension} \\ + --threads ${task.cpus} \\ $args \\ $vcf @@ -35,8 +45,16 @@ process BCFTOOLS_FILTER { stub: def prefix = task.ext.prefix ?: "${meta.id}" + extension = args.contains("--output-type b") || args.contains("-Ob") ? "bcf.gz" : + args.contains("--output-type u") || args.contains("-Ou") ? "bcf" : + args.contains("--output-type z") || args.contains("-Oz") ? "vcf.gz" : + args.contains("--output-type v") || args.contains("-Ov") ? "vcf" : + "vcf" + + if ("$vcf" == "${prefix}.${extension}") error "Input and output names are the same, set prefix in module configuration to disambiguate!" + """ - touch ${prefix}.vcf.gz + touch ${prefix}.${extension} cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/bcftools/filter/meta.yml b/modules/nf-core/bcftools/filter/meta.yml index 05a6d828..5b111fc3 100644 --- a/modules/nf-core/bcftools/filter/meta.yml +++ b/modules/nf-core/bcftools/filter/meta.yml @@ -39,3 +39,6 @@ output: authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/bcftools/mpileup/environment.yml b/modules/nf-core/bcftools/mpileup/environment.yml new file mode 100644 index 00000000..114390be --- /dev/null +++ b/modules/nf-core/bcftools/mpileup/environment.yml @@ -0,0 +1,7 @@ +name: bcftools_mpileup +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::bcftools=1.18 diff --git a/modules/nf-core/bcftools/mpileup/main.nf b/modules/nf-core/bcftools/mpileup/main.nf index c9e42c4d..5e57644a 100644 --- a/modules/nf-core/bcftools/mpileup/main.nf +++ b/modules/nf-core/bcftools/mpileup/main.nf @@ -2,14 +2,14 @@ process BCFTOOLS_MPILEUP { tag "$meta.id" label 'process_medium' - conda "bioconda::bcftools=1.16" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bcftools:1.16--hfe4b78e_1': - 'quay.io/biocontainers/bcftools:1.16--hfe4b78e_1' }" + 'https://depot.galaxyproject.org/singularity/bcftools:1.18--h8b25389_0': + 'biocontainers/bcftools:1.18--h8b25389_0' }" input: tuple val(meta), path(bam), path(intervals) - path fasta + tuple val(meta2), path(fasta) val save_mpileup output: diff --git a/modules/nf-core/bcftools/mpileup/meta.yml b/modules/nf-core/bcftools/mpileup/meta.yml index 5619a6f5..65410ddd 100644 --- a/modules/nf-core/bcftools/mpileup/meta.yml +++ b/modules/nf-core/bcftools/mpileup/meta.yml @@ -25,6 +25,10 @@ input: - intervals: type: file description: Input intervals file. A file (commonly '.bed') containing regions to subset + - meta: + type: map + description: | + Groovy Map containing information about the genome fasta, e.g. [ id: 'sarscov2' ] - fasta: type: file description: FASTA reference file @@ -61,3 +65,6 @@ output: authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/bcftools/mpileup/tests/main.nf.test b/modules/nf-core/bcftools/mpileup/tests/main.nf.test new file mode 100644 index 00000000..6478bbc2 --- /dev/null +++ b/modules/nf-core/bcftools/mpileup/tests/main.nf.test @@ -0,0 +1,116 @@ +nextflow_process { + + name "Test Process BCFTOOLS_MPILEUP" + script "../main.nf" + process "BCFTOOLS_MPILEUP" + + tag "modules" + tag "modules_nfcore" + tag "bcftools" + tag "bcftools/mpileup" + + config "./nextflow.config" + + test("sarscov2 - [bam, []], fasta, false") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + [] + ] + input[1] = [ + [ id:'sarscov2' ], // meta map + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.vcf, + process.out.tbi, + process.out.stats, + process.out.mpileup, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [bam, []], fasta, true") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + [] + ] + input[1] = [ + [ id:'sarscov2' ], // meta map + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = true + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.vcf, + process.out.tbi, + process.out.stats, + process.out.mpileup, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [bam, bed], fasta, false") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true) + ] + input[1] = [ + [ id:'sarscov2' ], // meta map + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.vcf, + process.out.tbi, + process.out.stats, + process.out.mpileup, + process.out.versions + ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/bcftools/mpileup/tests/main.nf.test.snap b/modules/nf-core/bcftools/mpileup/tests/main.nf.test.snap new file mode 100644 index 00000000..ef80ab1b --- /dev/null +++ b/modules/nf-core/bcftools/mpileup/tests/main.nf.test.snap @@ -0,0 +1,112 @@ +{ + "sarscov2 - [bam, []], fasta, true": { + "content": [ + [ + [ + { + "id": "test" + }, + "test.vcf.gz:md5,0f2f2c8488e97e7f13979380d5d3b6b5" + ] + ], + [ + [ + { + "id": "test" + }, + "test.vcf.gz.tbi:md5,34cb2eeb73f4d2b98218acecebd92704" + ] + ], + [ + [ + { + "id": "test" + }, + "test.bcftools_stats.txt:md5,a988fbcd2ea5d1ce30970dcb60a77ed7" + ] + ], + [ + [ + { + "id": "test" + }, + "test.mpileup.gz:md5,73b4a00398bddab2cd065b40d17ca4dc" + ] + ], + [ + "versions.yml:md5,e09c59d941374bb293aadc36e2f29dbf" + ] + ], + "timestamp": "2023-11-29T14:11:54.549517279" + }, + "sarscov2 - [bam, bed], fasta, false": { + "content": [ + [ + [ + { + "id": "test" + }, + "test.vcf.gz:md5,687244dbf71d05b3b973ab08ecf05310" + ] + ], + [ + [ + { + "id": "test" + }, + "test.vcf.gz.tbi:md5,3785df15f3d7faf35f3ad70d167a50f7" + ] + ], + [ + [ + { + "id": "test" + }, + "test.bcftools_stats.txt:md5,f8c5ab149c4bf0e5f51c518346cb87b5" + ] + ], + [ + + ], + [ + "versions.yml:md5,e09c59d941374bb293aadc36e2f29dbf" + ] + ], + "timestamp": "2023-11-29T14:12:00.865439661" + }, + "sarscov2 - [bam, []], fasta, false": { + "content": [ + [ + [ + { + "id": "test" + }, + "test.vcf.gz:md5,0f2f2c8488e97e7f13979380d5d3b6b5" + ] + ], + [ + [ + { + "id": "test" + }, + "test.vcf.gz.tbi:md5,34cb2eeb73f4d2b98218acecebd92704" + ] + ], + [ + [ + { + "id": "test" + }, + "test.bcftools_stats.txt:md5,a988fbcd2ea5d1ce30970dcb60a77ed7" + ] + ], + [ + + ], + [ + "versions.yml:md5,e09c59d941374bb293aadc36e2f29dbf" + ] + ], + "timestamp": "2023-11-29T14:11:47.814900494" + } +} \ No newline at end of file diff --git a/modules/nf-core/bcftools/mpileup/tests/nextflow.config b/modules/nf-core/bcftools/mpileup/tests/nextflow.config new file mode 100644 index 00000000..a7ba19fe --- /dev/null +++ b/modules/nf-core/bcftools/mpileup/tests/nextflow.config @@ -0,0 +1,4 @@ +process { + ext.args2 = '--no-version --ploidy 1 --multiallelic-caller' + ext.args3 = '--no-version' +} \ No newline at end of file diff --git a/modules/nf-core/bcftools/mpileup/tests/tags.yml b/modules/nf-core/bcftools/mpileup/tests/tags.yml new file mode 100644 index 00000000..07b91f98 --- /dev/null +++ b/modules/nf-core/bcftools/mpileup/tests/tags.yml @@ -0,0 +1,2 @@ +bcftools/mpileup: + - "modules/nf-core/bcftools/mpileup/**" diff --git a/modules/nf-core/bcftools/norm/environment.yml b/modules/nf-core/bcftools/norm/environment.yml new file mode 100644 index 00000000..fe80e4e7 --- /dev/null +++ b/modules/nf-core/bcftools/norm/environment.yml @@ -0,0 +1,7 @@ +name: bcftools_norm +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::bcftools=1.18 diff --git a/modules/nf-core/bcftools/norm/main.nf b/modules/nf-core/bcftools/norm/main.nf index 90387d6c..47d3dab1 100644 --- a/modules/nf-core/bcftools/norm/main.nf +++ b/modules/nf-core/bcftools/norm/main.nf @@ -2,14 +2,14 @@ process BCFTOOLS_NORM { tag "$meta.id" label 'process_medium' - conda "bioconda::bcftools=1.16" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bcftools:1.16--hfe4b78e_1': - 'quay.io/biocontainers/bcftools:1.16--hfe4b78e_1' }" + 'https://depot.galaxyproject.org/singularity/bcftools:1.18--h8b25389_0': + 'biocontainers/bcftools:1.18--h8b25389_0' }" input: tuple val(meta), path(vcf), path(tbi) - path(fasta) + tuple val(meta2), path(fasta) output: tuple val(meta), path("*.{vcf,vcf.gz,bcf,bcf.gz}") , emit: vcf diff --git a/modules/nf-core/bcftools/norm/meta.yml b/modules/nf-core/bcftools/norm/meta.yml index c3ea2c03..1f3e1b62 100644 --- a/modules/nf-core/bcftools/norm/meta.yml +++ b/modules/nf-core/bcftools/norm/meta.yml @@ -30,6 +30,11 @@ input: description: | An optional index of the VCF file (for when the VCF is compressed) pattern: "*.vcf.gz.tbi" + - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] - fasta: type: file description: FASTA reference file @@ -50,3 +55,7 @@ output: pattern: "versions.yml" authors: - "@abhi18av" + - "@ramprasadn" +maintainers: + - "@abhi18av" + - "@ramprasadn" diff --git a/modules/nf-core/bcftools/query/environment.yml b/modules/nf-core/bcftools/query/environment.yml new file mode 100644 index 00000000..4f9661ca --- /dev/null +++ b/modules/nf-core/bcftools/query/environment.yml @@ -0,0 +1,7 @@ +name: bcftools_query +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::bcftools=1.18 diff --git a/modules/nf-core/bcftools/query/main.nf b/modules/nf-core/bcftools/query/main.nf index 5a917b3e..e9e73a6a 100644 --- a/modules/nf-core/bcftools/query/main.nf +++ b/modules/nf-core/bcftools/query/main.nf @@ -1,11 +1,11 @@ process BCFTOOLS_QUERY { tag "$meta.id" - label 'process_medium' + label 'process_single' - conda "bioconda::bcftools=1.16" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bcftools:1.16--hfe4b78e_1': - 'quay.io/biocontainers/bcftools:1.16--hfe4b78e_1' }" + 'https://depot.galaxyproject.org/singularity/bcftools:1.18--h8b25389_0': + 'biocontainers/bcftools:1.18--h8b25389_0' }" input: tuple val(meta), path(vcf), path(tbi) @@ -14,8 +14,8 @@ process BCFTOOLS_QUERY { path samples output: - tuple val(meta), path("*.txt"), emit: txt - path "versions.yml" , emit: versions + tuple val(meta), path("*.${suffix}"), emit: output + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when @@ -23,17 +23,30 @@ process BCFTOOLS_QUERY { script: def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" + suffix = task.ext.suffix ?: "txt" def regions_file = regions ? "--regions-file ${regions}" : "" def targets_file = targets ? "--targets-file ${targets}" : "" def samples_file = samples ? "--samples-file ${samples}" : "" """ bcftools query \\ - --output ${prefix}.txt \\ $regions_file \\ $targets_file \\ $samples_file \\ $args \\ - $vcf + $vcf \\ + > ${prefix}.${suffix} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bcftools: \$(bcftools --version 2>&1 | head -n1 | sed 's/^.*bcftools //; s/ .*\$//') + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + suffix = task.ext.suffix ?: "txt" + """ + touch ${prefix}.${suffix} \\ cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/bcftools/query/meta.yml b/modules/nf-core/bcftools/query/meta.yml index fd4fd473..303ef610 100644 --- a/modules/nf-core/bcftools/query/meta.yml +++ b/modules/nf-core/bcftools/query/meta.yml @@ -48,10 +48,9 @@ output: description: | Groovy Map containing sample information e.g. [ id:'test', single_end:false ] - - txt: + - output: type: file description: BCFTools query output file - pattern: "*.txt" - versions: type: file description: File containing software versions @@ -59,3 +58,6 @@ output: authors: - "@abhi18av" - "@drpatelh" +maintainers: + - "@abhi18av" + - "@drpatelh" diff --git a/modules/nf-core/bcftools/query/tests/main.nf.test b/modules/nf-core/bcftools/query/tests/main.nf.test new file mode 100644 index 00000000..e9ea5a9d --- /dev/null +++ b/modules/nf-core/bcftools/query/tests/main.nf.test @@ -0,0 +1,101 @@ +nextflow_process { + + name "Test Process BCFTOOLS_QUERY" + script "../main.nf" + process "BCFTOOLS_QUERY" + + tag "modules" + tag "modules_nfcore" + tag "bcftools" + tag "bcftools/query" + + config "./nextflow.config" + + test("sarscov2 - [vcf, tbi], [], [], []") { + + when { + process { + """ + input[0] = [ + [ id:'out' ], // meta map + file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_vcf_gz_tbi'], checkIfExists: true) + ] + input[1] = [] + input[2] = [] + input[3] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.output, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [vcf, tbi], vcf, tsv, []") { + + when { + process { + """ + input[0] = [ + [ id:'out' ], // meta map + file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_vcf_gz_tbi'], checkIfExists: true) + ] + input[1] = file(params.test_data['sarscov2']['illumina']['test3_vcf_gz'], checkIfExists: true) + input[2] = file(params.test_data['sarscov2']['illumina']['test2_vcf_targets_tsv_gz'], checkIfExists: true) + input[3] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.output, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [vcf, tbi], [], [], [] - stub") { + + when { + process { + """ + input[0] = [ + [ id:'out' ], // meta map + file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_vcf_gz_tbi'], checkIfExists: true) + ] + input[1] = [] + input[2] = [] + input[3] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.output[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/bcftools/query/tests/main.nf.test.snap b/modules/nf-core/bcftools/query/tests/main.nf.test.snap new file mode 100644 index 00000000..a19f2053 --- /dev/null +++ b/modules/nf-core/bcftools/query/tests/main.nf.test.snap @@ -0,0 +1,43 @@ +{ + "sarscov2 - [vcf, tbi], vcf, tsv, []": { + "content": [ + [ + [ + { + "id": "out" + }, + "out.txt:md5,75a6bd0084e2e1838cf7baba11b99d19" + ] + ], + [ + "versions.yml:md5,b40206d5437ce4b044d15c47ddd93d8e" + ] + ], + "timestamp": "2023-11-29T14:21:05.191946862" + }, + "sarscov2 - [vcf, tbi], [], [], [] - stub": { + "content": [ + "out.txt", + [ + "versions.yml:md5,b40206d5437ce4b044d15c47ddd93d8e" + ] + ], + "timestamp": "2023-11-29T14:21:11.169603542" + }, + "sarscov2 - [vcf, tbi], [], [], []": { + "content": [ + [ + [ + { + "id": "out" + }, + "out.txt:md5,87a2ab194e1ee3219b44e58429ec3307" + ] + ], + [ + "versions.yml:md5,b40206d5437ce4b044d15c47ddd93d8e" + ] + ], + "timestamp": "2023-11-29T14:20:59.335041418" + } +} \ No newline at end of file diff --git a/modules/nf-core/bcftools/query/tests/nextflow.config b/modules/nf-core/bcftools/query/tests/nextflow.config new file mode 100644 index 00000000..da81c2a0 --- /dev/null +++ b/modules/nf-core/bcftools/query/tests/nextflow.config @@ -0,0 +1,3 @@ +process { + ext.args = "-f '%CHROM %POS %REF %ALT[%SAMPLE=%GT]'" +} \ No newline at end of file diff --git a/modules/nf-core/bcftools/query/tests/tags.yml b/modules/nf-core/bcftools/query/tests/tags.yml new file mode 100644 index 00000000..fb9455cb --- /dev/null +++ b/modules/nf-core/bcftools/query/tests/tags.yml @@ -0,0 +1,2 @@ +bcftools/query: + - "modules/nf-core/bcftools/query/**" diff --git a/modules/nf-core/bcftools/sort/environment.yml b/modules/nf-core/bcftools/sort/environment.yml new file mode 100644 index 00000000..89cf911d --- /dev/null +++ b/modules/nf-core/bcftools/sort/environment.yml @@ -0,0 +1,7 @@ +name: bcftools_sort +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::bcftools=1.18 diff --git a/modules/nf-core/bcftools/sort/main.nf b/modules/nf-core/bcftools/sort/main.nf index 9ae3253b..c982944c 100644 --- a/modules/nf-core/bcftools/sort/main.nf +++ b/modules/nf-core/bcftools/sort/main.nf @@ -2,10 +2,10 @@ process BCFTOOLS_SORT { tag "$meta.id" label 'process_medium' - conda "bioconda::bcftools=1.16" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bcftools:1.16--hfe4b78e_1': - 'quay.io/biocontainers/bcftools:1.16--hfe4b78e_1' }" + 'https://depot.galaxyproject.org/singularity/bcftools:1.18--h8b25389_0': + 'biocontainers/bcftools:1.18--h8b25389_0' }" input: tuple val(meta), path(vcf) @@ -30,6 +30,7 @@ process BCFTOOLS_SORT { bcftools \\ sort \\ --output ${prefix}.${extension} \\ + --temp-dir . \\ $args \\ $vcf diff --git a/modules/nf-core/bcftools/sort/meta.yml b/modules/nf-core/bcftools/sort/meta.yml index 0c244a48..84747c6d 100644 --- a/modules/nf-core/bcftools/sort/meta.yml +++ b/modules/nf-core/bcftools/sort/meta.yml @@ -12,7 +12,6 @@ tools: tool_dev_url: https://github.com/samtools/bcftools doi: "10.1093/bioinformatics/btp352" licence: ["MIT"] - input: - meta: type: map @@ -23,7 +22,6 @@ input: type: file description: The VCF/BCF file to be sorted pattern: "*.{vcf.gz,vcf,bcf}" - output: - meta: type: map @@ -38,6 +36,7 @@ output: type: file description: Sorted VCF file pattern: "*.{vcf.gz}" - authors: - "@Gwennid" +maintainers: + - "@Gwennid" diff --git a/modules/nf-core/bcftools/stats/environment.yml b/modules/nf-core/bcftools/stats/environment.yml new file mode 100644 index 00000000..1a969528 --- /dev/null +++ b/modules/nf-core/bcftools/stats/environment.yml @@ -0,0 +1,7 @@ +name: bcftools_stats +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::bcftools=1.18 diff --git a/modules/nf-core/bcftools/stats/main.nf b/modules/nf-core/bcftools/stats/main.nf index 51e9c91c..ffa1df64 100644 --- a/modules/nf-core/bcftools/stats/main.nf +++ b/modules/nf-core/bcftools/stats/main.nf @@ -2,16 +2,18 @@ process BCFTOOLS_STATS { tag "$meta.id" label 'process_single' - conda "bioconda::bcftools=1.16" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bcftools:1.16--hfe4b78e_1': - 'quay.io/biocontainers/bcftools:1.16--hfe4b78e_1' }" + 'https://depot.galaxyproject.org/singularity/bcftools:1.18--h8b25389_0': + 'biocontainers/bcftools:1.18--h8b25389_0' }" input: - tuple val(meta), path(vcf), path(tbi) - path regions - path targets - path samples + tuple val(meta), path(vcf), path(tbi) + tuple val(meta2), path(regions) + tuple val(meta3), path(targets) + tuple val(meta4), path(samples) + tuple val(meta5), path(exons) + tuple val(meta6), path(fasta) output: tuple val(meta), path("*stats.txt"), emit: stats @@ -26,12 +28,16 @@ process BCFTOOLS_STATS { def regions_file = regions ? "--regions-file ${regions}" : "" def targets_file = targets ? "--targets-file ${targets}" : "" def samples_file = samples ? "--samples-file ${samples}" : "" + def reference_fasta = fasta ? "--fasta-ref ${fasta}" : "" + def exons_file = exons ? "--exons ${exons}" : "" """ bcftools stats \\ $args \\ $regions_file \\ $targets_file \\ $samples_file \\ + $reference_fasta \\ + $exons_file \\ $vcf > ${prefix}.bcftools_stats.txt cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/bcftools/stats/meta.yml b/modules/nf-core/bcftools/stats/meta.yml index f7afcd50..7ea2103e 100644 --- a/modules/nf-core/bcftools/stats/meta.yml +++ b/modules/nf-core/bcftools/stats/meta.yml @@ -41,6 +41,16 @@ input: description: | Optional, file of sample names to be included or excluded. e.g. 'file.tsv' + - exons: + type: file + description: | + Tab-delimited file with exons for indel frameshifts (chr,beg,end; 1-based, inclusive, optionally bgzip compressed). + e.g. 'exons.tsv.gz' + - fasta: + type: file + description: | + Faidx indexed reference sequence file to determine INDEL context. + e.g. 'reference.fa' output: - meta: type: map @@ -59,3 +69,9 @@ authors: - "@joseespinosa" - "@drpatelh" - "@SusiJo" + - "@TCLamnidis" +maintainers: + - "@joseespinosa" + - "@drpatelh" + - "@SusiJo" + - "@TCLamnidis" diff --git a/modules/nf-core/bedtools/getfasta/environment.yml b/modules/nf-core/bedtools/getfasta/environment.yml new file mode 100644 index 00000000..a89401f2 --- /dev/null +++ b/modules/nf-core/bedtools/getfasta/environment.yml @@ -0,0 +1,7 @@ +name: bedtools_getfasta +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::bedtools=2.31.1 diff --git a/modules/nf-core/bedtools/getfasta/main.nf b/modules/nf-core/bedtools/getfasta/main.nf index 57e7f0de..50549c7d 100644 --- a/modules/nf-core/bedtools/getfasta/main.nf +++ b/modules/nf-core/bedtools/getfasta/main.nf @@ -2,10 +2,10 @@ process BEDTOOLS_GETFASTA { tag "$bed" label 'process_single' - conda "bioconda::bedtools=2.30.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bedtools:2.30.0--hc088bd4_0' : - 'quay.io/biocontainers/bedtools:2.30.0--hc088bd4_0' }" + 'https://depot.galaxyproject.org/singularity/bedtools:2.31.1--hf5e1c6e_0' : + 'biocontainers/bedtools:2.31.1--hf5e1c6e_0' }" input: path bed diff --git a/modules/nf-core/bedtools/getfasta/meta.yml b/modules/nf-core/bedtools/getfasta/meta.yml index 11335100..25fb19a1 100644 --- a/modules/nf-core/bedtools/getfasta/meta.yml +++ b/modules/nf-core/bedtools/getfasta/meta.yml @@ -19,7 +19,6 @@ input: type: file description: Input fasta file pattern: "*.{fa,fasta}" - output: - fasta: type: file @@ -32,3 +31,6 @@ output: authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/bedtools/maskfasta/environment.yml b/modules/nf-core/bedtools/maskfasta/environment.yml new file mode 100644 index 00000000..71d18917 --- /dev/null +++ b/modules/nf-core/bedtools/maskfasta/environment.yml @@ -0,0 +1,7 @@ +name: bedtools_maskfasta +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::bedtools=2.31.1 diff --git a/modules/nf-core/bedtools/maskfasta/main.nf b/modules/nf-core/bedtools/maskfasta/main.nf index a84a23c1..9511a8d8 100644 --- a/modules/nf-core/bedtools/maskfasta/main.nf +++ b/modules/nf-core/bedtools/maskfasta/main.nf @@ -2,10 +2,10 @@ process BEDTOOLS_MASKFASTA { tag "$meta.id" label 'process_single' - conda "bioconda::bedtools=2.30.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bedtools:2.30.0--hc088bd4_0' : - 'quay.io/biocontainers/bedtools:2.30.0--hc088bd4_0' }" + 'https://depot.galaxyproject.org/singularity/bedtools:2.31.1--hf5e1c6e_0' : + 'biocontainers/bedtools:2.31.1--hf5e1c6e_0' }" input: tuple val(meta), path(bed) diff --git a/modules/nf-core/bedtools/maskfasta/meta.yml b/modules/nf-core/bedtools/maskfasta/meta.yml index cc33df3e..94f81aba 100644 --- a/modules/nf-core/bedtools/maskfasta/meta.yml +++ b/modules/nf-core/bedtools/maskfasta/meta.yml @@ -24,7 +24,6 @@ input: type: file description: Input fasta file pattern: "*.{fa,fasta}" - output: - meta: type: map @@ -42,3 +41,6 @@ output: authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/bedtools/merge/environment.yml b/modules/nf-core/bedtools/merge/environment.yml new file mode 100644 index 00000000..99707878 --- /dev/null +++ b/modules/nf-core/bedtools/merge/environment.yml @@ -0,0 +1,7 @@ +name: bedtools_merge +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::bedtools=2.31.1 diff --git a/modules/nf-core/bedtools/merge/main.nf b/modules/nf-core/bedtools/merge/main.nf index 21b2e645..5310647d 100644 --- a/modules/nf-core/bedtools/merge/main.nf +++ b/modules/nf-core/bedtools/merge/main.nf @@ -2,10 +2,10 @@ process BEDTOOLS_MERGE { tag "$meta.id" label 'process_single' - conda "bioconda::bedtools=2.30.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bedtools:2.30.0--hc088bd4_0' : - 'quay.io/biocontainers/bedtools:2.30.0--hc088bd4_0' }" + 'https://depot.galaxyproject.org/singularity/bedtools:2.31.1--hf5e1c6e_0' : + 'biocontainers/bedtools:2.31.1--hf5e1c6e_0' }" input: tuple val(meta), path(bed) @@ -33,4 +33,15 @@ process BEDTOOLS_MERGE { bedtools: \$(bedtools --version | sed -e "s/bedtools v//g") END_VERSIONS """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.bed + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bedtools: \$(bedtools --version | sed -e "s/bedtools v//g") + END_VERSIONS + """ } diff --git a/modules/nf-core/bedtools/merge/meta.yml b/modules/nf-core/bedtools/merge/meta.yml index 76743679..5565ce48 100644 --- a/modules/nf-core/bedtools/merge/meta.yml +++ b/modules/nf-core/bedtools/merge/meta.yml @@ -3,6 +3,8 @@ description: combines overlapping or “book-ended” features in an interval fi keywords: - bed - merge + - bedtools + - overlapped bed tools: - bedtools: description: | @@ -37,3 +39,7 @@ authors: - "@Emiller88" - "@sruthipsuresh" - "@drpatelh" +maintainers: + - "@Emiller88" + - "@sruthipsuresh" + - "@drpatelh" diff --git a/modules/nf-core/blast/blastn/environment.yml b/modules/nf-core/blast/blastn/environment.yml new file mode 100644 index 00000000..cb9b15dd --- /dev/null +++ b/modules/nf-core/blast/blastn/environment.yml @@ -0,0 +1,7 @@ +name: blast_blastn +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::blast=2.14.1 diff --git a/modules/nf-core/blast/blastn/main.nf b/modules/nf-core/blast/blastn/main.nf index 5f35422a..e8b96add 100644 --- a/modules/nf-core/blast/blastn/main.nf +++ b/modules/nf-core/blast/blastn/main.nf @@ -2,18 +2,18 @@ process BLAST_BLASTN { tag "$meta.id" label 'process_medium' - conda "bioconda::blast=2.13.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/blast:2.13.0--hf3cf87c_0' : - 'quay.io/biocontainers/blast:2.13.0--hf3cf87c_0' }" + 'https://depot.galaxyproject.org/singularity/blast:2.14.1--pl5321h6f7f691_0': + 'biocontainers/blast:2.14.1--pl5321h6f7f691_0' }" input: - tuple val(meta), path(fasta) - path db + tuple val(meta) , path(fasta) + tuple val(meta2), path(db) output: - tuple val(meta), path('*.blastn.txt'), emit: txt - path "versions.yml" , emit: versions + tuple val(meta), path('*.txt'), emit: txt + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when @@ -21,14 +21,34 @@ process BLAST_BLASTN { script: def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" + def is_compressed = fasta.getExtension() == "gz" ? true : false + def fasta_name = is_compressed ? fasta.getBaseName() : fasta + """ - DB=`find -L ./ -name "*.ndb" | sed 's/\\.ndb\$//'` + if [ "${is_compressed}" == "true" ]; then + gzip -c -d ${fasta} > ${fasta_name} + fi + + DB=`find -L ./ -name "*.nin" | sed 's/\\.nin\$//'` blastn \\ - -num_threads $task.cpus \\ + -num_threads ${task.cpus} \\ -db \$DB \\ - -query $fasta \\ - $args \\ - -out ${prefix}.blastn.txt + -query ${fasta_name} \\ + ${args} \\ + -out ${prefix}.txt + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + blast: \$(blastn -version 2>&1 | sed 's/^.*blastn: //; s/ .*\$//') + END_VERSIONS + """ + + stub: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.txt + cat <<-END_VERSIONS > versions.yml "${task.process}": blast: \$(blastn -version 2>&1 | sed 's/^.*blastn: //; s/ .*\$//') diff --git a/modules/nf-core/blast/blastn/meta.yml b/modules/nf-core/blast/blastn/meta.yml index 2742278d..a0d64dd6 100644 --- a/modules/nf-core/blast/blastn/meta.yml +++ b/modules/nf-core/blast/blastn/meta.yml @@ -22,16 +22,26 @@ input: - fasta: type: file description: Input fasta file containing queries sequences - pattern: "*.{fa,fasta}" + pattern: "*.{fa,fasta,fa.gz,fasta.gz}" + - meta2: + type: map + description: | + Groovy Map containing db information + e.g. [ id:'test2', single_end:false ] - db: type: directory - description: Directory containing blast database + description: Directory containing the blast database pattern: "*" output: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] - txt: type: file description: File containing blastn hits - pattern: "*.{blastn.txt}" + pattern: "*.txt" - versions: type: file description: File containing software versions @@ -39,3 +49,7 @@ output: authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" + - "@vagkaratzas" diff --git a/modules/nf-core/blast/blastn/tests/main.nf.test b/modules/nf-core/blast/blastn/tests/main.nf.test new file mode 100644 index 00000000..0e909a7e --- /dev/null +++ b/modules/nf-core/blast/blastn/tests/main.nf.test @@ -0,0 +1,71 @@ +nextflow_process { + + name "Test Process BLAST_BLASTN" + script "../main.nf" + process "BLAST_BLASTN" + config "./nextflow.config" + tag "modules" + tag "modules_nfcore" + tag "blast" + tag "blast/blastn" + + setup { + run("BLAST_MAKEBLASTDB") { + script "../../makeblastdb/main.nf" + process { + """ + input[0] = [ [id:'test2'], file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) ] + """ + } + } + } + + test("Should search for nucleotide hits against a blast db") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ [id:'test'], file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) ] + input[1] = BLAST_MAKEBLASTDB.out.db + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.txt[0][1]).getText().contains("Query= MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate") }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + + } + + test("Should search for zipped nucleotide hits against a blast db") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ [id:'test'], file(params.test_data['sarscov2']['genome']['genome_fasta_gz'], checkIfExists: true) ] + input[1] = BLAST_MAKEBLASTDB.out.db + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.txt[0][1]).getText().contains("Query= MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate") }, + { assert snapshot(process.out.versions).match("versions_zipped") } + ) + } + + } + +} diff --git a/modules/nf-core/blast/blastn/tests/main.nf.test.snap b/modules/nf-core/blast/blastn/tests/main.nf.test.snap new file mode 100644 index 00000000..d1b5f3f2 --- /dev/null +++ b/modules/nf-core/blast/blastn/tests/main.nf.test.snap @@ -0,0 +1,18 @@ +{ + "versions": { + "content": [ + [ + "versions.yml:md5,2d5ffadc7035672f6a9e00b01d1751ea" + ] + ], + "timestamp": "2023-12-11T07:20:03.54997013" + }, + "versions_zipped": { + "content": [ + [ + "versions.yml:md5,2d5ffadc7035672f6a9e00b01d1751ea" + ] + ], + "timestamp": "2023-12-11T07:20:12.925782708" + } +} \ No newline at end of file diff --git a/modules/nf-core/blast/blastn/tests/nextflow.config b/modules/nf-core/blast/blastn/tests/nextflow.config new file mode 100644 index 00000000..0899289b --- /dev/null +++ b/modules/nf-core/blast/blastn/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: BLAST_MAKEBLASTDB { + ext.args = '-dbtype nucl' + } +} diff --git a/modules/nf-core/blast/blastn/tests/tags.yml b/modules/nf-core/blast/blastn/tests/tags.yml new file mode 100644 index 00000000..b4588ab8 --- /dev/null +++ b/modules/nf-core/blast/blastn/tests/tags.yml @@ -0,0 +1,2 @@ +blast/blastn: + - modules/nf-core/blast/blastn/** diff --git a/modules/nf-core/blast/makeblastdb/environment.yml b/modules/nf-core/blast/makeblastdb/environment.yml new file mode 100644 index 00000000..cf84a60e --- /dev/null +++ b/modules/nf-core/blast/makeblastdb/environment.yml @@ -0,0 +1,7 @@ +name: blast_makeblastdb +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::blast=2.14.1 diff --git a/modules/nf-core/blast/makeblastdb/main.nf b/modules/nf-core/blast/makeblastdb/main.nf index 62abd813..cd1083d0 100644 --- a/modules/nf-core/blast/makeblastdb/main.nf +++ b/modules/nf-core/blast/makeblastdb/main.nf @@ -1,30 +1,62 @@ process BLAST_MAKEBLASTDB { - tag "$fasta" + tag "$meta.id" label 'process_medium' - conda "bioconda::blast=2.13.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/blast:2.13.0--hf3cf87c_0' : - 'quay.io/biocontainers/blast:2.13.0--hf3cf87c_0' }" + 'https://depot.galaxyproject.org/singularity/blast:2.14.1--pl5321h6f7f691_0': + 'biocontainers/blast:2.14.1--pl5321h6f7f691_0' }" input: - path fasta + tuple val(meta), path(fasta) output: - path 'blast_db' , emit: db - path "versions.yml" , emit: versions + tuple val(meta), path("${meta.id}"), emit: db + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when script: def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def is_compressed = fasta.getExtension() == "gz" ? true : false + def fasta_name = is_compressed ? fasta.getBaseName() : fasta """ + if [ "${is_compressed}" == "true" ]; then + gzip -c -d ${fasta} > ${fasta_name} + fi + makeblastdb \\ - -in $fasta \\ - $args - mkdir blast_db - mv ${fasta}* blast_db + -in ${fasta_name} \\ + ${args} + mkdir ${prefix} + mv ${fasta_name}* ${prefix} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + blast: \$(blastn -version 2>&1 | sed 's/^.*blastn: //; s/ .*\$//') + END_VERSIONS + """ + + stub: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def is_compressed = fasta.getExtension() == "gz" ? true : false + def fasta_name = is_compressed ? fasta.getBaseName() : fasta + """ + touch ${fasta_name}.fasta + touch ${fasta_name}.fasta.ndb + touch ${fasta_name}.fasta.nhr + touch ${fasta_name}.fasta.nin + touch ${fasta_name}.fasta.njs + touch ${fasta_name}.fasta.not + touch ${fasta_name}.fasta.nsq + touch ${fasta_name}.fasta.ntf + touch ${fasta_name}.fasta.nto + mkdir ${prefix} + mv ${fasta_name}* ${prefix} + cat <<-END_VERSIONS > versions.yml "${task.process}": blast: \$(blastn -version 2>&1 | sed 's/^.*blastn: //; s/ .*\$//') diff --git a/modules/nf-core/blast/makeblastdb/meta.yml b/modules/nf-core/blast/makeblastdb/meta.yml index 83c4b292..9ed63901 100644 --- a/modules/nf-core/blast/makeblastdb/meta.yml +++ b/modules/nf-core/blast/makeblastdb/meta.yml @@ -13,11 +13,21 @@ tools: doi: 10.1016/S0022-2836(05)80360-2 licence: ["US-Government-Work"] input: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] - fasta: type: file description: Input fasta file - pattern: "*.{fa,fasta}" + pattern: "*.{fa,fasta,fa.gz,fasta.gz}" output: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] - db: type: directory description: Output directory containing blast database files @@ -29,3 +39,7 @@ output: authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" + - "@vagkaratzas" diff --git a/modules/nf-core/blast/makeblastdb/tests/main.nf.test b/modules/nf-core/blast/makeblastdb/tests/main.nf.test new file mode 100644 index 00000000..983b165f --- /dev/null +++ b/modules/nf-core/blast/makeblastdb/tests/main.nf.test @@ -0,0 +1,92 @@ +nextflow_process { + + name "Test Process BLAST_MAKEBLASTDB" + script "../main.nf" + process "BLAST_MAKEBLASTDB" + config "./nextflow.config" + tag "modules" + tag "modules_nfcore" + tag "blast" + tag "blast/makeblastdb" + + test("Should build a blast db folder from a fasta file") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ [id:'test'], file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert process.out.db + with(process.out.db) { + assert size() == 1 + with(get(0).get(1)) { + File folder = new File(get(0).get(1)) + File[] listOfFiles = folder.listFiles() + listOfFiles = listOfFiles.sort { it.name } + assert listOfFiles.length == 9 + assert snapshot("${get(0).get(1)}/${listOfFiles[0].name}").match("genome.fasta") + assert snapshot("${get(0).get(1)}/${listOfFiles[1].name}").match("genome.fasta.ndb") + assert snapshot("${get(0).get(1)}/${listOfFiles[2].name}").match("genome.fasta.nhr") + assert snapshot("${get(0).get(1)}/${listOfFiles[5].name}").match("genome.fasta.not") + assert snapshot("${get(0).get(1)}/${listOfFiles[6].name}").match("genome.fasta.nsq") + assert snapshot("${get(0).get(1)}/${listOfFiles[7].name}").match("genome.fasta.ntf") + assert snapshot("${get(0).get(1)}/${listOfFiles[8].name}").match("genome.fasta.nto") + } + } + }, + { assert process.out.versions } + ) + } + + } + + test("Should build a blast db folder from a zipped fasta file") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ [id:'test'], file(params.test_data['sarscov2']['genome']['genome_fasta_gz'], checkIfExists: true) ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert process.out.db + with(process.out.db) { + assert size() == 1 + with(get(0).get(1)) { + File folder = new File(get(0).get(1)) + File[] listOfFiles = folder.listFiles() + listOfFiles = listOfFiles.sort { it.name } + assert listOfFiles.length == 10 + assert snapshot("${get(0).get(1)}/${listOfFiles[0].name}").match("gz_genome.fasta") + assert snapshot("${get(0).get(1)}/${listOfFiles[2].name}").match("gz_genome.fasta.ndb") + assert snapshot("${get(0).get(1)}/${listOfFiles[3].name}").match("gz_genome.fasta.nhr") + assert snapshot("${get(0).get(1)}/${listOfFiles[6].name}").match("gz_genome.fasta.not") + assert snapshot("${get(0).get(1)}/${listOfFiles[7].name}").match("gz_genome.fasta.nsq") + assert snapshot("${get(0).get(1)}/${listOfFiles[8].name}").match("gz_genome.fasta.ntf") + assert snapshot("${get(0).get(1)}/${listOfFiles[9].name}").match("gz_genome.fasta.nto") + } + } + }, + { assert process.out.versions } + ) + } + + } + +} diff --git a/modules/nf-core/blast/makeblastdb/tests/main.nf.test.snap b/modules/nf-core/blast/makeblastdb/tests/main.nf.test.snap new file mode 100644 index 00000000..b6f040ed --- /dev/null +++ b/modules/nf-core/blast/makeblastdb/tests/main.nf.test.snap @@ -0,0 +1,86 @@ +{ + "genome.fasta": { + "content": [ + "genome.fasta:md5,6e9fe4042a72f2345f644f239272b7e6" + ], + "timestamp": "2023-11-07T12:52:38.457245596" + }, + "gz_genome.fasta.ntf": { + "content": [ + "genome.fasta.ntf:md5,de1250813f0c7affc6d12dac9d0fb6bb" + ], + "timestamp": "2023-11-07T12:58:02.121840034" + }, + "genome.fasta.not": { + "content": [ + "genome.fasta.not:md5,1e53e9d08f1d23af0299cfa87478a7bb" + ], + "timestamp": "2023-11-07T12:55:33.862012946" + }, + "genome.fasta.nhr": { + "content": [ + "genome.fasta.nhr:md5,f4b4ddb034fd3dd7b25c89e9d50c004e" + ], + "timestamp": "2023-11-07T12:55:33.857994517" + }, + "gz_genome.fasta.nhr": { + "content": [ + "genome.fasta.nhr:md5,f4b4ddb034fd3dd7b25c89e9d50c004e" + ], + "timestamp": "2023-11-07T12:58:02.102407993" + }, + "genome.fasta.ntf": { + "content": [ + "genome.fasta.ntf:md5,de1250813f0c7affc6d12dac9d0fb6bb" + ], + "timestamp": "2023-11-07T12:55:33.877288786" + }, + "gz_genome.fasta.not": { + "content": [ + "genome.fasta.not:md5,1e53e9d08f1d23af0299cfa87478a7bb" + ], + "timestamp": "2023-11-07T12:58:02.108135313" + }, + "gz_genome.fasta.ndb": { + "content": [ + "genome.fasta.ndb:md5,0d553c830656469211de113c5022f06d" + ], + "timestamp": "2023-11-07T12:58:02.094305556" + }, + "gz_genome.fasta.nsq": { + "content": [ + "genome.fasta.nsq:md5,982cbc7d9e38743b9b1037588862b9da" + ], + "timestamp": "2023-11-07T12:58:02.115010863" + }, + "genome.fasta.nto": { + "content": [ + "genome.fasta.nto:md5,33cdeccccebe80329f1fdbee7f5874cb" + ], + "timestamp": "2023-11-07T12:55:33.890761822" + }, + "gz_genome.fasta.nto": { + "content": [ + "genome.fasta.nto:md5,33cdeccccebe80329f1fdbee7f5874cb" + ], + "timestamp": "2023-11-07T12:58:02.12931429" + }, + "genome.fasta.ndb": { + "content": [ + "genome.fasta.ndb:md5,0d553c830656469211de113c5022f06d" + ], + "timestamp": "2023-11-07T12:55:33.853303997" + }, + "genome.fasta.nsq": { + "content": [ + "genome.fasta.nsq:md5,982cbc7d9e38743b9b1037588862b9da" + ], + "timestamp": "2023-11-07T12:55:33.866667927" + }, + "gz_genome.fasta": { + "content": [ + "genome.fasta:md5,6e9fe4042a72f2345f644f239272b7e6" + ], + "timestamp": "2023-11-07T12:58:02.081764854" + } +} \ No newline at end of file diff --git a/modules/nf-core/blast/makeblastdb/tests/nextflow.config b/modules/nf-core/blast/makeblastdb/tests/nextflow.config new file mode 100644 index 00000000..0899289b --- /dev/null +++ b/modules/nf-core/blast/makeblastdb/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: BLAST_MAKEBLASTDB { + ext.args = '-dbtype nucl' + } +} diff --git a/modules/nf-core/blast/makeblastdb/tests/tags.yml b/modules/nf-core/blast/makeblastdb/tests/tags.yml new file mode 100644 index 00000000..ab74c02a --- /dev/null +++ b/modules/nf-core/blast/makeblastdb/tests/tags.yml @@ -0,0 +1,2 @@ +blast/makeblastdb: + - modules/nf-core/blast/makeblastdb/** diff --git a/modules/nf-core/bowtie2/align/environment.yml b/modules/nf-core/bowtie2/align/environment.yml new file mode 100644 index 00000000..d2796359 --- /dev/null +++ b/modules/nf-core/bowtie2/align/environment.yml @@ -0,0 +1,9 @@ +name: bowtie2_align +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::bowtie2=2.5.2 + - bioconda::samtools=1.18 + - conda-forge::pigz=2.6 diff --git a/modules/nf-core/bowtie2/align/main.nf b/modules/nf-core/bowtie2/align/main.nf index 3d851866..8c405ee3 100644 --- a/modules/nf-core/bowtie2/align/main.nf +++ b/modules/nf-core/bowtie2/align/main.nf @@ -2,10 +2,10 @@ process BOWTIE2_ALIGN { tag "$meta.id" label "process_high" - conda "bioconda::bowtie2=2.4.4 bioconda::samtools=1.16.1 conda-forge::pigz=2.6" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-ac74a7f02cebcfcc07d8e8d1d750af9c83b4d45a:a0ffedb52808e102887f6ce600d092675bf3528a-0' : - 'quay.io/biocontainers/mulled-v2-ac74a7f02cebcfcc07d8e8d1d750af9c83b4d45a:a0ffedb52808e102887f6ce600d092675bf3528a-0' }" + 'https://depot.galaxyproject.org/singularity/mulled-v2-ac74a7f02cebcfcc07d8e8d1d750af9c83b4d45a:f70b31a2db15c023d641c32f433fb02cd04df5a6-0' : + 'biocontainers/mulled-v2-ac74a7f02cebcfcc07d8e8d1d750af9c83b4d45a:f70b31a2db15c023d641c32f433fb02cd04df5a6-0' }" input: tuple val(meta) , path(reads) @@ -14,10 +14,10 @@ process BOWTIE2_ALIGN { val sort_bam output: - tuple val(meta), path("*.bam") , emit: bam - tuple val(meta), path("*.log") , emit: log - tuple val(meta), path("*fastq.gz"), emit: fastq, optional:true - path "versions.yml" , emit: versions + tuple val(meta), path("*.{bam,sam}"), emit: aligned + tuple val(meta), path("*.log") , emit: log + tuple val(meta), path("*fastq.gz") , emit: fastq, optional:true + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when @@ -38,6 +38,8 @@ process BOWTIE2_ALIGN { } def samtools_command = sort_bam ? 'sort' : 'view' + def extension_pattern = /(--output-fmt|-O)+\s+(\S+)/ + def extension = (args2 ==~ extension_pattern) ? (args2 =~ extension_pattern)[0][2].toLowerCase() : "bam" """ INDEX=`find -L ./ -name "*.rev.1.bt2" | sed "s/\\.rev.1.bt2\$//"` @@ -50,8 +52,8 @@ process BOWTIE2_ALIGN { --threads $task.cpus \\ $unaligned \\ $args \\ - 2> ${prefix}.bowtie2.log \\ - | samtools $samtools_command $args2 --threads $task.cpus -o ${prefix}.bam - + 2> >(tee ${prefix}.bowtie2.log >&2) \\ + | samtools $samtools_command $args2 --threads $task.cpus -o ${prefix}.${extension} - if [ -f ${prefix}.unmapped.fastq.1.gz ]; then mv ${prefix}.unmapped.fastq.1.gz ${prefix}.unmapped_1.fastq.gz @@ -68,4 +70,30 @@ process BOWTIE2_ALIGN { pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' ) END_VERSIONS """ + + stub: + def args2 = task.ext.args2 ?: "" + def prefix = task.ext.prefix ?: "${meta.id}" + def extension_pattern = /(--output-fmt|-O)+\s+(\S+)/ + def extension = (args2 ==~ extension_pattern) ? (args2 =~ extension_pattern)[0][2].toLowerCase() : "bam" + def create_unmapped = "" + if (meta.single_end) { + create_unmapped = save_unaligned ? "touch ${prefix}.unmapped.fastq.gz" : "" + } else { + create_unmapped = save_unaligned ? "touch ${prefix}.unmapped_1.fastq.gz && touch ${prefix}.unmapped_2.fastq.gz" : "" + } + + """ + touch ${prefix}.${extension} + touch ${prefix}.bowtie2.log + ${create_unmapped} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bowtie2: \$(echo \$(bowtie2 --version 2>&1) | sed 's/^.*bowtie2-align-s version //; s/ .*\$//') + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' ) + END_VERSIONS + """ + } diff --git a/modules/nf-core/bowtie2/align/meta.yml b/modules/nf-core/bowtie2/align/meta.yml index c8e9a001..e66811d0 100644 --- a/modules/nf-core/bowtie2/align/meta.yml +++ b/modules/nf-core/bowtie2/align/meta.yml @@ -46,10 +46,10 @@ input: description: use samtools sort (true) or samtools view (false) pattern: "true or false" output: - - bam: + - aligned: type: file - description: Output BAM file containing read alignments - pattern: "*.{bam}" + description: Output BAM/SAM file containing read alignments + pattern: "*.{bam,sam}" - versions: type: file description: File containing software versions @@ -65,3 +65,6 @@ output: authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/bowtie2/align/tests/large_index.config b/modules/nf-core/bowtie2/align/tests/large_index.config new file mode 100644 index 00000000..fdc1c59d --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/large_index.config @@ -0,0 +1,5 @@ +process { + withName: BOWTIE2_BUILD { + ext.args = '--large-index' + } +} \ No newline at end of file diff --git a/modules/nf-core/bowtie2/align/tests/main.nf.test b/modules/nf-core/bowtie2/align/tests/main.nf.test new file mode 100644 index 00000000..a478d17b --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/main.nf.test @@ -0,0 +1,561 @@ +nextflow_process { + + name "Test Process BOWTIE2_ALIGN" + script "../main.nf" + process "BOWTIE2_ALIGN" + tag "modules" + tag "modules_nfcore" + tag "bowtie2" + tag "bowtie2/align" + + test("sarscov2 - fastq, index, false, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, false, false - sam") { + + config "./sam.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).readLines()[0..4], + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, false, false - sam2") { + + config "./sam2.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).readLines()[0..4], + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, false, true - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = true //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, false, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, false, true - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = true //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, large_index, false, false - bam") { + + config "./large_index.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], large_index, false, false - bam") { + + config "./large_index.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, true, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = true //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, true, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = true //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, false, false - stub") { + + options "-stub" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + file(process.out.log[0][1]).name, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, true, false - stub") { + + options "-stub" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = true //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + file(process.out.log[0][1]).name, + file(process.out.fastq[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/bowtie2/align/tests/main.nf.test.snap b/modules/nf-core/bowtie2/align/tests/main.nf.test.snap new file mode 100644 index 00000000..883dc7ec --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/main.nf.test.snap @@ -0,0 +1,263 @@ +{ + "sarscov2 - fastq, index, false, false - sam2": { + "content": [ + [ + "ERR5069949.2151832\t16\tMT192765.1\t17453\t42\t150M\t*\t0\t0\tACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGA\tAAAA&1) | sed 's/^.*bowtie2-align-s version //; s/ .*\$//') END_VERSIONS """ + + stub: + """ + mkdir bowtie2 + touch bowtie2/${fasta.baseName}.{1..4}.bt2 + touch bowtie2/${fasta.baseName}.rev.{1,2}.bt2 + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + bowtie2: \$(echo \$(bowtie2 --version 2>&1) | sed 's/^.*bowtie2-align-s version //; s/ .*\$//') + END_VERSIONS + """ } diff --git a/modules/nf-core/bowtie2/build/meta.yml b/modules/nf-core/bowtie2/build/meta.yml index 0240224d..2d687991 100644 --- a/modules/nf-core/bowtie2/build/meta.yml +++ b/modules/nf-core/bowtie2/build/meta.yml @@ -41,3 +41,6 @@ output: authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/bowtie2/build/tests/main.nf.test b/modules/nf-core/bowtie2/build/tests/main.nf.test new file mode 100644 index 00000000..16376025 --- /dev/null +++ b/modules/nf-core/bowtie2/build/tests/main.nf.test @@ -0,0 +1,31 @@ +nextflow_process { + + name "Test Process BOWTIE2_BUILD" + script "modules/nf-core/bowtie2/build/main.nf" + process "BOWTIE2_BUILD" + tag "modules" + tag "modules_nfcore" + tag "bowtie2" + tag "bowtie2/build" + + test("Should run without failures") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + + then { + assert process.success + assert snapshot(process.out).match() + } + + } + +} diff --git a/modules/nf-core/bowtie2/build/tests/main.nf.test.snap b/modules/nf-core/bowtie2/build/tests/main.nf.test.snap new file mode 100644 index 00000000..6875e021 --- /dev/null +++ b/modules/nf-core/bowtie2/build/tests/main.nf.test.snap @@ -0,0 +1,45 @@ +{ + "Should run without failures": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + [ + "genome.1.bt2:md5,cbe3d0bbea55bc57c99b4bfa25b5fbdf", + "genome.2.bt2:md5,47b153cd1319abc88dda532462651fcf", + "genome.3.bt2:md5,4ed93abba181d8dfab2e303e33114777", + "genome.4.bt2:md5,c25be5f8b0378abf7a58c8a880b87626", + "genome.rev.1.bt2:md5,52be6950579598a990570fbcf5372184", + "genome.rev.2.bt2:md5,e3b4ef343dea4dd571642010a7d09597" + ] + ] + ], + "1": [ + "versions.yml:md5,1df11e9b82891527271c889c880d3974" + ], + "index": [ + [ + { + "id": "test" + }, + [ + "genome.1.bt2:md5,cbe3d0bbea55bc57c99b4bfa25b5fbdf", + "genome.2.bt2:md5,47b153cd1319abc88dda532462651fcf", + "genome.3.bt2:md5,4ed93abba181d8dfab2e303e33114777", + "genome.4.bt2:md5,c25be5f8b0378abf7a58c8a880b87626", + "genome.rev.1.bt2:md5,52be6950579598a990570fbcf5372184", + "genome.rev.2.bt2:md5,e3b4ef343dea4dd571642010a7d09597" + ] + ] + ], + "versions": [ + "versions.yml:md5,1df11e9b82891527271c889c880d3974" + ] + } + ], + "timestamp": "2023-11-23T11:51:01.107681997" + } +} \ No newline at end of file diff --git a/modules/nf-core/bowtie2/build/tests/tags.yml b/modules/nf-core/bowtie2/build/tests/tags.yml new file mode 100644 index 00000000..81aa61da --- /dev/null +++ b/modules/nf-core/bowtie2/build/tests/tags.yml @@ -0,0 +1,2 @@ +bowtie2/build: + - modules/nf-core/bowtie2/build/** diff --git a/modules/nf-core/cat/fastq/environment.yml b/modules/nf-core/cat/fastq/environment.yml new file mode 100644 index 00000000..bff93add --- /dev/null +++ b/modules/nf-core/cat/fastq/environment.yml @@ -0,0 +1,7 @@ +name: cat_fastq +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - conda-forge::sed=4.7 diff --git a/modules/nf-core/cat/fastq/main.nf b/modules/nf-core/cat/fastq/main.nf index 5021e6fc..3d963784 100644 --- a/modules/nf-core/cat/fastq/main.nf +++ b/modules/nf-core/cat/fastq/main.nf @@ -2,7 +2,7 @@ process CAT_FASTQ { tag "$meta.id" label 'process_single' - conda "conda-forge::sed=4.7" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : 'nf-core/ubuntu:20.04' }" diff --git a/modules/nf-core/cat/fastq/meta.yml b/modules/nf-core/cat/fastq/meta.yml index c836598e..db4ac3c7 100644 --- a/modules/nf-core/cat/fastq/meta.yml +++ b/modules/nf-core/cat/fastq/meta.yml @@ -1,6 +1,7 @@ name: cat_fastq description: Concatenates fastq files keywords: + - cat - fastq - concatenate tools: @@ -16,7 +17,7 @@ input: Groovy Map containing sample information e.g. [ id:'test', single_end:false ] - reads: - type: list + type: file description: | List of input FastQ files to be concatenated. output: @@ -33,7 +34,9 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test b/modules/nf-core/cat/fastq/tests/main.nf.test new file mode 100644 index 00000000..f5f94182 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/main.nf.test @@ -0,0 +1,143 @@ +nextflow_process { + + name "Test Process CAT_FASTQ" + script "../main.nf" + process "CAT_FASTQ" + tag "modules" + tag "modules_nfcore" + tag "cat" + tag "cat/fastq" + + test("test_cat_fastq_single_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test2_1_fastq_gz'], checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.reads).match() }, + { assert path(process.out.versions.get(0)).getText().contains("cat") } + ) + } + } + + test("test_cat_fastq_paired_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test2_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test2_2_fastq_gz'], checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.reads).match() }, + { assert path(process.out.versions.get(0)).getText().contains("cat") } + ) + } + } + + test("test_cat_fastq_single_end_same_name") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.reads).match() }, + { assert path(process.out.versions.get(0)).getText().contains("cat") } + ) + } + } + + test("test_cat_fastq_paired_end_same_name") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.reads).match() }, + { assert path(process.out.versions.get(0)).getText().contains("cat") } + ) + } + } + + test("test_cat_fastq_single_end_single_file") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.reads).match() }, + { assert path(process.out.versions.get(0)).getText().contains("cat") } + ) + } + } +} diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test.snap b/modules/nf-core/cat/fastq/tests/main.nf.test.snap new file mode 100644 index 00000000..ec2342e5 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/main.nf.test.snap @@ -0,0 +1,78 @@ +{ + "test_cat_fastq_single_end": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,f9cf5e375f7de81a406144a2c70cc64d" + ] + ] + ], + "timestamp": "2023-10-17T23:19:12.990284837" + }, + "test_cat_fastq_single_end_same_name": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,63f817db7a29a03eb538104495556f66" + ] + ] + ], + "timestamp": "2023-10-17T23:19:31.554568147" + }, + "test_cat_fastq_single_end_single_file": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,e325ef7deb4023447a1f074e285761af" + ] + ] + ], + "timestamp": "2023-10-17T23:19:49.629360033" + }, + "test_cat_fastq_paired_end_same_name": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,63f817db7a29a03eb538104495556f66", + "test_2.merged.fastq.gz:md5,fe9f266f43a6fc3dcab690a18419a56e" + ] + ] + ] + ], + "timestamp": "2023-10-17T23:19:40.711617539" + }, + "test_cat_fastq_paired_end": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,f9cf5e375f7de81a406144a2c70cc64d", + "test_2.merged.fastq.gz:md5,77c8e966e130d8c6b6ec9be52fcb2bda" + ] + ] + ] + ], + "timestamp": "2023-10-18T07:53:20.923560211" + } +} \ No newline at end of file diff --git a/modules/nf-core/cat/fastq/tests/tags.yml b/modules/nf-core/cat/fastq/tests/tags.yml new file mode 100644 index 00000000..6ac43614 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/tags.yml @@ -0,0 +1,2 @@ +cat/fastq: + - modules/nf-core/cat/fastq/** diff --git a/modules/nf-core/custom/dumpsoftwareversions/environment.yml b/modules/nf-core/custom/dumpsoftwareversions/environment.yml new file mode 100644 index 00000000..f0c63f69 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/environment.yml @@ -0,0 +1,7 @@ +name: custom_dumpsoftwareversions +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::multiqc=1.17 diff --git a/modules/nf-core/custom/dumpsoftwareversions/main.nf b/modules/nf-core/custom/dumpsoftwareversions/main.nf index c9d014b1..7685b33c 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/main.nf +++ b/modules/nf-core/custom/dumpsoftwareversions/main.nf @@ -2,10 +2,10 @@ process CUSTOM_DUMPSOFTWAREVERSIONS { label 'process_single' // Requires `pyyaml` which does not have a dedicated container but is in the MultiQC container - conda "bioconda::multiqc=1.15" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.15--pyhdfd78af_0' : - 'biocontainers/multiqc:1.15--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.17--pyhdfd78af_0' : + 'biocontainers/multiqc:1.17--pyhdfd78af_0' }" input: path versions diff --git a/modules/nf-core/custom/dumpsoftwareversions/meta.yml b/modules/nf-core/custom/dumpsoftwareversions/meta.yml index c32657de..5f15a5fd 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/meta.yml +++ b/modules/nf-core/custom/dumpsoftwareversions/meta.yml @@ -1,4 +1,4 @@ -# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/yaml-schema.json +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json name: custom_dumpsoftwareversions description: Custom module used to dump software versions within the nf-core pipeline template keywords: @@ -16,7 +16,6 @@ input: type: file description: YML file containing software versions pattern: "*.yml" - output: - yml: type: file @@ -30,7 +29,9 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@drpatelh" - "@grst" +maintainers: + - "@drpatelh" + - "@grst" diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test new file mode 100644 index 00000000..eec1db10 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test @@ -0,0 +1,38 @@ +nextflow_process { + + name "Test Process CUSTOM_DUMPSOFTWAREVERSIONS" + script "../main.nf" + process "CUSTOM_DUMPSOFTWAREVERSIONS" + tag "modules" + tag "modules_nfcore" + tag "custom" + tag "dumpsoftwareversions" + tag "custom/dumpsoftwareversions" + + test("Should run without failures") { + when { + process { + """ + def tool1_version = ''' + TOOL1: + tool1: 0.11.9 + '''.stripIndent() + + def tool2_version = ''' + TOOL2: + tool2: 1.9 + '''.stripIndent() + + input[0] = Channel.of(tool1_version, tool2_version).collectFile() + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap new file mode 100644 index 00000000..4274ed57 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap @@ -0,0 +1,27 @@ +{ + "Should run without failures": { + "content": [ + { + "0": [ + "software_versions.yml:md5,1c851188476409cda5752ce971b20b58" + ], + "1": [ + "software_versions_mqc.yml:md5,2570f4ba271ad08357b0d3d32a9cf84d" + ], + "2": [ + "versions.yml:md5,3843ac526e762117eedf8825b40683df" + ], + "mqc_yml": [ + "software_versions_mqc.yml:md5,2570f4ba271ad08357b0d3d32a9cf84d" + ], + "versions": [ + "versions.yml:md5,3843ac526e762117eedf8825b40683df" + ], + "yml": [ + "software_versions.yml:md5,1c851188476409cda5752ce971b20b58" + ] + } + ], + "timestamp": "2023-11-03T14:43:22.157011" + } +} diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml new file mode 100644 index 00000000..405aa24a --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml @@ -0,0 +1,2 @@ +custom/dumpsoftwareversions: + - modules/nf-core/custom/dumpsoftwareversions/** diff --git a/modules/nf-core/custom/getchromsizes/environment.yml b/modules/nf-core/custom/getchromsizes/environment.yml new file mode 100644 index 00000000..2a01695f --- /dev/null +++ b/modules/nf-core/custom/getchromsizes/environment.yml @@ -0,0 +1,7 @@ +name: custom_getchromsizes +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.16.1 diff --git a/modules/nf-core/custom/getchromsizes/main.nf b/modules/nf-core/custom/getchromsizes/main.nf index 580f87fe..e8084ea2 100644 --- a/modules/nf-core/custom/getchromsizes/main.nf +++ b/modules/nf-core/custom/getchromsizes/main.nf @@ -2,10 +2,10 @@ process CUSTOM_GETCHROMSIZES { tag "$fasta" label 'process_single' - conda "bioconda::samtools=1.16.1" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' : - 'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }" + 'biocontainers/samtools:1.16.1--h6899075_1' }" input: tuple val(meta), path(fasta) diff --git a/modules/nf-core/custom/getchromsizes/meta.yml b/modules/nf-core/custom/getchromsizes/meta.yml index 219ca1d8..529be07e 100644 --- a/modules/nf-core/custom/getchromsizes/meta.yml +++ b/modules/nf-core/custom/getchromsizes/meta.yml @@ -12,7 +12,6 @@ tools: tool_dev_url: https://github.com/samtools/samtools doi: 10.1093/bioinformatics/btp352 licence: ["MIT"] - input: - meta: type: map @@ -23,7 +22,6 @@ input: type: file description: FASTA file pattern: "*.{fa,fasta,fna,fas}" - output: - meta: type: map @@ -46,8 +44,11 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@tamara-hodgetts" - "@chris-cheshire" - "@muffato" +maintainers: + - "@tamara-hodgetts" + - "@chris-cheshire" + - "@muffato" diff --git a/modules/nf-core/custom/getchromsizes/tests/main.nf.test b/modules/nf-core/custom/getchromsizes/tests/main.nf.test new file mode 100644 index 00000000..844bd996 --- /dev/null +++ b/modules/nf-core/custom/getchromsizes/tests/main.nf.test @@ -0,0 +1,60 @@ +nextflow_process { + + name "Test Process CUSTOM_GETCHROMSIZES" + script "../main.nf" + process "CUSTOM_GETCHROMSIZES" + + tag "modules" + tag "modules_nfcore" + tag "custom" + tag "custom/getchromsizes" + + test("test_custom_getchromsizes") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("test_custom_getchromsizes_bgzip") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['genome']['genome_fasta_gz'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap b/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap new file mode 100644 index 00000000..142298ee --- /dev/null +++ b/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap @@ -0,0 +1,124 @@ +{ + "test_custom_getchromsizes": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.sizes:md5,a57c401f27ae5133823fb09fb21c8a3c" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,45a83c5f3dddbc5dcab30035169f7ce8" + ], + "fai": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + + ], + "sizes": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.sizes:md5,a57c401f27ae5133823fb09fb21c8a3c" + ] + ], + "versions": [ + "versions.yml:md5,45a83c5f3dddbc5dcab30035169f7ce8" + ] + } + ], + "timestamp": "2023-10-17T10:20:42.652464" + }, + "test_custom_getchromsizes_bgzip": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.sizes:md5,a57c401f27ae5133823fb09fb21c8a3c" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474" + ] + ], + "3": [ + "versions.yml:md5,45a83c5f3dddbc5dcab30035169f7ce8" + ], + "fai": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474" + ] + ], + "sizes": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.sizes:md5,a57c401f27ae5133823fb09fb21c8a3c" + ] + ], + "versions": [ + "versions.yml:md5,45a83c5f3dddbc5dcab30035169f7ce8" + ] + } + ], + "timestamp": "2023-10-17T10:22:25.185203" + } +} \ No newline at end of file diff --git a/modules/nf-core/custom/getchromsizes/tests/tags.yml b/modules/nf-core/custom/getchromsizes/tests/tags.yml new file mode 100644 index 00000000..d89a805f --- /dev/null +++ b/modules/nf-core/custom/getchromsizes/tests/tags.yml @@ -0,0 +1,2 @@ +custom/getchromsizes: + - modules/nf-core/custom/getchromsizes/** diff --git a/modules/nf-core/fastp/environment.yml b/modules/nf-core/fastp/environment.yml new file mode 100644 index 00000000..70389e66 --- /dev/null +++ b/modules/nf-core/fastp/environment.yml @@ -0,0 +1,7 @@ +name: fastp +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::fastp=0.23.4 diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf index 5eeb9b09..5fac3c1a 100644 --- a/modules/nf-core/fastp/main.nf +++ b/modules/nf-core/fastp/main.nf @@ -2,10 +2,10 @@ process FASTP { tag "$meta.id" label 'process_medium' - conda "bioconda::fastp=0.23.2" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/fastp:0.23.2--h79da9fb_0' : - 'quay.io/biocontainers/fastp:0.23.2--h79da9fb_0' }" + 'https://depot.galaxyproject.org/singularity/fastp:0.23.4--h5f740d0_0' : + 'biocontainers/fastp:0.23.4--h5f740d0_0' }" input: tuple val(meta), path(reads) @@ -45,7 +45,7 @@ process FASTP { $adapter_list \\ $fail_fastq \\ $args \\ - 2> ${prefix}.fastp.log \\ + 2> >(tee ${prefix}.fastp.log >&2) \\ | gzip -c > ${prefix}.fastp.fastq.gz cat <<-END_VERSIONS > versions.yml @@ -66,7 +66,7 @@ process FASTP { $adapter_list \\ $fail_fastq \\ $args \\ - 2> ${prefix}.fastp.log + 2> >(tee ${prefix}.fastp.log >&2) cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -91,7 +91,7 @@ process FASTP { --thread $task.cpus \\ --detect_adapter_for_pe \\ $args \\ - 2> ${prefix}.fastp.log + 2> >(tee ${prefix}.fastp.log >&2) cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/fastp/meta.yml b/modules/nf-core/fastp/meta.yml index 197ea7ca..c22a16ab 100644 --- a/modules/nf-core/fastp/meta.yml +++ b/modules/nf-core/fastp/meta.yml @@ -33,7 +33,6 @@ input: - save_merged: type: boolean description: Specify true to save all merged reads to the a file ending in `*.merged.fastq.gz` - output: - meta: type: map @@ -71,3 +70,6 @@ output: authors: - "@drpatelh" - "@kevinmenden" +maintainers: + - "@drpatelh" + - "@kevinmenden" diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test new file mode 100644 index 00000000..f610b735 --- /dev/null +++ b/modules/nf-core/fastp/tests/main.nf.test @@ -0,0 +1,485 @@ +nextflow_process { + + name "Test Process FASTP" + script "../main.nf" + process "FASTP" + tag "modules" + tag "modules_nfcore" + tag "fastp" + + test("test_fastp_single_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = [ + [ id:'test', single_end:true ], + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ] + ] + + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:12.922000 K (92.984097%)", + "single end (151 cycles)" ] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 99" ] + def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("test_fastp_single_end_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("test_fastp_paired_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] + def log_text = [ "No adapter detected for read1", + "Q30 bases: 12281(88.3716%)"] + def json_text = ['"passed_filter_reads": 198'] + def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("fastp test_fastp_interleaved") { + config './nextflow.config' + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = [ [ id:'test', single_end:true ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_interleaved_fastq_gz'], checkIfExists: true) ] + ] + + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "paired end (151 cycles + 151 cycles)"] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 198"] + def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("fastp test_fastp_interleaved_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("test_fastp_single_end_trim_fail") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = true + save_merged = false + + input[0] = [ [ id:'test', single_end:true ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ] + ] + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:12.922000 K (92.984097%)", + "single end (151 cycles)"] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 99" ] + def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { failed_read_lines.each { failed_read_line -> + { assert path(process.out.reads_fail.get(0).get(1)).linesGzip.contains(failed_read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("test_fastp_single_end_trim_fail_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("test_fastp_paired_end_trim_fail") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = true + save_merged = false + + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] + def log_text = [ "No adapter detected for read1", + "Q30 bases: 12281(88.3716%)"] + def json_text = ['"passed_filter_reads": 198'] + def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { failed_read2_lines.each { failed_read2_line -> + { assert path(process.out.reads_fail.get(0).get(1).get(1)).linesGzip.contains(failed_read2_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("test_fastp_paired_end_merged") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = true + + input[0] = [ [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "
"] + def log_text = [ "Merged and filtered:", + "total reads: 75", + "total bases: 13683"] + def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683'] + def read1_lines = [ "@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", + "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", + "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { read_merged_lines.each { read_merged_line -> + { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("test_fastp_paired_end_merged_adapterlist") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = file("https://github.com/nf-core/test-datasets/raw/modules/data/delete_me/fastp/adapters.fasta", checkIfExists: true) + save_trimmed_fail = false + save_merged = true + + input[0] = [ [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "
"] + def log_text = [ "Merged and filtered:", + "total reads: 75", + "total bases: 13683"] + def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683',"--adapter_fasta"] + def read1_lines = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", + "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", + "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { read_merged_lines.each { read_merged_line -> + { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } +} diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap new file mode 100644 index 00000000..0fa68c7d --- /dev/null +++ b/modules/nf-core/fastp/tests/main.nf.test.snap @@ -0,0 +1,52 @@ +{ + "fastp test_fastp_interleaved_json": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,168f516f7bd4b7b6c32da7cba87299a4" + ] + ] + ], + "timestamp": "2023-10-17T11:04:45.794175881" + }, + "test_fastp_single_end_json": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc" + ] + ] + ], + "timestamp": "2023-10-17T11:04:10.566343705" + }, + "versions": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "timestamp": "2023-10-17T11:04:10.582076024" + }, + "test_fastp_single_end_trim_fail_json": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5" + ] + ] + ], + "timestamp": "2023-10-17T11:05:00.379878948" + } +} \ No newline at end of file diff --git a/modules/nf-core/fastp/tests/nextflow.config b/modules/nf-core/fastp/tests/nextflow.config new file mode 100644 index 00000000..0f7849ad --- /dev/null +++ b/modules/nf-core/fastp/tests/nextflow.config @@ -0,0 +1,6 @@ +process { + + withName: FASTP { + ext.args = "--interleaved_in" + } +} diff --git a/modules/nf-core/fastp/tests/tags.yml b/modules/nf-core/fastp/tests/tags.yml new file mode 100644 index 00000000..c1afcce7 --- /dev/null +++ b/modules/nf-core/fastp/tests/tags.yml @@ -0,0 +1,2 @@ +fastp: + - modules/nf-core/fastp/** diff --git a/modules/nf-core/fastqc/environment.yml b/modules/nf-core/fastqc/environment.yml new file mode 100644 index 00000000..1787b38a --- /dev/null +++ b/modules/nf-core/fastqc/environment.yml @@ -0,0 +1,7 @@ +name: fastqc +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::fastqc=0.12.1 diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf index 249f9064..9e19a74c 100644 --- a/modules/nf-core/fastqc/main.nf +++ b/modules/nf-core/fastqc/main.nf @@ -2,10 +2,10 @@ process FASTQC { tag "$meta.id" label 'process_medium' - conda "bioconda::fastqc=0.11.9" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/fastqc:0.11.9--0' : - 'biocontainers/fastqc:0.11.9--0' }" + 'https://depot.galaxyproject.org/singularity/fastqc:0.12.1--hdfd78af_0' : + 'biocontainers/fastqc:0.12.1--hdfd78af_0' }" input: tuple val(meta), path(reads) @@ -37,7 +37,7 @@ process FASTQC { cat <<-END_VERSIONS > versions.yml "${task.process}": - fastqc: \$( fastqc --version | sed -e "s/FastQC v//g" ) + fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' ) END_VERSIONS """ @@ -49,7 +49,7 @@ process FASTQC { cat <<-END_VERSIONS > versions.yml "${task.process}": - fastqc: \$( fastqc --version | sed -e "s/FastQC v//g" ) + fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' ) END_VERSIONS """ } diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml index 4da5bb5a..ee5507e0 100644 --- a/modules/nf-core/fastqc/meta.yml +++ b/modules/nf-core/fastqc/meta.yml @@ -50,3 +50,8 @@ authors: - "@grst" - "@ewels" - "@FelixKrueger" +maintainers: + - "@drpatelh" + - "@grst" + - "@ewels" + - "@FelixKrueger" diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test new file mode 100644 index 00000000..b9e8f926 --- /dev/null +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -0,0 +1,109 @@ +nextflow_process { + + name "Test Process FASTQC" + script "../main.nf" + process "FASTQC" + tag "modules" + tag "modules_nfcore" + tag "fastqc" + + test("Single-Read") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id: 'test', single_end:true ], + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. + // looks like this:
Mon 2 Oct 2023
test.gz
+ // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 + { assert process.out.html.get(0).get(1) ==~ ".*/test_fastqc.html" }, + { assert path(process.out.html.get(0).get(1)).getText().contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match("versions") }, + { assert process.out.zip.get(0).get(1) ==~ ".*/test_fastqc.zip" } + ) + } + } +// TODO +// // +// // Test with paired-end data +// // +// workflow test_fastqc_paired_end { +// input = [ +// [id: 'test', single_end: false], // meta map +// [ +// file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), +// file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) +// ] +// ] + +// FASTQC ( input ) +// } + +// // +// // Test with interleaved data +// // +// workflow test_fastqc_interleaved { +// input = [ +// [id: 'test', single_end: false], // meta map +// file(params.test_data['sarscov2']['illumina']['test_interleaved_fastq_gz'], checkIfExists: true) +// ] + +// FASTQC ( input ) +// } + +// // +// // Test with bam data +// // +// workflow test_fastqc_bam { +// input = [ +// [id: 'test', single_end: false], // meta map +// file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) +// ] + +// FASTQC ( input ) +// } + +// // +// // Test with multiple samples +// // +// workflow test_fastqc_multiple { +// input = [ +// [id: 'test', single_end: false], // meta map +// [ +// file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), +// file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true), +// file(params.test_data['sarscov2']['illumina']['test2_1_fastq_gz'], checkIfExists: true), +// file(params.test_data['sarscov2']['illumina']['test2_2_fastq_gz'], checkIfExists: true) +// ] +// ] + +// FASTQC ( input ) +// } + +// // +// // Test with custom prefix +// // +// workflow test_fastqc_custom_prefix { +// input = [ +// [ id:'mysample', single_end:true ], // meta map +// file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) +// ] + +// FASTQC ( input ) +// } +} diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap new file mode 100644 index 00000000..636a32ce --- /dev/null +++ b/modules/nf-core/fastqc/tests/main.nf.test.snap @@ -0,0 +1,10 @@ +{ + "versions": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "timestamp": "2023-10-09T23:40:54+0000" + } +} \ No newline at end of file diff --git a/modules/nf-core/fastqc/tests/tags.yml b/modules/nf-core/fastqc/tests/tags.yml new file mode 100644 index 00000000..7834294b --- /dev/null +++ b/modules/nf-core/fastqc/tests/tags.yml @@ -0,0 +1,2 @@ +fastqc: + - modules/nf-core/fastqc/** diff --git a/modules/nf-core/freyja/boot/environment.yml b/modules/nf-core/freyja/boot/environment.yml new file mode 100644 index 00000000..71c285aa --- /dev/null +++ b/modules/nf-core/freyja/boot/environment.yml @@ -0,0 +1,7 @@ +name: freyja_boot +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::freyja=1.4.7 diff --git a/modules/nf-core/freyja/boot/main.nf b/modules/nf-core/freyja/boot/main.nf index 10e39d02..7d35c06a 100644 --- a/modules/nf-core/freyja/boot/main.nf +++ b/modules/nf-core/freyja/boot/main.nf @@ -2,10 +2,11 @@ process FREYJA_BOOT { tag "$meta.id" label 'process_high' - conda "bioconda::freyja=1.3.12" + + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/freyja:1.3.12--pyhdfd78af_0': - 'quay.io/biocontainers/freyja:1.3.12--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/freyja:1.4.7--pyhdfd78af_0': + 'biocontainers/freyja:1.4.7--pyhdfd78af_0' }" input: tuple val(meta), path(variants), path(depths) diff --git a/modules/nf-core/freyja/boot/meta.yml b/modules/nf-core/freyja/boot/meta.yml index 3eca1568..f3d91b52 100644 --- a/modules/nf-core/freyja/boot/meta.yml +++ b/modules/nf-core/freyja/boot/meta.yml @@ -12,9 +12,8 @@ tools: homepage: "https://github.com/andersen-lab/Freyja" documentation: "https://github.com/andersen-lab/Freyja/wiki" tool_dev_url: "https://github.com/andersen-lab/Freyja" - doi: "http://dx.doi.org/10.1038/s41586-022-05049-6" - licence: "['BSD-2-Clause']" - + doi: "10.1038/s41586-022-05049-6" + licence: ["BSD-2-Clause"] input: - meta: type: map @@ -25,41 +24,21 @@ input: type: file description: File containing identified variants in a gff-like format pattern: "*.variants.tsv" - - - meta2: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - depths: type: file description: File containing depth of the variants pattern: "*.depth.tsv" - - repeats: - type: value (int) + type: integer description: Number of bootstrap repeats to perform - - - meta3: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - barcodes: type: file description: File containing lineage defining barcodes pattern: "*barcodes.csv" - - - meta4: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - lineages_meta: type: file description: File containing lineage metadata that correspond to barcodes pattern: "*lineages.json" - output: - meta: type: map @@ -78,6 +57,7 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@Joon-Klaps" +maintainers: + - "@Joon-Klaps" diff --git a/modules/nf-core/freyja/boot/tests/main.nf.test b/modules/nf-core/freyja/boot/tests/main.nf.test new file mode 100644 index 00000000..6f75a9c6 --- /dev/null +++ b/modules/nf-core/freyja/boot/tests/main.nf.test @@ -0,0 +1,61 @@ +nextflow_process { + + name "Test Process FREYJA_BOOT" + script "../main.nf" + process "FREYJA_BOOT" + + tag "modules" + tag "modules_nfcore" + tag "freyja" + tag "freyja/boot" + tag "freyja/variants" + tag "freyja/updatedb" + + test("sarscov2 - illumina - test_paired_end_sorted - bam") { + + setup { + run("FREYJA_VARIANTS") { + script "../../variants/main.nf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + input[1] = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + """ + } + } + run("FREYJA_UPDATE") { + script "../../update/main.nf" + process { + """ + input[0] = "freyja_db" + """ + } + } + } + + when { + process { + """ + input[0] = FREYJA_VARIANTS.out.variants + input[1] = 10 + input[2] = FREYJA_UPDATE.out.barcodes + input[3] = FREYJA_UPDATE.out.lineages_meta + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.summarized.get(0).get(1)).getText().contains("0.025,") }, + { assert path(process.out.lineages.get(0).get(1)).getText().contains("0.025,") }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + + } + +} diff --git a/modules/nf-core/freyja/boot/tests/main.nf.test.snap b/modules/nf-core/freyja/boot/tests/main.nf.test.snap new file mode 100644 index 00000000..b6143310 --- /dev/null +++ b/modules/nf-core/freyja/boot/tests/main.nf.test.snap @@ -0,0 +1,10 @@ +{ + "versions": { + "content": [ + [ + "versions.yml:md5,0cf7253a5b3b16532fca5908dffb01b8" + ] + ], + "timestamp": "2023-12-06T15:36:42.746574889" + } +} \ No newline at end of file diff --git a/modules/nf-core/freyja/boot/tests/nextflow.config b/modules/nf-core/freyja/boot/tests/nextflow.config new file mode 100644 index 00000000..3045d571 --- /dev/null +++ b/modules/nf-core/freyja/boot/tests/nextflow.config @@ -0,0 +1,8 @@ +process { + + + withName: FREYJA_BOOT { + ext.args="--depthcutoff 1" + } + +} diff --git a/modules/nf-core/freyja/boot/tests/tags.yml b/modules/nf-core/freyja/boot/tests/tags.yml new file mode 100644 index 00000000..8ccc35eb --- /dev/null +++ b/modules/nf-core/freyja/boot/tests/tags.yml @@ -0,0 +1,2 @@ +freyja/boot: + - "modules/nf-core/freyja/boot/**" diff --git a/modules/nf-core/freyja/demix/environment.yml b/modules/nf-core/freyja/demix/environment.yml new file mode 100644 index 00000000..d692468f --- /dev/null +++ b/modules/nf-core/freyja/demix/environment.yml @@ -0,0 +1,7 @@ +name: freyja_demix +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::freyja=1.4.7 diff --git a/modules/nf-core/freyja/demix/main.nf b/modules/nf-core/freyja/demix/main.nf index 6587cb3c..9ea5bdd4 100644 --- a/modules/nf-core/freyja/demix/main.nf +++ b/modules/nf-core/freyja/demix/main.nf @@ -2,10 +2,11 @@ process FREYJA_DEMIX { tag "$meta.id" label 'process_low' - conda "bioconda::freyja=1.3.12" + + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/freyja:1.3.12--pyhdfd78af_0': - 'quay.io/biocontainers/freyja:1.3.12--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/freyja:1.4.7--pyhdfd78af_0': + 'biocontainers/freyja:1.4.7--pyhdfd78af_0' }" input: tuple val(meta), path(variants), path(depths) diff --git a/modules/nf-core/freyja/demix/meta.yml b/modules/nf-core/freyja/demix/meta.yml index a47663df..141a155f 100644 --- a/modules/nf-core/freyja/demix/meta.yml +++ b/modules/nf-core/freyja/demix/meta.yml @@ -11,9 +11,8 @@ tools: homepage: "https://github.com/andersen-lab/Freyja" documentation: "https://github.com/andersen-lab/Freyja/wiki" tool_dev_url: "https://github.com/andersen-lab/Freyja" - doi: "http://dx.doi.org/10.1038/s41586-022-05049-6" - licence: "['BSD-2-Clause']" - + doi: "10.1038/s41586-022-05049-6" + licence: ["BSD-2-Clause"] input: - meta: type: map @@ -24,37 +23,18 @@ input: type: file description: File containing identified variants in a gff-like format pattern: "*.variants.tsv" - - - meta2: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - depths: type: file description: File containing depth of the variants pattern: "*.depth.tsv" - - - meta3: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - barcodes: type: file description: File containing lineage defining barcodes pattern: "*barcodes.csv" - - - meta4: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - lineages_meta: type: file description: File containing lineage metadata that correspond to barcodes pattern: "*lineages.json" - output: - meta: type: map @@ -69,6 +49,7 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@Joon-Klaps" +maintainers: + - "@Joon-Klaps" diff --git a/modules/nf-core/freyja/demix/tests/main.nf.test b/modules/nf-core/freyja/demix/tests/main.nf.test new file mode 100644 index 00000000..6ad1fb4a --- /dev/null +++ b/modules/nf-core/freyja/demix/tests/main.nf.test @@ -0,0 +1,60 @@ + +nextflow_process { + + name "Test Process FREYJA_DEMIX" + script "../main.nf" + process "FREYJA_DEMIX" + + tag "modules" + tag "modules_nfcore" + tag "freyja" + tag "freyja/demix" + tag "freyja/variants" + tag "freyja/updatedb" + + test("sarscov2 - illumina - test_paired_end_sorted - bam") { + + setup { + run("FREYJA_VARIANTS") { + script "../../variants/main.nf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + input[1] = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + """ + } + } + run("FREYJA_UPDATE") { + script "../../update/main.nf" + process { + """ + input[0] = "freyja_db" + """ + } + } + } + + when { + process { + """ + input[0] = FREYJA_VARIANTS.out.variants + input[1] = FREYJA_UPDATE.out.barcodes + input[2] = FREYJA_UPDATE.out.lineages_meta + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.demix.get(0).get(1)).getText().contains("summarized") }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + + } + +} diff --git a/modules/nf-core/freyja/demix/tests/main.nf.test.snap b/modules/nf-core/freyja/demix/tests/main.nf.test.snap new file mode 100644 index 00000000..e4d3fad5 --- /dev/null +++ b/modules/nf-core/freyja/demix/tests/main.nf.test.snap @@ -0,0 +1,10 @@ +{ + "versions": { + "content": [ + [ + "versions.yml:md5,d36ecae032c1b476d7b57de248b72729" + ] + ], + "timestamp": "2023-12-06T13:37:14.56803127" + } +} diff --git a/modules/nf-core/freyja/demix/tests/nextflow.config b/modules/nf-core/freyja/demix/tests/nextflow.config new file mode 100644 index 00000000..ebd5a70d --- /dev/null +++ b/modules/nf-core/freyja/demix/tests/nextflow.config @@ -0,0 +1,8 @@ +process { + + + withName: FREYJA_DEMIX{ + ext.args = "--depthcutoff 1" + } + +} diff --git a/modules/nf-core/freyja/demix/tests/tags.yml b/modules/nf-core/freyja/demix/tests/tags.yml new file mode 100644 index 00000000..9e2c4bd1 --- /dev/null +++ b/modules/nf-core/freyja/demix/tests/tags.yml @@ -0,0 +1,2 @@ +freyja/demix: + - "modules/nf-core/freyja/demix/**" diff --git a/modules/nf-core/freyja/update/environment.yml b/modules/nf-core/freyja/update/environment.yml new file mode 100644 index 00000000..7d7b1e9b --- /dev/null +++ b/modules/nf-core/freyja/update/environment.yml @@ -0,0 +1,7 @@ +name: freyja_update +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::freyja=1.4.7 diff --git a/modules/nf-core/freyja/update/main.nf b/modules/nf-core/freyja/update/main.nf index 1711b14c..eb320b35 100644 --- a/modules/nf-core/freyja/update/main.nf +++ b/modules/nf-core/freyja/update/main.nf @@ -2,10 +2,11 @@ process FREYJA_UPDATE { tag "$db_name" label 'process_single' - conda "bioconda::freyja=1.3.12" + + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/freyja:1.3.12--pyhdfd78af_0': - 'quay.io/biocontainers/freyja:1.3.12--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/freyja:1.4.7--pyhdfd78af_0': + 'biocontainers/freyja:1.4.7--pyhdfd78af_0' }" input: val db_name diff --git a/modules/nf-core/freyja/update/meta.yml b/modules/nf-core/freyja/update/meta.yml index 2af5d662..1f5fc3c6 100644 --- a/modules/nf-core/freyja/update/meta.yml +++ b/modules/nf-core/freyja/update/meta.yml @@ -10,14 +10,12 @@ tools: homepage: "https://github.com/andersen-lab/Freyja" documentation: "https://github.com/andersen-lab/Freyja/wiki" tool_dev_url: "https://github.com/andersen-lab/Freyja" - doi: "http://dx.doi.org/10.1038/s41586-022-05049-6" - licence: "['BSD-2-Clause']" - + doi: "10.1038/s41586-022-05049-6" + licence: ["BSD-2-Clause"] input: - db_name: type: string description: "The name of the database directory" - output: - barcodes: type: file @@ -35,6 +33,7 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@Joon-Klaps" +maintainers: + - "@Joon-Klaps" diff --git a/modules/nf-core/freyja/update/tests/main.nf.test b/modules/nf-core/freyja/update/tests/main.nf.test new file mode 100644 index 00000000..e1c293cc --- /dev/null +++ b/modules/nf-core/freyja/update/tests/main.nf.test @@ -0,0 +1,34 @@ +nextflow_process { + + name "Test Process FREYJA_UPDATE" + script "../main.nf" + process "FREYJA_UPDATE" + + tag "modules" + tag "modules_nfcore" + tag "freyja" + tag "freyja/update" + + test("sarscov2 - value db name ") { + + when { + process { + """ + input[0] = "test_db" + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.barcodes.get(0)).exists() }, + { assert path(process.out.lineages_meta.get(0)).exists() }, + { assert path(process.out.lineages_topology.get(0)).exists() }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + + } + +} diff --git a/modules/nf-core/freyja/update/tests/main.nf.test.snap b/modules/nf-core/freyja/update/tests/main.nf.test.snap new file mode 100644 index 00000000..6eae23e0 --- /dev/null +++ b/modules/nf-core/freyja/update/tests/main.nf.test.snap @@ -0,0 +1,10 @@ +{ + "versions": { + "content": [ + [ + "versions.yml:md5,8649650231828547e8fed40e072da108" + ] + ], + "timestamp": "2023-12-06T14:13:14.806958334" + } +} \ No newline at end of file diff --git a/modules/nf-core/freyja/update/tests/tags.yml b/modules/nf-core/freyja/update/tests/tags.yml new file mode 100644 index 00000000..90826aab --- /dev/null +++ b/modules/nf-core/freyja/update/tests/tags.yml @@ -0,0 +1,2 @@ +freyja/update: + - "modules/nf-core/freyja/update/**" diff --git a/modules/nf-core/freyja/variants/environment.yml b/modules/nf-core/freyja/variants/environment.yml new file mode 100644 index 00000000..4fb28982 --- /dev/null +++ b/modules/nf-core/freyja/variants/environment.yml @@ -0,0 +1,7 @@ +name: freyja_variants +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::freyja=1.4.7 diff --git a/modules/nf-core/freyja/variants/main.nf b/modules/nf-core/freyja/variants/main.nf index cdc6d788..e319114b 100644 --- a/modules/nf-core/freyja/variants/main.nf +++ b/modules/nf-core/freyja/variants/main.nf @@ -2,10 +2,11 @@ process FREYJA_VARIANTS { tag "$meta.id" label 'process_medium' - conda "bioconda::freyja=1.3.12" + + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/freyja:1.3.12--pyhdfd78af_0': - 'quay.io/biocontainers/freyja:1.3.12--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/freyja:1.4.7--pyhdfd78af_0': + 'biocontainers/freyja:1.4.7--pyhdfd78af_0' }" input: tuple val(meta), path(bam) diff --git a/modules/nf-core/freyja/variants/meta.yml b/modules/nf-core/freyja/variants/meta.yml index 13ddd377..24f8d693 100644 --- a/modules/nf-core/freyja/variants/meta.yml +++ b/modules/nf-core/freyja/variants/meta.yml @@ -10,9 +10,8 @@ tools: homepage: "https://github.com/andersen-lab/Freyja" documentation: "https://github.com/andersen-lab/Freyja/wiki" tool_dev_url: "https://github.com/andersen-lab/Freyja" - doi: "http://dx.doi.org/10.1038/s41586-022-05049-6" - licence: "['BSD-2-Clause']" - + doi: "10.1038/s41586-022-05049-6" + licence: ["BSD-2-Clause"] input: - meta: type: map @@ -23,12 +22,10 @@ input: type: file description: Sorted BAM file pattern: "*.bam" - - fasta: type: file description: The reference sequence used for mapping and generating the BAM file pattern: "*.fa" - output: - meta: type: map @@ -47,6 +44,7 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@Joon-Klaps" +maintainers: + - "@Joon-Klaps" diff --git a/modules/nf-core/freyja/variants/tests/main.nf.test b/modules/nf-core/freyja/variants/tests/main.nf.test new file mode 100644 index 00000000..e0bb4026 --- /dev/null +++ b/modules/nf-core/freyja/variants/tests/main.nf.test @@ -0,0 +1,35 @@ +nextflow_process { + + name "Test Process FREYJA_VARIANTS" + script "../main.nf" + process "FREYJA_VARIANTS" + + tag "modules" + tag "modules_nfcore" + tag "freyja" + tag "freyja/variants" + + test("sarscov2 - illumina - test_paired_end_sorted - bam") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + input[1] = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/freyja/variants/tests/main.nf.test.snap b/modules/nf-core/freyja/variants/tests/main.nf.test.snap new file mode 100644 index 00000000..2693e2f9 --- /dev/null +++ b/modules/nf-core/freyja/variants/tests/main.nf.test.snap @@ -0,0 +1,35 @@ +{ + "sarscov2 - illumina - test_paired_end_sorted - bam": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.variants.tsv:md5,966450bae4d9abae278572927b821983", + "test.depth.tsv:md5,27f79b28a365a8af915895b484d1153e" + ] + ], + "1": [ + "versions.yml:md5,f7edb34ea4dfc2fbb2299aef03791926" + ], + "variants": [ + [ + { + "id": "test", + "single_end": false + }, + "test.variants.tsv:md5,966450bae4d9abae278572927b821983", + "test.depth.tsv:md5,27f79b28a365a8af915895b484d1153e" + ] + ], + "versions": [ + "versions.yml:md5,f7edb34ea4dfc2fbb2299aef03791926" + ] + } + ], + "timestamp": "2023-12-06T15:13:57.445426554" + } +} \ No newline at end of file diff --git a/modules/nf-core/freyja/variants/tests/tags.yml b/modules/nf-core/freyja/variants/tests/tags.yml new file mode 100644 index 00000000..b53250c9 --- /dev/null +++ b/modules/nf-core/freyja/variants/tests/tags.yml @@ -0,0 +1,2 @@ +freyja/variants: + - "modules/nf-core/freyja/variants/**" diff --git a/modules/nf-core/gunzip/environment.yml b/modules/nf-core/gunzip/environment.yml new file mode 100644 index 00000000..25910b34 --- /dev/null +++ b/modules/nf-core/gunzip/environment.yml @@ -0,0 +1,7 @@ +name: gunzip +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - conda-forge::sed=4.7 diff --git a/modules/nf-core/gunzip/main.nf b/modules/nf-core/gunzip/main.nf index e7189d2f..468a6f28 100644 --- a/modules/nf-core/gunzip/main.nf +++ b/modules/nf-core/gunzip/main.nf @@ -2,7 +2,7 @@ process GUNZIP { tag "$archive" label 'process_single' - conda "conda-forge::sed=4.7" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : 'nf-core/ubuntu:20.04' }" @@ -21,10 +21,14 @@ process GUNZIP { def args = task.ext.args ?: '' gunzip = archive.toString() - '.gz' """ - gunzip \\ - -f \\ + # Not calling gunzip itself because it creates files + # with the original group ownership rather than the + # default one for that user / the work directory + gzip \\ + -cd \\ $args \\ - $archive + $archive \\ + > $gunzip cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/gunzip/meta.yml b/modules/nf-core/gunzip/meta.yml index 2e0e4054..231034f2 100644 --- a/modules/nf-core/gunzip/meta.yml +++ b/modules/nf-core/gunzip/meta.yml @@ -3,6 +3,7 @@ description: Compresses and decompresses files. keywords: - gunzip - compression + - decompression tools: - gunzip: description: | @@ -32,3 +33,7 @@ authors: - "@joseespinosa" - "@drpatelh" - "@jfy133" +maintainers: + - "@joseespinosa" + - "@drpatelh" + - "@jfy133" diff --git a/modules/nf-core/gunzip/tests/main.nf.test b/modules/nf-core/gunzip/tests/main.nf.test new file mode 100644 index 00000000..d0317922 --- /dev/null +++ b/modules/nf-core/gunzip/tests/main.nf.test @@ -0,0 +1,35 @@ +nextflow_process { + + name "Test Process GUNZIP" + script "../main.nf" + process "GUNZIP" + tag "gunzip" + tag "modules_nfcore" + tag "modules" + + test("Should run without failures") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [], + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/gunzip/tests/main.nf.test.snap b/modules/nf-core/gunzip/tests/main.nf.test.snap new file mode 100644 index 00000000..720fd9ff --- /dev/null +++ b/modules/nf-core/gunzip/tests/main.nf.test.snap @@ -0,0 +1,31 @@ +{ + "Should run without failures": { + "content": [ + { + "0": [ + [ + [ + + ], + "test_1.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + [ + + ], + "test_1.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "timestamp": "2023-10-17T15:35:37.690477896" + } +} \ No newline at end of file diff --git a/modules/nf-core/gunzip/tests/tags.yml b/modules/nf-core/gunzip/tests/tags.yml new file mode 100644 index 00000000..fd3f6915 --- /dev/null +++ b/modules/nf-core/gunzip/tests/tags.yml @@ -0,0 +1,2 @@ +gunzip: + - modules/nf-core/gunzip/** diff --git a/modules/nf-core/ivar/consensus/environment.yml b/modules/nf-core/ivar/consensus/environment.yml new file mode 100644 index 00000000..c7b87d02 --- /dev/null +++ b/modules/nf-core/ivar/consensus/environment.yml @@ -0,0 +1,7 @@ +name: ivar_consensus +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::ivar=1.4 diff --git a/modules/nf-core/ivar/consensus/main.nf b/modules/nf-core/ivar/consensus/main.nf index 827463dd..9786200e 100644 --- a/modules/nf-core/ivar/consensus/main.nf +++ b/modules/nf-core/ivar/consensus/main.nf @@ -2,10 +2,10 @@ process IVAR_CONSENSUS { tag "$meta.id" label 'process_medium' - conda "bioconda::ivar=1.4" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/ivar:1.4--h6b7c446_1' : - 'quay.io/biocontainers/ivar:1.4--h6b7c446_1' }" + 'biocontainers/ivar:1.4--h6b7c446_1' }" input: tuple val(meta), path(bam) diff --git a/modules/nf-core/ivar/consensus/meta.yml b/modules/nf-core/ivar/consensus/meta.yml index fb562603..99e11924 100644 --- a/modules/nf-core/ivar/consensus/meta.yml +++ b/modules/nf-core/ivar/consensus/meta.yml @@ -54,3 +54,6 @@ output: authors: - "@andersgs" - "@drpatelh" +maintainers: + - "@andersgs" + - "@drpatelh" diff --git a/modules/nf-core/ivar/trim/environment.yml b/modules/nf-core/ivar/trim/environment.yml new file mode 100644 index 00000000..7fb8b3a2 --- /dev/null +++ b/modules/nf-core/ivar/trim/environment.yml @@ -0,0 +1,7 @@ +name: ivar_trim +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::ivar=1.4 diff --git a/modules/nf-core/ivar/trim/main.nf b/modules/nf-core/ivar/trim/main.nf index a7dc404d..7a687d02 100644 --- a/modules/nf-core/ivar/trim/main.nf +++ b/modules/nf-core/ivar/trim/main.nf @@ -2,10 +2,10 @@ process IVAR_TRIM { tag "$meta.id" label 'process_medium' - conda "bioconda::ivar=1.4" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/ivar:1.4--h6b7c446_1' : - 'quay.io/biocontainers/ivar:1.4--h6b7c446_1' }" + 'biocontainers/ivar:1.4--h6b7c446_1' }" input: tuple val(meta), path(bam), path(bai) diff --git a/modules/nf-core/ivar/trim/meta.yml b/modules/nf-core/ivar/trim/meta.yml index d01dd1a2..3a99f6f3 100644 --- a/modules/nf-core/ivar/trim/meta.yml +++ b/modules/nf-core/ivar/trim/meta.yml @@ -50,3 +50,6 @@ output: authors: - "@andersgs" - "@drpatelh" +maintainers: + - "@andersgs" + - "@drpatelh" diff --git a/modules/nf-core/ivar/variants/environment.yml b/modules/nf-core/ivar/variants/environment.yml new file mode 100644 index 00000000..7431cac4 --- /dev/null +++ b/modules/nf-core/ivar/variants/environment.yml @@ -0,0 +1,7 @@ +name: ivar_variants +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::ivar=1.4 diff --git a/modules/nf-core/ivar/variants/main.nf b/modules/nf-core/ivar/variants/main.nf index ae647f2b..189696aa 100644 --- a/modules/nf-core/ivar/variants/main.nf +++ b/modules/nf-core/ivar/variants/main.nf @@ -2,10 +2,10 @@ process IVAR_VARIANTS { tag "$meta.id" label 'process_medium' - conda "bioconda::ivar=1.4" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/ivar:1.4--h6b7c446_1' : - 'quay.io/biocontainers/ivar:1.4--h6b7c446_1' }" + 'biocontainers/ivar:1.4--h6b7c446_1' }" input: tuple val(meta), path(bam) diff --git a/modules/nf-core/ivar/variants/meta.yml b/modules/nf-core/ivar/variants/meta.yml index 4d09e449..9dc9b05c 100644 --- a/modules/nf-core/ivar/variants/meta.yml +++ b/modules/nf-core/ivar/variants/meta.yml @@ -58,3 +58,6 @@ output: authors: - "@andersgs" - "@drpatelh" +maintainers: + - "@andersgs" + - "@drpatelh" diff --git a/modules/nf-core/kraken2/kraken2/environment.yml b/modules/nf-core/kraken2/kraken2/environment.yml new file mode 100644 index 00000000..63be419b --- /dev/null +++ b/modules/nf-core/kraken2/kraken2/environment.yml @@ -0,0 +1,8 @@ +name: kraken2_kraken2 +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::kraken2=2.1.2 + - conda-forge::pigz=2.6 diff --git a/modules/nf-core/kraken2/kraken2/main.nf b/modules/nf-core/kraken2/kraken2/main.nf index 5901064e..cdf02d0f 100644 --- a/modules/nf-core/kraken2/kraken2/main.nf +++ b/modules/nf-core/kraken2/kraken2/main.nf @@ -2,10 +2,10 @@ process KRAKEN2_KRAKEN2 { tag "$meta.id" label 'process_high' - conda "bioconda::kraken2=2.1.2 conda-forge::pigz=2.6" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/mulled-v2-5799ab18b5fc681e75923b2450abaa969907ec98:87fc08d11968d081f3e8a37131c1f1f6715b6542-0' : - 'quay.io/biocontainers/mulled-v2-5799ab18b5fc681e75923b2450abaa969907ec98:87fc08d11968d081f3e8a37131c1f1f6715b6542-0' }" + 'biocontainers/mulled-v2-5799ab18b5fc681e75923b2450abaa969907ec98:87fc08d11968d081f3e8a37131c1f1f6715b6542-0' }" input: tuple val(meta), path(reads) diff --git a/modules/nf-core/kraken2/kraken2/meta.yml b/modules/nf-core/kraken2/kraken2/meta.yml index 7129fe3a..7909ffe7 100644 --- a/modules/nf-core/kraken2/kraken2/meta.yml +++ b/modules/nf-core/kraken2/kraken2/meta.yml @@ -28,12 +28,12 @@ input: type: directory description: Kraken2 database - save_output_fastqs: - type: boolean + type: string description: | If true, optional commands are added to save classified and unclassified reads as fastq files - save_reads_assignment: - type: boolean + type: string description: | If true, an optional command is added to save a file reporting the taxonomic classification of each input read @@ -73,3 +73,6 @@ output: authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/kraken2/kraken2/tests/main.nf.test b/modules/nf-core/kraken2/kraken2/tests/main.nf.test new file mode 100644 index 00000000..4cf63e2f --- /dev/null +++ b/modules/nf-core/kraken2/kraken2/tests/main.nf.test @@ -0,0 +1,142 @@ +nextflow_process { + name "Test Process KRAKEN2_KRAKEN2" + script "../main.nf" + process "KRAKEN2_KRAKEN2" + tag "kraken2" + tag "kraken2/kraken2" + tag "modules" + tag "modules_nfcore" + + setup { + run("UNTAR") { + script "modules/nf-core/untar/main.nf" + process { + """ + input[0] = Channel.of([ + [], + file( + params.test_data['sarscov2']['genome']['kraken2_tar_gz'], + checkIfExists: true + ) + ]) + """ + } + } + } + + test("sarscov2 illumina single end [fastq]") { + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + [ file( + params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], + checkIfExists: true + )] + ] + input[1] = UNTAR.out.untar.map{ it[1] } + input[2] = true + input[3] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.report, + process.out.versions, + ).match() + }, + { assert process.out.classified_reads_fastq.get(0).get(1) ==~ ".*/test.classified.fastq.gz" }, + { assert process.out.unclassified_reads_fastq.get(0).get(1) ==~ ".*/test.unclassified.fastq.gz" }, + ) + } + } + + test("sarscov2 illumina paired end [fastq]") { + when { + params { + outdir = "$outputDir" + } + + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file( + params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], + checkIfExists: true + ), + file( + params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], + checkIfExists: true + ) + + ] + ] + input[1] = UNTAR.out.untar.map{ it[1] } + input[2] = true + input[3] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.report, + process.out.versions, + ).match() + }, + { assert process.out.classified_reads_fastq.get(0).get(1).get(0) + ==~ ".*/test.classified_1.fastq.gz" }, + { assert process.out.classified_reads_fastq.get(0).get(1).get(1) + ==~ ".*/test.classified_2.fastq.gz" }, + { assert process.out.unclassified_reads_fastq.get(0).get(1).get(0) + ==~ ".*/test.unclassified_1.fastq.gz" }, + { assert process.out.unclassified_reads_fastq.get(0).get(1).get(1) + ==~ ".*/test.unclassified_2.fastq.gz" }, + ) + } + } + + test("sarscov2 illumina single end [fastq] + save_reads_assignment") { + when { + params { + outdir = "$outputDir" + } + + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + [ file( + params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], + checkIfExists: true + )] + ] + input[1] = UNTAR.out.untar.map{ it[1] } + input[2] = false + input[3] = true + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.report, + process.out.classified_reads_assignment, + process.out.versions, + ).match() + }, + ) + } + } +} diff --git a/modules/nf-core/kraken2/kraken2/tests/main.nf.test.snap b/modules/nf-core/kraken2/kraken2/tests/main.nf.test.snap new file mode 100644 index 00000000..c1bdd0c6 --- /dev/null +++ b/modules/nf-core/kraken2/kraken2/tests/main.nf.test.snap @@ -0,0 +1,62 @@ +{ + "sarscov2 illumina single end [fastq]": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.kraken2.report.txt:md5,4227755fe40478b8d7dc8634b489761e" + ] + ], + [ + "versions.yml:md5,bcb3e2520685846df02bb27cc6b1794b" + ] + ], + "timestamp": "2023-10-25T09:01:29.775797" + }, + "sarscov2 illumina paired end [fastq]": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.kraken2.report.txt:md5,4227755fe40478b8d7dc8634b489761e" + ] + ], + [ + "versions.yml:md5,bcb3e2520685846df02bb27cc6b1794b" + ] + ], + "timestamp": "2023-10-25T09:01:37.025389" + }, + "sarscov2 illumina single end [fastq] + save_reads_assignment": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.kraken2.report.txt:md5,4227755fe40478b8d7dc8634b489761e" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.kraken2.classifiedreads.txt:md5,e7a90531f0d8d777316515c36fe4cae0" + ] + ], + [ + "versions.yml:md5,bcb3e2520685846df02bb27cc6b1794b" + ] + ], + "timestamp": "2023-10-25T09:01:45.775262" + } +} \ No newline at end of file diff --git a/modules/nf-core/kraken2/kraken2/tests/tags.yml b/modules/nf-core/kraken2/kraken2/tests/tags.yml new file mode 100644 index 00000000..9ebfd7ab --- /dev/null +++ b/modules/nf-core/kraken2/kraken2/tests/tags.yml @@ -0,0 +1,3 @@ +kraken2/kraken2: + - modules/nf-core/kraken2/kraken2/** + - modules/nf-core/untar/** diff --git a/modules/nf-core/minia/environment.yml b/modules/nf-core/minia/environment.yml new file mode 100644 index 00000000..10e45529 --- /dev/null +++ b/modules/nf-core/minia/environment.yml @@ -0,0 +1,7 @@ +name: minia +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::minia=3.2.6 diff --git a/modules/nf-core/minia/main.nf b/modules/nf-core/minia/main.nf index fe242920..40d3213f 100644 --- a/modules/nf-core/minia/main.nf +++ b/modules/nf-core/minia/main.nf @@ -2,10 +2,10 @@ process MINIA { tag "$meta.id" label 'process_high' - conda "bioconda::minia=3.2.6" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/minia:3.2.6--h9a82719_0' : - 'quay.io/biocontainers/minia:3.2.6--h9a82719_0' }" + 'biocontainers/minia:3.2.6--h9a82719_0' }" input: tuple val(meta), path(reads) diff --git a/modules/nf-core/minia/meta.yml b/modules/nf-core/minia/meta.yml index ae86f75c..03241027 100644 --- a/modules/nf-core/minia/meta.yml +++ b/modules/nf-core/minia/meta.yml @@ -45,3 +45,6 @@ output: authors: - "@drpatelh" - "@kevinmenden" +maintainers: + - "@drpatelh" + - "@kevinmenden" diff --git a/modules/nf-core/mosdepth/environment.yml b/modules/nf-core/mosdepth/environment.yml new file mode 100644 index 00000000..88c7126c --- /dev/null +++ b/modules/nf-core/mosdepth/environment.yml @@ -0,0 +1,8 @@ +name: mosdepth +channels: + - conda-forge + - bioconda + - defaults +dependencies: + # renovate: datasource=conda depName=bioconda/mosdepth + - mosdepth=0.3.6 diff --git a/modules/nf-core/mosdepth/main.nf b/modules/nf-core/mosdepth/main.nf index be4be831..c7e24303 100644 --- a/modules/nf-core/mosdepth/main.nf +++ b/modules/nf-core/mosdepth/main.nf @@ -2,15 +2,14 @@ process MOSDEPTH { tag "$meta.id" label 'process_medium' - conda "bioconda::mosdepth=0.3.3" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mosdepth:0.3.3--hdfd78af_1' : - 'quay.io/biocontainers/mosdepth:0.3.3--hdfd78af_1'}" + 'https://depot.galaxyproject.org/singularity/mosdepth:0.3.6--hd299d5a_0' : + 'biocontainers/mosdepth:0.3.6--hd299d5a_0'}" input: - tuple val(meta), path(bam), path(bai) - tuple val(meta2), path(bed) - tuple val(meta3), path(fasta) + tuple val(meta), path(bam), path(bai), path(bed) + tuple val(meta2), path(fasta) output: tuple val(meta), path('*.global.dist.txt') , emit: global_txt @@ -36,10 +35,10 @@ process MOSDEPTH { def reference = fasta ? "--fasta ${fasta}" : "" def interval = bed ? "--by ${bed}" : "" if (bed && args.contains("--by")) { - exit 1, "'--by' can only be specified once when running mosdepth! Either remove input BED file definition or remove '--by' from 'ext.args' definition" + error "'--by' can only be specified once when running mosdepth! Either remove input BED file definition or remove '--by' from 'ext.args' definition" } if (!bed && args.contains("--thresholds")) { - exit 1, "'--thresholds' can only be specified in conjunction with '--by'" + error "'--thresholds' can only be specified in conjunction with '--by'" } """ diff --git a/modules/nf-core/mosdepth/meta.yml b/modules/nf-core/mosdepth/meta.yml index adf3893f..9caaf2cd 100644 --- a/modules/nf-core/mosdepth/meta.yml +++ b/modules/nf-core/mosdepth/meta.yml @@ -26,19 +26,14 @@ input: type: file description: Index for BAM/CRAM file pattern: "*.{bai,crai}" - - meta2: - type: map - description: | - Groovy Map containing bed information - e.g. [ id:'test' ] - bed: type: file description: BED file with intersected intervals pattern: "*.{bed}" - - meta3: + - meta2: type: map description: | - Groovy Map containing reference information + Groovy Map containing bed information e.g. [ id:'test' ] - fasta: type: file @@ -107,3 +102,8 @@ authors: - "@drpatelh" - "@ramprasadn" - "@matthdsm" +maintainers: + - "@joseespinosa" + - "@drpatelh" + - "@ramprasadn" + - "@matthdsm" diff --git a/modules/nf-core/mosdepth/tests/main.nf.test b/modules/nf-core/mosdepth/tests/main.nf.test new file mode 100644 index 00000000..d991f819 --- /dev/null +++ b/modules/nf-core/mosdepth/tests/main.nf.test @@ -0,0 +1,260 @@ +nextflow_process { + + name "Test Process MOSDEPTH" + script "../main.nf" + process "MOSDEPTH" + + tag "modules" + tag "modules_nfcore" + tag "mosdepth" + + test("homo_sapiens - bam, bai, []") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), + [] + ] + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("homo_sapiens - bam, bai, bed") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), + file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) + ] + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("homo_sapiens - cram, crai, []") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true), + [] + ] + input[1] = [ + [ id:'test' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("homo_sapiens - cram, crai, bed") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true), + file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) + ] + input[1] = [ + [ id:'test' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("homo_sapiens - bam, bai, [] - window") { + + config "./window.config" + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), + [] + ] + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("homo_sapiens - bam, bai, [] - quantized") { + + config "./quantized.config" + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), + [] + ] + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("homo_sapiens - bam, bai, bed - thresholds") { + + config "./threshold.config" + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), + file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) + ] + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("homo_sapiens - bam, bai, bed - fail") { + + config "./window.config" + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), + file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) + ] + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.failed } + ) + } + + } + + test("homo_sapiens - bam, bai, [] - stub") { + + options "-stub" + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), + file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) + ] + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.global_txt[0][1]).name, + file(process.out.summary_txt[0][1]).name, + file(process.out.regions_txt[0][1]).name, + file(process.out.per_base_d4[0][1]).name, + file(process.out.per_base_bed[0][1]).name, + file(process.out.per_base_csi[0][1]).name, + file(process.out.regions_bed[0][1]).name, + file(process.out.regions_csi[0][1]).name, + file(process.out.quantized_bed[0][1]).name, + file(process.out.quantized_csi[0][1]).name, + file(process.out.thresholds_bed[0][1]).name, + file(process.out.thresholds_csi[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/mosdepth/tests/main.nf.test.snap b/modules/nf-core/mosdepth/tests/main.nf.test.snap new file mode 100644 index 00000000..dc4d9508 --- /dev/null +++ b/modules/nf-core/mosdepth/tests/main.nf.test.snap @@ -0,0 +1,1145 @@ +{ + "homo_sapiens - bam, bai, [] - stub": { + "content": [ + "test.global.dist.txt", + "test.summary.txt", + "test.region.dist.txt", + "test.per-base.d4", + "test.per-base.bed.gz", + "test.per-base.bed.gz.csi", + "test.regions.bed.gz", + "test.regions.bed.gz.csi", + "test.quantized.bed.gz", + "test.quantized.bed.gz.csi", + "test.thresholds.bed.gz", + "test.thresholds.bed.gz.csi", + [ + "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8" + ] + ], + "timestamp": "2023-11-27T15:14:34.897155161" + }, + "homo_sapiens - cram, crai, bed": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" + ] + ], + "10": [ + + ], + "11": [ + + ], + "12": [ + "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8" + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz:md5,5d398caf7171ec4406278e2add3009ae" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" + ] + ], + "8": [ + + ], + "9": [ + + ], + "global_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "per_base_bed": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a" + ] + ], + "per_base_csi": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" + ] + ], + "per_base_d4": [ + + ], + "quantized_bed": [ + + ], + "quantized_csi": [ + + ], + "regions_bed": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz:md5,5d398caf7171ec4406278e2add3009ae" + ] + ], + "regions_csi": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" + ] + ], + "regions_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "summary_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" + ] + ], + "thresholds_bed": [ + + ], + "thresholds_csi": [ + + ], + "versions": [ + "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8" + ] + } + ], + "timestamp": "2023-11-27T14:47:18.171150781" + }, + "homo_sapiens - bam, bai, [] - quantized": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59" + ] + ], + "10": [ + + ], + "11": [ + + ], + "12": [ + "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8" + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" + ] + ], + "6": [ + + ], + "7": [ + + ], + "8": [ + [ + { + "id": "test", + "single_end": true + }, + "test.quantized.bed.gz:md5,3e434a8bafcf59a67841ae3d4d752838" + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": true + }, + "test.quantized.bed.gz.csi:md5,be9617f551f19a33923f1e886eaefb93" + ] + ], + "global_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "per_base_bed": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a" + ] + ], + "per_base_csi": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" + ] + ], + "per_base_d4": [ + + ], + "quantized_bed": [ + [ + { + "id": "test", + "single_end": true + }, + "test.quantized.bed.gz:md5,3e434a8bafcf59a67841ae3d4d752838" + ] + ], + "quantized_csi": [ + [ + { + "id": "test", + "single_end": true + }, + "test.quantized.bed.gz.csi:md5,be9617f551f19a33923f1e886eaefb93" + ] + ], + "regions_bed": [ + + ], + "regions_csi": [ + + ], + "regions_txt": [ + + ], + "summary_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59" + ] + ], + "thresholds_bed": [ + + ], + "thresholds_csi": [ + + ], + "versions": [ + "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8" + ] + } + ], + "timestamp": "2023-11-27T14:47:29.228103864" + }, + "homo_sapiens - bam, bai, bed": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" + ] + ], + "10": [ + + ], + "11": [ + + ], + "12": [ + "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8" + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz:md5,5d398caf7171ec4406278e2add3009ae" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" + ] + ], + "8": [ + + ], + "9": [ + + ], + "global_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "per_base_bed": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a" + ] + ], + "per_base_csi": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" + ] + ], + "per_base_d4": [ + + ], + "quantized_bed": [ + + ], + "quantized_csi": [ + + ], + "regions_bed": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz:md5,5d398caf7171ec4406278e2add3009ae" + ] + ], + "regions_csi": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" + ] + ], + "regions_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "summary_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" + ] + ], + "thresholds_bed": [ + + ], + "thresholds_csi": [ + + ], + "versions": [ + "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8" + ] + } + ], + "timestamp": "2023-11-27T14:47:04.537716314" + }, + "homo_sapiens - bam, bai, [] - window": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" + ] + ], + "10": [ + + ], + "11": [ + + ], + "12": [ + "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8" + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.region.dist.txt:md5,39e0e707ec32feb5176fd20a95f1f468" + ] + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz:md5,f02e2cb49cc050e13d76942d6960827a" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz.csi:md5,257d67678136963d9dd904330079609d" + ] + ], + "8": [ + + ], + "9": [ + + ], + "global_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "per_base_bed": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a" + ] + ], + "per_base_csi": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" + ] + ], + "per_base_d4": [ + + ], + "quantized_bed": [ + + ], + "quantized_csi": [ + + ], + "regions_bed": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz:md5,f02e2cb49cc050e13d76942d6960827a" + ] + ], + "regions_csi": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz.csi:md5,257d67678136963d9dd904330079609d" + ] + ], + "regions_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.region.dist.txt:md5,39e0e707ec32feb5176fd20a95f1f468" + ] + ], + "summary_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" + ] + ], + "thresholds_bed": [ + + ], + "thresholds_csi": [ + + ], + "versions": [ + "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8" + ] + } + ], + "timestamp": "2023-11-27T14:47:23.708536171" + }, + "homo_sapiens - bam, bai, []": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59" + ] + ], + "10": [ + + ], + "11": [ + + ], + "12": [ + "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8" + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" + ] + ], + "6": [ + + ], + "7": [ + + ], + "8": [ + + ], + "9": [ + + ], + "global_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "per_base_bed": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a" + ] + ], + "per_base_csi": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" + ] + ], + "per_base_d4": [ + + ], + "quantized_bed": [ + + ], + "quantized_csi": [ + + ], + "regions_bed": [ + + ], + "regions_csi": [ + + ], + "regions_txt": [ + + ], + "summary_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59" + ] + ], + "thresholds_bed": [ + + ], + "thresholds_csi": [ + + ], + "versions": [ + "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8" + ] + } + ], + "timestamp": "2023-11-27T14:46:56.975710077" + }, + "homo_sapiens - cram, crai, []": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59" + ] + ], + "10": [ + + ], + "11": [ + + ], + "12": [ + "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8" + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" + ] + ], + "6": [ + + ], + "7": [ + + ], + "8": [ + + ], + "9": [ + + ], + "global_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "per_base_bed": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a" + ] + ], + "per_base_csi": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" + ] + ], + "per_base_d4": [ + + ], + "quantized_bed": [ + + ], + "quantized_csi": [ + + ], + "regions_bed": [ + + ], + "regions_csi": [ + + ], + "regions_txt": [ + + ], + "summary_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.summary.txt:md5,4f0d231060cbde4efdd673863bd2fb59" + ] + ], + "thresholds_bed": [ + + ], + "thresholds_csi": [ + + ], + "versions": [ + "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8" + ] + } + ], + "timestamp": "2023-11-27T14:47:12.09259995" + }, + "homo_sapiens - bam, bai, bed - thresholds": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": true + }, + "test.thresholds.bed.gz:md5,13101e326eea3cbfa1d569b69f494f4c" + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": true + }, + "test.thresholds.bed.gz.csi:md5,912055ee9452229439df6fae95644196" + ] + ], + "12": [ + "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8" + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz:md5,5d398caf7171ec4406278e2add3009ae" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" + ] + ], + "8": [ + + ], + "9": [ + + ], + "global_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.global.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "per_base_bed": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz:md5,bc1df47d46f818fee5275975925d769a" + ] + ], + "per_base_csi": [ + [ + { + "id": "test", + "single_end": true + }, + "test.per-base.bed.gz.csi:md5,9e649ac749ff6c6073bef5ab63e8aaa4" + ] + ], + "per_base_d4": [ + + ], + "quantized_bed": [ + + ], + "quantized_csi": [ + + ], + "regions_bed": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz:md5,5d398caf7171ec4406278e2add3009ae" + ] + ], + "regions_csi": [ + [ + { + "id": "test", + "single_end": true + }, + "test.regions.bed.gz.csi:md5,47669cfe41f3e222e74d81e1b1be191f" + ] + ], + "regions_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.region.dist.txt:md5,e82e90c7d508a135b5a8a7cd6933452e" + ] + ], + "summary_txt": [ + [ + { + "id": "test", + "single_end": true + }, + "test.mosdepth.summary.txt:md5,96c037f769974b904beb53edc4f56d82" + ] + ], + "thresholds_bed": [ + [ + { + "id": "test", + "single_end": true + }, + "test.thresholds.bed.gz:md5,13101e326eea3cbfa1d569b69f494f4c" + ] + ], + "thresholds_csi": [ + [ + { + "id": "test", + "single_end": true + }, + "test.thresholds.bed.gz.csi:md5,912055ee9452229439df6fae95644196" + ] + ], + "versions": [ + "versions.yml:md5,f8b1896c9c6784181f1234e87225f0e8" + ] + } + ], + "timestamp": "2023-11-27T14:49:44.311847326" + } +} \ No newline at end of file diff --git a/modules/nf-core/mosdepth/tests/quantized.config b/modules/nf-core/mosdepth/tests/quantized.config new file mode 100644 index 00000000..63c55350 --- /dev/null +++ b/modules/nf-core/mosdepth/tests/quantized.config @@ -0,0 +1,3 @@ +process { + ext.args = "--quantize 0:1:4:100:200" +} \ No newline at end of file diff --git a/modules/nf-core/mosdepth/tests/tags.yml b/modules/nf-core/mosdepth/tests/tags.yml new file mode 100644 index 00000000..5cd2e08e --- /dev/null +++ b/modules/nf-core/mosdepth/tests/tags.yml @@ -0,0 +1,2 @@ +mosdepth: + - "modules/nf-core/mosdepth/**" diff --git a/modules/nf-core/mosdepth/tests/threshold.config b/modules/nf-core/mosdepth/tests/threshold.config new file mode 100644 index 00000000..9b014ddf --- /dev/null +++ b/modules/nf-core/mosdepth/tests/threshold.config @@ -0,0 +1,3 @@ +process { + ext.args = "--thresholds 1,10,20,30" +} \ No newline at end of file diff --git a/modules/nf-core/mosdepth/tests/window.config b/modules/nf-core/mosdepth/tests/window.config new file mode 100644 index 00000000..7a0f755c --- /dev/null +++ b/modules/nf-core/mosdepth/tests/window.config @@ -0,0 +1,3 @@ +process { + ext.args = "--by 100" +} \ No newline at end of file diff --git a/modules/nf-core/nanoplot/environment.yml b/modules/nf-core/nanoplot/environment.yml new file mode 100644 index 00000000..219cd2e3 --- /dev/null +++ b/modules/nf-core/nanoplot/environment.yml @@ -0,0 +1,7 @@ +name: nanoplot +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::nanoplot=1.41.6 diff --git a/modules/nf-core/nanoplot/main.nf b/modules/nf-core/nanoplot/main.nf index ca0d8454..6dfe1352 100644 --- a/modules/nf-core/nanoplot/main.nf +++ b/modules/nf-core/nanoplot/main.nf @@ -2,10 +2,10 @@ process NANOPLOT { tag "$meta.id" label 'process_low' - conda "bioconda::nanoplot=1.41.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/nanoplot:1.41.0--pyhdfd78af_0' : - 'quay.io/biocontainers/nanoplot:1.41.0--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/nanoplot:1.41.6--pyhdfd78af_0' : + 'biocontainers/nanoplot:1.41.6--pyhdfd78af_0' }" input: tuple val(meta), path(ontfile) @@ -29,6 +29,7 @@ process NANOPLOT { $args \\ -t $task.cpus \\ $input_file + cat <<-END_VERSIONS > versions.yml "${task.process}": nanoplot: \$(echo \$(NanoPlot --version 2>&1) | sed 's/^.*NanoPlot //; s/ .*\$//') diff --git a/modules/nf-core/nanoplot/meta.yml b/modules/nf-core/nanoplot/meta.yml index 28c8c2d3..46fbd562 100644 --- a/modules/nf-core/nanoplot/meta.yml +++ b/modules/nf-core/nanoplot/meta.yml @@ -57,3 +57,6 @@ output: authors: - "@drpatelh" - "@yuukiiwa" +maintainers: + - "@drpatelh" + - "@yuukiiwa" diff --git a/modules/nf-core/nanoplot/tests/main.nf.test b/modules/nf-core/nanoplot/tests/main.nf.test new file mode 100644 index 00000000..d8dc6bc0 --- /dev/null +++ b/modules/nf-core/nanoplot/tests/main.nf.test @@ -0,0 +1,71 @@ +nextflow_process { + + name "Test Process NANOPLOT" + tag "modules_nfcore" + tag "modules" + tag "nanoplot" + script "../main.nf" + process "NANOPLOT" + + test("NanoPlot summary") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + [ file(params.test_data['sarscov2']['nanopore']['test_sequencing_summary'], checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.txt, + process.out.versions + ).match() + }, + { + with(process.out.html.get(0)) { + assert get(1).collect { p -> file(p).getName() }.contains("NanoPlot-report.html") + } + } + ) + } + + } + + test("NanoPlot FASTQ") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + [ file(params.test_data['sarscov2']['nanopore']['test_fastq_gz'], checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.txt, + process.out.versions + ).match() + }, + { + with(process.out.html.get(0)) { + assert get(1).collect { p -> file(p).getName() }.contains("NanoPlot-report.html") + } + } + ) + } + + } +} diff --git a/modules/nf-core/nanoplot/tests/main.nf.test.snap b/modules/nf-core/nanoplot/tests/main.nf.test.snap new file mode 100644 index 00000000..1df28066 --- /dev/null +++ b/modules/nf-core/nanoplot/tests/main.nf.test.snap @@ -0,0 +1,34 @@ +{ + "NanoPlot FASTQ": { + "content": [ + [ + [ + { + "id": "test" + }, + "NanoStats.txt:md5,50373c7543e71e3baf040926f0c69ac1" + ] + ], + [ + "versions.yml:md5,961cee64736aeb9e56b65d05ee3cd1a5" + ] + ], + "timestamp": "2023-10-17T16:18:44.848688965" + }, + "NanoPlot summary": { + "content": [ + [ + [ + { + "id": "test" + }, + "NanoStats.txt:md5,90464bf7049ca66106de56e7eac23dd4" + ] + ], + [ + "versions.yml:md5,961cee64736aeb9e56b65d05ee3cd1a5" + ] + ], + "timestamp": "2023-10-17T16:18:31.104601192" + } +} \ No newline at end of file diff --git a/modules/nf-core/nanoplot/tests/tags.yaml b/modules/nf-core/nanoplot/tests/tags.yaml new file mode 100644 index 00000000..7c6ce3fa --- /dev/null +++ b/modules/nf-core/nanoplot/tests/tags.yaml @@ -0,0 +1,2 @@ +nanoplot: + - modules/nf-core/nanoplot/** diff --git a/modules/nf-core/nextclade/datasetget/environment.yml b/modules/nf-core/nextclade/datasetget/environment.yml new file mode 100644 index 00000000..cdd9f646 --- /dev/null +++ b/modules/nf-core/nextclade/datasetget/environment.yml @@ -0,0 +1,7 @@ +name: nextclade_datasetget +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::nextclade=2.12.0 diff --git a/modules/nf-core/nextclade/datasetget/main.nf b/modules/nf-core/nextclade/datasetget/main.nf index ab2e20d3..70c900a5 100644 --- a/modules/nf-core/nextclade/datasetget/main.nf +++ b/modules/nf-core/nextclade/datasetget/main.nf @@ -2,10 +2,10 @@ process NEXTCLADE_DATASETGET { tag "$dataset" label 'process_low' - conda "bioconda::nextclade=2.12.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/nextclade:2.12.0--h9ee0642_0' : - 'quay.io/biocontainers/nextclade:2.12.0--h9ee0642_0' }" + 'biocontainers/nextclade:2.12.0--h9ee0642_0' }" input: val dataset diff --git a/modules/nf-core/nextclade/datasetget/meta.yml b/modules/nf-core/nextclade/datasetget/meta.yml index 16ee59f7..f3fb403e 100644 --- a/modules/nf-core/nextclade/datasetget/meta.yml +++ b/modules/nf-core/nextclade/datasetget/meta.yml @@ -10,9 +10,7 @@ tools: homepage: https://github.com/nextstrain/nextclade documentation: https://github.com/nextstrain/nextclade tool_dev_url: https://github.com/nextstrain/nextclade - licence: ["MIT"] - input: - dataset: type: string @@ -26,7 +24,6 @@ input: type: string description: Version tag of the dataset to download. A list of available datasets can be obtained using the nextclade dataset list command. pattern: ".+" - output: - versions: type: file @@ -36,7 +33,9 @@ output: type: path description: A directory containing the dataset files needed for nextclade run pattern: "prefix" - authors: - "@antunderwood" - "@drpatelh" +maintainers: + - "@antunderwood" + - "@drpatelh" diff --git a/modules/nf-core/nextclade/run/environment.yml b/modules/nf-core/nextclade/run/environment.yml new file mode 100644 index 00000000..1e50e8d4 --- /dev/null +++ b/modules/nf-core/nextclade/run/environment.yml @@ -0,0 +1,7 @@ +name: nextclade_run +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::nextclade=2.12.0 diff --git a/modules/nf-core/nextclade/run/main.nf b/modules/nf-core/nextclade/run/main.nf index 960892b7..33fb34c6 100644 --- a/modules/nf-core/nextclade/run/main.nf +++ b/modules/nf-core/nextclade/run/main.nf @@ -2,10 +2,10 @@ process NEXTCLADE_RUN { tag "$meta.id" label 'process_low' - conda "bioconda::nextclade=2.12.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/nextclade:2.12.0--h9ee0642_0' : - 'quay.io/biocontainers/nextclade:2.12.0--h9ee0642_0' }" + 'biocontainers/nextclade:2.12.0--h9ee0642_0' }" input: tuple val(meta), path(fasta) diff --git a/modules/nf-core/nextclade/run/meta.yml b/modules/nf-core/nextclade/run/meta.yml index 3271fca4..ceebfe20 100644 --- a/modules/nf-core/nextclade/run/meta.yml +++ b/modules/nf-core/nextclade/run/meta.yml @@ -10,9 +10,7 @@ tools: homepage: https://github.com/nextstrain/nextclade documentation: https://github.com/nextstrain/nextclade tool_dev_url: https://github.com/nextstrain/nextclade - licence: ["MIT"] - input: - meta: type: map @@ -27,7 +25,6 @@ input: type: file description: FASTA file containing one or more consensus sequences pattern: "*.{fasta,fa}" - output: - meta: type: map @@ -54,7 +51,9 @@ output: type: file description: TSV file containing nextclade results pattern: "*.{tsv}" - authors: - "@antunderwood" - "@drpatelh" +maintainers: + - "@antunderwood" + - "@drpatelh" diff --git a/modules/nf-core/pangolin/environment.yml b/modules/nf-core/pangolin/environment.yml new file mode 100644 index 00000000..3c4d98c8 --- /dev/null +++ b/modules/nf-core/pangolin/environment.yml @@ -0,0 +1,7 @@ +name: pangolin +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::pangolin=4.2 diff --git a/modules/nf-core/pangolin/main.nf b/modules/nf-core/pangolin/main.nf index e2db37b2..00cf4290 100644 --- a/modules/nf-core/pangolin/main.nf +++ b/modules/nf-core/pangolin/main.nf @@ -2,10 +2,10 @@ process PANGOLIN { tag "$meta.id" label 'process_medium' - conda "bioconda::pangolin=4.2" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/pangolin:4.2--pyhdfd78af_1' : - 'quay.io/biocontainers/pangolin:4.2--pyhdfd78af_1' }" + 'biocontainers/pangolin:4.2--pyhdfd78af_1' }" input: tuple val(meta), path(fasta) diff --git a/modules/nf-core/pangolin/meta.yml b/modules/nf-core/pangolin/meta.yml index 93c25a75..6493f2c8 100644 --- a/modules/nf-core/pangolin/meta.yml +++ b/modules/nf-core/pangolin/meta.yml @@ -32,3 +32,6 @@ output: authors: - "@kevinmenden" - "@drpatelh" +maintainers: + - "@kevinmenden" + - "@drpatelh" diff --git a/modules/nf-core/picard/collectmultiplemetrics/environment.yml b/modules/nf-core/picard/collectmultiplemetrics/environment.yml new file mode 100644 index 00000000..79b33280 --- /dev/null +++ b/modules/nf-core/picard/collectmultiplemetrics/environment.yml @@ -0,0 +1,7 @@ +name: picard_collectmultiplemetrics +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::picard=3.1.1 diff --git a/modules/nf-core/picard/collectmultiplemetrics/main.nf b/modules/nf-core/picard/collectmultiplemetrics/main.nf index ed88dbe7..5640ce94 100644 --- a/modules/nf-core/picard/collectmultiplemetrics/main.nf +++ b/modules/nf-core/picard/collectmultiplemetrics/main.nf @@ -2,10 +2,10 @@ process PICARD_COLLECTMULTIPLEMETRICS { tag "$meta.id" label 'process_single' - conda "bioconda::picard=3.0.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/picard:3.0.0--hdfd78af_1' : - 'quay.io/biocontainers/picard:3.0.0--hdfd78af_1' }" + 'https://depot.galaxyproject.org/singularity/picard:3.1.1--hdfd78af_0' : + 'biocontainers/picard:3.1.1--hdfd78af_0' }" input: tuple val(meta) , path(bam), path(bai) @@ -14,7 +14,7 @@ process PICARD_COLLECTMULTIPLEMETRICS { output: tuple val(meta), path("*_metrics"), emit: metrics - tuple val(meta), path("*.pdf") , emit: pdf + tuple val(meta), path("*.pdf") , emit: pdf, optional: true path "versions.yml" , emit: versions when: diff --git a/modules/nf-core/picard/collectmultiplemetrics/meta.yml b/modules/nf-core/picard/collectmultiplemetrics/meta.yml index 22656080..67bba57b 100644 --- a/modules/nf-core/picard/collectmultiplemetrics/meta.yml +++ b/modules/nf-core/picard/collectmultiplemetrics/meta.yml @@ -66,3 +66,5 @@ output: pattern: "versions.yml" authors: - "@drpatelh" +maintainers: + - "@drpatelh" diff --git a/modules/nf-core/picard/markduplicates/environment.yml b/modules/nf-core/picard/markduplicates/environment.yml new file mode 100644 index 00000000..58b795f5 --- /dev/null +++ b/modules/nf-core/picard/markduplicates/environment.yml @@ -0,0 +1,7 @@ +name: picard_markduplicates +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::picard=3.1.1 diff --git a/modules/nf-core/picard/markduplicates/main.nf b/modules/nf-core/picard/markduplicates/main.nf index 1fe6ee2d..80930cc4 100644 --- a/modules/nf-core/picard/markduplicates/main.nf +++ b/modules/nf-core/picard/markduplicates/main.nf @@ -2,15 +2,15 @@ process PICARD_MARKDUPLICATES { tag "$meta.id" label 'process_medium' - conda "bioconda::picard=3.0.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/picard:3.0.0--hdfd78af_1' : - 'quay.io/biocontainers/picard:3.0.0--hdfd78af_1' }" + 'https://depot.galaxyproject.org/singularity/picard:3.1.1--hdfd78af_0' : + 'biocontainers/picard:3.1.1--hdfd78af_0' }" input: tuple val(meta), path(bam) - path fasta - path fai + tuple val(meta2), path(fasta) + tuple val(meta3), path(fai) output: tuple val(meta), path("*.bam") , emit: bam @@ -30,6 +30,9 @@ process PICARD_MARKDUPLICATES { } else { avail_mem = (task.memory.mega*0.8).intValue() } + + if ("$bam" == "${prefix}.bam") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + """ picard \\ -Xmx${avail_mem}M \\ @@ -48,6 +51,7 @@ process PICARD_MARKDUPLICATES { stub: def prefix = task.ext.prefix ?: "${meta.id}" + if ("$bam" == "${prefix}.bam") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" """ touch ${prefix}.bam touch ${prefix}.bam.bai diff --git a/modules/nf-core/picard/markduplicates/meta.yml b/modules/nf-core/picard/markduplicates/meta.yml index 3f2357bb..1ab90c07 100644 --- a/modules/nf-core/picard/markduplicates/meta.yml +++ b/modules/nf-core/picard/markduplicates/meta.yml @@ -25,10 +25,20 @@ input: type: file description: BAM file pattern: "*.{bam,cram,sam}" + - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] - fasta: type: file description: Reference genome fasta file pattern: "*.{fasta,fa}" + - meta3: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] - fai: type: file description: Reference genome fasta index @@ -58,3 +68,8 @@ output: authors: - "@drpatelh" - "@projectoriented" + - "@ramprasadn" +maintainers: + - "@drpatelh" + - "@projectoriented" + - "@ramprasadn" diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test b/modules/nf-core/picard/markduplicates/tests/main.nf.test new file mode 100644 index 00000000..b2bba094 --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test @@ -0,0 +1,111 @@ +nextflow_process { + + name "Test Process PICARD_MARKDUPLICATES" + script "../main.nf" + process "PICARD_MARKDUPLICATES" + config "./nextflow.config" + tag "modules" + tag "modules_nfcore" + tag "picard" + tag "picard/markduplicates" + + test("sarscov2 - bam, fasta, fai - sorted bam") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [ + [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + path(process.out.metrics.get(0).get(1)).readLines()[0..2], + process.out.versions + ).match() } + ) + } + } + + test("sarscov2 - bam, fasta, fai - unsorted bam") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [ + [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + path(process.out.metrics.get(0).get(1)).readLines()[0..2], + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens - cram, fasta, fai") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true) + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + path(process.out.metrics.get(0).get(1)).readLines()[0..2], + process.out.versions + ).match() } + ) + } + } + +} diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap new file mode 100644 index 00000000..cd788a4d --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap @@ -0,0 +1,44 @@ +{ + "sarscov2 - bam, fasta, fai - unsorted bam": { + "content": [ + "test.marked.bam", + [ + "## htsjdk.samtools.metrics.StringHeader", + "# MarkDuplicates --INPUT test.paired_end.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", + "## htsjdk.samtools.metrics.StringHeader" + ], + [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ] + ], + "timestamp": "2023-11-28T10:50:37.735339781" + }, + "homo_sapiens - cram, fasta, fai": { + "content": [ + "test.marked.bam", + [ + "## htsjdk.samtools.metrics.StringHeader", + "# MarkDuplicates --INPUT test.paired_end.sorted.cram --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", + "## htsjdk.samtools.metrics.StringHeader" + ], + [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ] + ], + "timestamp": "2023-11-28T10:50:48.897954543" + }, + "sarscov2 - bam, fasta, fai - sorted bam": { + "content": [ + "test.marked.bam", + [ + "## htsjdk.samtools.metrics.StringHeader", + "# MarkDuplicates --INPUT test.paired_end.sorted.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", + "## htsjdk.samtools.metrics.StringHeader" + ], + [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ] + ], + "timestamp": "2023-11-28T10:50:26.591387512" + } +} \ No newline at end of file diff --git a/modules/nf-core/picard/markduplicates/tests/nextflow.config b/modules/nf-core/picard/markduplicates/tests/nextflow.config new file mode 100644 index 00000000..02818dd6 --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/nextflow.config @@ -0,0 +1,6 @@ +process { + withName: PICARD_MARKDUPLICATES { + ext.prefix = { "${meta.id}.marked" } + ext.args = '--ASSUME_SORT_ORDER queryname' + } +} diff --git a/modules/nf-core/picard/markduplicates/tests/tags.yml b/modules/nf-core/picard/markduplicates/tests/tags.yml new file mode 100644 index 00000000..4f213d62 --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/tags.yml @@ -0,0 +1,2 @@ +picard/markduplicates: + - modules/nf-core/picard/markduplicates/** diff --git a/modules/nf-core/plasmidid/environment.yml b/modules/nf-core/plasmidid/environment.yml new file mode 100644 index 00000000..1eda21d5 --- /dev/null +++ b/modules/nf-core/plasmidid/environment.yml @@ -0,0 +1,7 @@ +name: plasmidid +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::plasmidid=1.6.5 diff --git a/modules/nf-core/plasmidid/main.nf b/modules/nf-core/plasmidid/main.nf index ff7165b1..32fe7716 100644 --- a/modules/nf-core/plasmidid/main.nf +++ b/modules/nf-core/plasmidid/main.nf @@ -2,10 +2,10 @@ process PLASMIDID { tag "$meta.id" label 'process_medium' - conda "bioconda::plasmidid=1.6.5" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/plasmidid:1.6.5--hdfd78af_0' : - 'quay.io/biocontainers/plasmidid:1.6.5--hdfd78af_0' }" + 'biocontainers/plasmidid:1.6.5--hdfd78af_0' }" input: tuple val(meta), path(scaffold) diff --git a/modules/nf-core/plasmidid/meta.yml b/modules/nf-core/plasmidid/meta.yml index 4e0169d8..66479359 100644 --- a/modules/nf-core/plasmidid/meta.yml +++ b/modules/nf-core/plasmidid/meta.yml @@ -10,9 +10,7 @@ tools: homepage: https://github.com/BU-ISCIII/plasmidID/wiki documentation: https://github.com/BU-ISCIII/plasmidID#readme tool_dev_url: https://github.com/BU-ISCIII/plasmidID - licence: ["GPL v3"] - input: - meta: type: map @@ -27,7 +25,6 @@ input: type: file description: FASTA reference file pattern: "*.{fasta,fa}" - output: - meta: type: map @@ -70,7 +67,9 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/pycoqc/environment.yml b/modules/nf-core/pycoqc/environment.yml new file mode 100644 index 00000000..c2a3a4d1 --- /dev/null +++ b/modules/nf-core/pycoqc/environment.yml @@ -0,0 +1,7 @@ +name: pycoqc +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::pycoqc=2.5.2 diff --git a/modules/nf-core/pycoqc/main.nf b/modules/nf-core/pycoqc/main.nf index 02092a4b..98169db2 100644 --- a/modules/nf-core/pycoqc/main.nf +++ b/modules/nf-core/pycoqc/main.nf @@ -2,10 +2,10 @@ process PYCOQC { tag "$summary" label 'process_medium' - conda "bioconda::pycoqc=2.5.2" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/pycoqc:2.5.2--py_0' : - 'quay.io/biocontainers/pycoqc:2.5.2--py_0' }" + 'biocontainers/pycoqc:2.5.2--py_0' }" input: tuple val(meta), path(summary) diff --git a/modules/nf-core/pycoqc/meta.yml b/modules/nf-core/pycoqc/meta.yml index 83748855..cfbd8516 100644 --- a/modules/nf-core/pycoqc/meta.yml +++ b/modules/nf-core/pycoqc/meta.yml @@ -13,7 +13,6 @@ tools: tool_dev_url: https://github.com/tleonardi/pycoQC doi: "10.21105/joss.01236" licence: ["GNU General Public v3 (GPL v3)"] - input: - meta: type: map @@ -24,7 +23,6 @@ input: type: file description: sequencing summary file pattern: "*.{txt}" - output: - meta: type: map @@ -42,7 +40,9 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/pycoqc/tests/main.nf.test b/modules/nf-core/pycoqc/tests/main.nf.test new file mode 100644 index 00000000..afc15a98 --- /dev/null +++ b/modules/nf-core/pycoqc/tests/main.nf.test @@ -0,0 +1,43 @@ +nextflow_process { + + name "Test Process PYCOQC" + script "../main.nf" + config "./nextflow.config" + process "PYCOQC" + tag "modules" + tag "modules_nfcore" + tag "pycoqc" + + test("sarscov2 nanopore [sequencing_summary.txt]") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.test_data['sarscov2']['nanopore']['test_sequencing_summary'], checkIfExists: true) + ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.versions).match("versions") }, + { assert process.out.html.get(0).get(1) ==~ ".*/test.html" }, + { + with (process.out.json.get(0)) { + assert snapshot(path(get(1)).json['All Reads']).match("all_reads") + } + } + ) + } + + } + +} diff --git a/modules/nf-core/pycoqc/tests/main.nf.test.snap b/modules/nf-core/pycoqc/tests/main.nf.test.snap new file mode 100644 index 00000000..6f76ec99 --- /dev/null +++ b/modules/nf-core/pycoqc/tests/main.nf.test.snap @@ -0,0 +1,642 @@ +{ + "versions": { + "content": [ + [ + "versions.yml:md5,b8cbbd20cd14b232853b22dad9097029" + ] + ], + "timestamp": "2023-10-26T12:27:18.329232497" + }, + "all_reads": { + "content": [ + { + "run": { + "run_duration": 0.05634208255343967, + "active_channels": 4, + "runid_number": 85, + "barcodes_number": 2 + }, + "basecall": { + "reads_number": 100, + "bases_number": 1160, + "N50": 12, + "len_percentiles": [ + 7.0, + 7.99, + 8.0, + 8.0, + 8.96, + 9.0, + 9.0, + 9.0, + 9.0, + 9.0, + 9.0, + 9.0, + 9.0, + 9.0, + 9.860000000000001, + 10.0, + 10.0, + 10.0, + 10.0, + 10.0, + 10.0, + 10.0, + 10.0, + 10.0, + 10.759999999999998, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.0, + 11.490000000000002, + 12.0, + 12.0, + 12.0, + 12.0, + 12.0, + 12.0, + 12.0, + 12.0, + 12.0, + 12.0, + 12.0, + 12.0, + 12.0, + 12.350000000000009, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.0, + 13.129999999999995, + 14.0, + 14.0, + 14.0, + 14.0, + 14.0, + 14.0, + 14.0, + 14.0, + 14.0, + 14.030000000000001, + 15.019999999999996, + 16.010000000000005, + 17.0 + ], + "qual_score_percentiles": [ + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0 + ], + "len_hist": { + "x": [ + 7.079467203414813, + 7.1598365548894245, + 7.241118296021455, + 7.323322784675837, + 7.406460496304719, + 7.490542025282382, + 7.575578086255286, + 7.661579515507467, + 7.748557272341409, + 7.836522440474623, + 7.925486229452044, + 8.0154599760745, + 8.106455145843357, + 8.198483334421615, + 8.291556269111537, + 8.38568581034909, + 8.480883953215336, + 8.577162828964994, + 8.674534706572327, + 8.773011994294619, + 8.872607241253366, + 8.973333139033429, + 9.075202523300351, + 9.178228375436028, + 9.282423824192943, + 9.38780214736718, + 9.494376773490446, + 9.60216128354128, + 9.711169412675714, + 9.821415051977546, + 9.93291225022852, + 10.045675215698578, + 10.159718317956445, + 10.275056089700772, + 10.39170322861204, + 10.509674599225537, + 10.628985234825558, + 10.74965033936112, + 10.87168528938343, + 10.995105636005325, + 11.11992710688301, + 11.24616560822024, + 11.373837226795256, + 11.502958232010789, + 11.633545077967261, + 11.765614405559578, + 11.899183044597708, + 12.0342680159513, + 12.170886533718726, + 12.309056007420674, + 12.448794044218685, + 12.590118451158833, + 12.733047237440953, + 12.877598616713547, + 13.023791009394788, + 13.171643045019879, + 13.321173564615009, + 13.472401623098337, + 13.625346491708175, + 13.780027660458732, + 13.936464840623792, + 14.094677967248542, + 14.254687201689917, + 14.416512934185814, + 14.580175786453418, + 14.74569661431711, + 14.913096510366126, + 15.082396806642413, + 15.253619077359039, + 15.426785141649408, + 15.601917066347703, + 15.779037168800926, + 15.958168019712783, + 16.139332446019967, + 16.322553533800992, + 16.507854631218105, + 16.69525935149256, + 16.88479157591372, + 17.076475456882275, + 17.270335420988005, + 17.466396172122547, + 17.66468269462737, + 17.86522025647767, + 18.068034412502243, + 18.27315100763998, + 18.48059618023337, + 18.69039636535932, + 18.902578298197817, + 19.117169017438876, + 19.33419586872804, + 19.553686508151195, + 19.77566890575874, + 20.00017134912987, + 20.22722244697736, + 20.456851132793165, + 20.689086668535484, + 20.923958648357658, + 21.16149700237941, + 21.401732000500846 + ], + "y": [ + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 1.0, + 1.0, + 1.0, + 1.0, + 1.0, + 0.0, + 0.0, + 0.0, + 0.0, + 1.0, + 1.0, + 1.0, + 1.0, + 1.0, + 0.0, + 0.0, + 0.0, + 1.0, + 3.0, + 4.0, + 5.0, + 4.0, + 3.0, + 2.0, + 1.0, + 1.0, + 2.0, + 2.0, + 2.0, + 1.0, + 1.0, + 1.0, + 2.0, + 3.0, + 4.0, + 3.0, + 2.0, + 1.0, + 1.0, + 1.0, + 1.0, + 2.0, + 1.0, + 1.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0 + ] + }, + "qual_score_hist": { + "x": [ + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0 + ], + "y": [ + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 0.0, + 1.0, + 3.0, + 9.0, + 18.0, + 29.0, + 37.0 + ] + } + } + } + ], + "timestamp": "2023-10-26T12:19:31.009207323" + } +} \ No newline at end of file diff --git a/modules/nf-core/pycoqc/tests/nextflow.config b/modules/nf-core/pycoqc/tests/nextflow.config new file mode 100644 index 00000000..d532f8f7 --- /dev/null +++ b/modules/nf-core/pycoqc/tests/nextflow.config @@ -0,0 +1,9 @@ +process { + + publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } + + withName: PYCOQC { + ext.args = '--min_pass_qual 0' + } + +} diff --git a/modules/nf-core/pycoqc/tests/tags.yml b/modules/nf-core/pycoqc/tests/tags.yml new file mode 100644 index 00000000..ab301426 --- /dev/null +++ b/modules/nf-core/pycoqc/tests/tags.yml @@ -0,0 +1,2 @@ +pycoqc: + - modules/nf-core/pycoqc/** diff --git a/modules/nf-core/quast/environment.yml b/modules/nf-core/quast/environment.yml new file mode 100644 index 00000000..0f9e3079 --- /dev/null +++ b/modules/nf-core/quast/environment.yml @@ -0,0 +1,7 @@ +name: quast +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::quast=5.2.0 diff --git a/modules/nf-core/quast/main.nf b/modules/nf-core/quast/main.nf index a7f9a4c8..d8f36284 100644 --- a/modules/nf-core/quast/main.nf +++ b/modules/nf-core/quast/main.nf @@ -1,31 +1,33 @@ process QUAST { + tag "$meta.id" label 'process_medium' - conda "bioconda::quast=5.2.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/quast:5.2.0--py39pl5321h2add14b_1' : - 'quay.io/biocontainers/quast:5.2.0--py39pl5321h2add14b_1' }" + 'biocontainers/quast:5.2.0--py39pl5321h2add14b_1' }" input: - path consensus - path fasta - path gff - val use_fasta - val use_gff + tuple val(meta) , path(consensus) + tuple val(meta2), path(fasta) + tuple val(meta3), path(gff) output: - path "${prefix}" , emit: results - path '*.tsv' , emit: tsv - path "versions.yml" , emit: versions + tuple val(meta), path("${prefix}") , emit: results + tuple val(meta), path("${prefix}.tsv") , emit: tsv + tuple val(meta), path("${prefix}_transcriptome.tsv") , optional: true , emit: transcriptome + tuple val(meta), path("${prefix}_misassemblies.tsv") , optional: true , emit: misassemblies + tuple val(meta), path("${prefix}_unaligned.tsv") , optional: true , emit: unaligned + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' - prefix = task.ext.prefix ?: 'quast' - def features = use_gff ? "--features $gff" : '' - def reference = use_fasta ? "-r $fasta" : '' + def args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + def features = gff ? "--features $gff" : '' + def reference = fasta ? "-r $fasta" : '' """ quast.py \\ --output-dir $prefix \\ @@ -35,7 +37,96 @@ process QUAST { $args \\ ${consensus.join(' ')} - ln -s ${prefix}/report.tsv + ln -s ${prefix}/report.tsv ${prefix}.tsv + [ -f ${prefix}/contigs_reports/all_alignments_transcriptome.tsv ] && ln -s ${prefix}/contigs_reports/all_alignments_transcriptome.tsv ${prefix}_transcriptome.tsv + [ -f ${prefix}/contigs_reports/misassemblies_report.tsv ] && ln -s ${prefix}/contigs_reports/misassemblies_report.tsv ${prefix}_misassemblies.tsv + [ -f ${prefix}/contigs_reports/unaligned_report.tsv ] && ln -s ${prefix}/contigs_reports/unaligned_report.tsv ${prefix}_unaligned.tsv + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + quast: \$(quast.py --version 2>&1 | sed 's/^.*QUAST v//; s/ .*\$//') + END_VERSIONS + """ + + stub: + def args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}" + def features = gff ? "--features $gff" : '' + def reference = fasta ? "-r $fasta" : '' + + """ + mkdir -p $prefix + touch $prefix/report.tsv + touch $prefix/report.html + touch $prefix/report.pdf + touch $prefix/quast.log + touch $prefix/transposed_report.txt + touch $prefix/transposed_report.tex + touch $prefix/icarus.html + touch $prefix/report.tex + touch $prefix/report.txt + + mkdir -p $prefix/basic_stats + touch $prefix/basic_stats/cumulative_plot.pdf + touch $prefix/basic_stats/Nx_plot.pdf + touch $prefix/basic_stats/genome_GC_content_plot.pdf + touch $prefix/basic_stats/GC_content_plot.pdf + + mkdir -p $prefix/icarus_viewers + touch $prefix/icarus_viewers/contig_size_viewer.html + + ln -s $prefix/report.tsv ${prefix}.tsv + + if [ $fasta ]; then + touch $prefix/basic_stats/NGx_plot.pdf + touch $prefix/basic_stats/gc.icarus.txt + + mkdir -p $prefix/aligned_stats + touch $prefix/aligned_stats/NAx_plot.pdf + touch $prefix/aligned_stats/NGAx_plot.pdf + touch $prefix/aligned_stats/cumulative_plot.pdf + + mkdir -p $prefix/contigs_reports + touch $prefix/contigs_reports/all_alignments_transcriptome.tsv + touch $prefix/contigs_reports/contigs_report_transcriptome.mis_contigs.info + touch $prefix/contigs_reports/contigs_report_transcriptome.stderr + touch $prefix/contigs_reports/contigs_report_transcriptome.stdout + touch $prefix/contigs_reports/contigs_report_transcriptome.unaligned.info + mkdir -p $prefix/contigs_reports/minimap_output + touch $prefix/contigs_reports/minimap_output/transcriptome.coords + touch $prefix/contigs_reports/minimap_output/transcriptome.coords.filtered + touch $prefix/contigs_reports/minimap_output/transcriptome.coords_tmp + touch $prefix/contigs_reports/minimap_output/transcriptome.sf + touch $prefix/contigs_reports/minimap_output/transcriptome.unaligned + touch $prefix/contigs_reports/minimap_output/transcriptome.used_snps + touch $prefix/contigs_reports/misassemblies_frcurve_plot.pdf + touch $prefix/contigs_reports/misassemblies_plot.pdf + touch $prefix/contigs_reports/misassemblies_report.tex + touch $prefix/contigs_reports/misassemblies_report.tsv + touch $prefix/contigs_reports/misassemblies_report.txt + touch $prefix/contigs_reports/transcriptome.mis_contigs.fa + touch $prefix/contigs_reports/transposed_report_misassemblies.tex + touch $prefix/contigs_reports/transposed_report_misassemblies.tsv + touch $prefix/contigs_reports/transposed_report_misassemblies.txt + touch $prefix/contigs_reports/unaligned_report.tex + touch $prefix/contigs_reports/unaligned_report.tsv + touch $prefix/contigs_reports/unaligned_report.txt + + mkdir -p $prefix/genome_stats + touch $prefix/genome_stats/genome_info.txt + touch $prefix/genome_stats/transcriptome_gaps.txt + touch $prefix/icarus_viewers/alignment_viewer.html + + ln -sf ${prefix}/contigs_reports/misassemblies_report.tsv ${prefix}_misassemblies.tsv + ln -sf ${prefix}/contigs_reports/unaligned_report.tsv ${prefix}_unaligned.tsv + ln -sf ${prefix}/contigs_reports/all_alignments_transcriptome.tsv ${prefix}_transcriptome.tsv + + fi + + if ([ $fasta ] && [ $gff ]); then + touch $prefix/genome_stats/features_cumulative_plot.pdf + touch $prefix/genome_stats/features_frcurve_plot.pdf + fi cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/quast/meta.yml b/modules/nf-core/quast/meta.yml index 2189bb3e..5850ff98 100644 --- a/modules/nf-core/quast/meta.yml +++ b/modules/nf-core/quast/meta.yml @@ -4,6 +4,8 @@ keywords: - quast - assembly - quality + - contig + - scaffold tools: - quast: description: | @@ -20,16 +22,9 @@ input: type: file description: | The genome assembly to be evaluated. Has to contain at least a non-empty string dummy value. - - use_fasta: - type: boolean - description: Whether to use the provided fasta reference genome file - gff: type: file description: The genome GFF file. Has to contain at least a non-empty string dummy value. - - use_gff: - type: boolean - description: Whether to use the provided gff reference annotation file - output: - quast: type: directory @@ -38,13 +33,29 @@ output: - report: type: file description: tab-separated version of the summary, suitable for spreadsheets and mqc - pattern: "report.tsv" - + pattern: "${prefix}.tsv" + - misassemblies: + type: file + description: | + Report containing misassemblies, only when a reference fasta is provided + pattern: "${prefix}_misassemblies.tsv" + - transcriptome: + type: file + description: | + Report containing all the alignments of transcriptome to the assembly, only when a reference fasta is provided + pattern: "${prefix}_transcriptome.tsv" + - unaligned: + type: file + description: | + Report containing unaligned contigs, only when a reference fasta is provided + pattern: "${prefix}_unaligned.tsv" - versions: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@drpatelh" - "@kevinmenden" +maintainers: + - "@drpatelh" + - "@kevinmenden" diff --git a/modules/nf-core/samtools/flagstat/environment.yml b/modules/nf-core/samtools/flagstat/environment.yml new file mode 100644 index 00000000..5efae053 --- /dev/null +++ b/modules/nf-core/samtools/flagstat/environment.yml @@ -0,0 +1,7 @@ +name: samtools_flagstat +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/flagstat/main.nf b/modules/nf-core/samtools/flagstat/main.nf index 2120cd7d..f1893d7c 100644 --- a/modules/nf-core/samtools/flagstat/main.nf +++ b/modules/nf-core/samtools/flagstat/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_FLAGSTAT { tag "$meta.id" label 'process_single' - conda "bioconda::samtools=1.16.1" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' : - 'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : + 'biocontainers/samtools:1.18--h50ea8bc_1' }" input: tuple val(meta), path(bam), path(bai) @@ -32,4 +32,15 @@ process SAMTOOLS_FLAGSTAT { samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') END_VERSIONS """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.flagstat + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ } diff --git a/modules/nf-core/samtools/flagstat/meta.yml b/modules/nf-core/samtools/flagstat/meta.yml index 954225df..97991358 100644 --- a/modules/nf-core/samtools/flagstat/meta.yml +++ b/modules/nf-core/samtools/flagstat/meta.yml @@ -47,3 +47,5 @@ output: pattern: "versions.yml" authors: - "@drpatelh" +maintainers: + - "@drpatelh" diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test b/modules/nf-core/samtools/flagstat/tests/main.nf.test new file mode 100644 index 00000000..c8dd8dc9 --- /dev/null +++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test @@ -0,0 +1,36 @@ +nextflow_process { + + name "Test Process SAMTOOLS_FLAGSTAT" + script "../main.nf" + process "SAMTOOLS_FLAGSTAT" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/flagstat" + + test("BAM") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.flagstat).match() }, + { assert path(process.out.versions.get(0)).getText().contains("samtools") } + ) + } + } +} diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap new file mode 100644 index 00000000..880019f2 --- /dev/null +++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap @@ -0,0 +1,16 @@ +{ + "BAM": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ] + ], + "timestamp": "2023-11-14T15:49:22.577133" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/flagstat/tests/tags.yml b/modules/nf-core/samtools/flagstat/tests/tags.yml new file mode 100644 index 00000000..2d2b7255 --- /dev/null +++ b/modules/nf-core/samtools/flagstat/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/flagstat: + - modules/nf-core/samtools/flagstat/** diff --git a/modules/nf-core/samtools/idxstats/environment.yml b/modules/nf-core/samtools/idxstats/environment.yml new file mode 100644 index 00000000..2401db0f --- /dev/null +++ b/modules/nf-core/samtools/idxstats/environment.yml @@ -0,0 +1,7 @@ +name: samtools_idxstats +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/idxstats/main.nf b/modules/nf-core/samtools/idxstats/main.nf index a7b87d8b..00d916bb 100644 --- a/modules/nf-core/samtools/idxstats/main.nf +++ b/modules/nf-core/samtools/idxstats/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_IDXSTATS { tag "$meta.id" label 'process_single' - conda "bioconda::samtools=1.16.1" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' : - 'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : + 'biocontainers/samtools:1.18--h50ea8bc_1' }" input: tuple val(meta), path(bam), path(bai) @@ -33,4 +33,16 @@ process SAMTOOLS_IDXSTATS { samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') END_VERSIONS """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + + """ + touch ${prefix}.idxstats + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ } diff --git a/modules/nf-core/samtools/idxstats/meta.yml b/modules/nf-core/samtools/idxstats/meta.yml index dda87e1e..344e92a3 100644 --- a/modules/nf-core/samtools/idxstats/meta.yml +++ b/modules/nf-core/samtools/idxstats/meta.yml @@ -48,3 +48,5 @@ output: pattern: "versions.yml" authors: - "@drpatelh" +maintainers: + - "@drpatelh" diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test b/modules/nf-core/samtools/idxstats/tests/main.nf.test new file mode 100644 index 00000000..f6c92150 --- /dev/null +++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test @@ -0,0 +1,36 @@ +nextflow_process { + + name "Test Process SAMTOOLS_IDXSTATS" + script "../main.nf" + process "SAMTOOLS_IDXSTATS" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/idxstats" + + test("BAM") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.idxstats).match() }, + { assert path(process.out.versions.get(0)).getText().contains("samtools") } + ) + } + } +} diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap new file mode 100644 index 00000000..4c6c12bd --- /dev/null +++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap @@ -0,0 +1,16 @@ +{ + "BAM": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + ] + ] + ], + "timestamp": "2023-11-14T15:52:19.875194" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/idxstats/tests/tags.yml b/modules/nf-core/samtools/idxstats/tests/tags.yml new file mode 100644 index 00000000..d3057c61 --- /dev/null +++ b/modules/nf-core/samtools/idxstats/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/idxstats: + - modules/nf-core/samtools/idxstats/** diff --git a/modules/nf-core/samtools/index/environment.yml b/modules/nf-core/samtools/index/environment.yml new file mode 100644 index 00000000..296ed99e --- /dev/null +++ b/modules/nf-core/samtools/index/environment.yml @@ -0,0 +1,7 @@ +name: samtools_index +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/index/main.nf b/modules/nf-core/samtools/index/main.nf index 8b95687a..8ad18fdc 100644 --- a/modules/nf-core/samtools/index/main.nf +++ b/modules/nf-core/samtools/index/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_INDEX { tag "$meta.id" label 'process_low' - conda "bioconda::samtools=1.16.1" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' : - 'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : + 'biocontainers/samtools:1.18--h50ea8bc_1' }" input: tuple val(meta), path(input) diff --git a/modules/nf-core/samtools/index/meta.yml b/modules/nf-core/samtools/index/meta.yml index 8bd2fa6f..01a4ee03 100644 --- a/modules/nf-core/samtools/index/meta.yml +++ b/modules/nf-core/samtools/index/meta.yml @@ -51,3 +51,7 @@ authors: - "@drpatelh" - "@ewels" - "@maxulysse" +maintainers: + - "@drpatelh" + - "@ewels" + - "@maxulysse" diff --git a/modules/nf-core/samtools/index/tests/csi.nextflow.config b/modules/nf-core/samtools/index/tests/csi.nextflow.config new file mode 100644 index 00000000..0ed260ef --- /dev/null +++ b/modules/nf-core/samtools/index/tests/csi.nextflow.config @@ -0,0 +1,7 @@ +process { + + withName: SAMTOOLS_INDEX { + ext.args = '-c' + } + +} diff --git a/modules/nf-core/samtools/index/tests/main.nf.test b/modules/nf-core/samtools/index/tests/main.nf.test new file mode 100644 index 00000000..c76a9169 --- /dev/null +++ b/modules/nf-core/samtools/index/tests/main.nf.test @@ -0,0 +1,87 @@ +nextflow_process { + + name "Test Process SAMTOOLS_INDEX" + script "../main.nf" + process "SAMTOOLS_INDEX" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/index" + + test("sarscov2 [BAI]") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.bai).match("bai") }, + { assert path(process.out.versions.get(0)).getText().contains("samtools") } + ) + } + } + + test("homo_sapiens [CRAI]") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.crai).match("crai") }, + { assert path(process.out.versions.get(0)).getText().contains("samtools") } + ) + } + } + + test("homo_sapiens [CSI]") { + + config "./csi.nextflow.config" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert path(process.out.csi.get(0).get(1)).exists() }, + { assert path(process.out.versions.get(0)).getText().contains("samtools") } + ) + } + } +} diff --git a/modules/nf-core/samtools/index/tests/main.nf.test.snap b/modules/nf-core/samtools/index/tests/main.nf.test.snap new file mode 100644 index 00000000..b3baee7f --- /dev/null +++ b/modules/nf-core/samtools/index/tests/main.nf.test.snap @@ -0,0 +1,28 @@ +{ + "crai": { + "content": [ + [ + [ + { + "id": "test" + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029" + ] + ] + ], + "timestamp": "2023-11-15T15:17:37.30801" + }, + "bai": { + "content": [ + [ + [ + { + "id": "test" + }, + "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4" + ] + ] + ], + "timestamp": "2023-11-15T15:17:30.869234" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/index/tests/tags.yml b/modules/nf-core/samtools/index/tests/tags.yml new file mode 100644 index 00000000..e0f58a7a --- /dev/null +++ b/modules/nf-core/samtools/index/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/index: + - modules/nf-core/samtools/index/** diff --git a/modules/nf-core/samtools/sort/environment.yml b/modules/nf-core/samtools/sort/environment.yml new file mode 100644 index 00000000..cd50868c --- /dev/null +++ b/modules/nf-core/samtools/sort/environment.yml @@ -0,0 +1,7 @@ +name: samtools_sort +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/sort/main.nf b/modules/nf-core/samtools/sort/main.nf index 84c167cd..4a666d42 100644 --- a/modules/nf-core/samtools/sort/main.nf +++ b/modules/nf-core/samtools/sort/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_SORT { tag "$meta.id" label 'process_medium' - conda "bioconda::samtools=1.16.1" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' : - 'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : + 'biocontainers/samtools:1.18--h50ea8bc_1' }" input: tuple val(meta), path(bam) @@ -23,7 +23,13 @@ process SAMTOOLS_SORT { def prefix = task.ext.prefix ?: "${meta.id}" if ("$bam" == "${prefix}.bam") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" """ - samtools sort $args -@ $task.cpus -o ${prefix}.bam -T $prefix $bam + samtools sort \\ + $args \\ + -@ $task.cpus \\ + -o ${prefix}.bam \\ + -T $prefix \\ + $bam + cat <<-END_VERSIONS > versions.yml "${task.process}": samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') diff --git a/modules/nf-core/samtools/sort/meta.yml b/modules/nf-core/samtools/sort/meta.yml index 07328431..2200de72 100644 --- a/modules/nf-core/samtools/sort/meta.yml +++ b/modules/nf-core/samtools/sort/meta.yml @@ -46,3 +46,6 @@ output: authors: - "@drpatelh" - "@ewels" +maintainers: + - "@drpatelh" + - "@ewels" diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test b/modules/nf-core/samtools/sort/tests/main.nf.test new file mode 100644 index 00000000..abb80978 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/main.nf.test @@ -0,0 +1,73 @@ +nextflow_process { + + name "Test Process SAMTOOLS_SORT" + script "../main.nf" + process "SAMTOOLS_SORT" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/sort" + + test("test_samtools_sort") { + + config "./nextflow.config" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], + [ + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("test_samtools_sort_stub") { + + config "./nextflow.config" + options "-stub-run" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], + [ + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test.snap b/modules/nf-core/samtools/sort/tests/main.nf.test.snap new file mode 100644 index 00000000..ff722259 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/main.nf.test.snap @@ -0,0 +1,48 @@ +{ + "test_samtools_sort": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,ea6a0fef94eb534e901f107a05a33a06" + ] + ], + "1": [ + + ], + "2": [ + "versions.yml:md5,33b6a403dc19a0d28e4219ccab0a1d80" + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,ea6a0fef94eb534e901f107a05a33a06" + ] + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,33b6a403dc19a0d28e4219ccab0a1d80" + ] + } + ], + "timestamp": "2023-12-04T11:11:22.005628301" + }, + "test_samtools_sort_stub": { + "content": [ + "test.sorted.bam", + [ + "versions.yml:md5,33b6a403dc19a0d28e4219ccab0a1d80" + ] + ], + "timestamp": "2023-12-04T17:47:22.314445935" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/sort/tests/nextflow.config b/modules/nf-core/samtools/sort/tests/nextflow.config new file mode 100644 index 00000000..d0f35086 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/nextflow.config @@ -0,0 +1,7 @@ +process { + + withName: SAMTOOLS_SORT { + ext.prefix = { "${meta.id}.sorted" } + } + +} diff --git a/modules/nf-core/samtools/sort/tests/tags.yml b/modules/nf-core/samtools/sort/tests/tags.yml new file mode 100644 index 00000000..cd63ea20 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/tags.yml @@ -0,0 +1,3 @@ +samtools/sort: + - modules/nf-core/samtools/sort/** + - tests/modules/nf-core/samtools/sort/** diff --git a/modules/nf-core/samtools/stats/environment.yml b/modules/nf-core/samtools/stats/environment.yml new file mode 100644 index 00000000..b89ce647 --- /dev/null +++ b/modules/nf-core/samtools/stats/environment.yml @@ -0,0 +1,7 @@ +name: samtools_stats +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/stats/main.nf b/modules/nf-core/samtools/stats/main.nf index 0a2a3640..7539140a 100644 --- a/modules/nf-core/samtools/stats/main.nf +++ b/modules/nf-core/samtools/stats/main.nf @@ -2,14 +2,14 @@ process SAMTOOLS_STATS { tag "$meta.id" label 'process_single' - conda "bioconda::samtools=1.16.1" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' : - 'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : + 'biocontainers/samtools:1.18--h50ea8bc_1' }" input: tuple val(meta), path(input), path(input_index) - path fasta + tuple val(meta2), path(fasta) output: tuple val(meta), path("*.stats"), emit: stats diff --git a/modules/nf-core/samtools/stats/meta.yml b/modules/nf-core/samtools/stats/meta.yml index 1d68a5d8..735ff812 100644 --- a/modules/nf-core/samtools/stats/meta.yml +++ b/modules/nf-core/samtools/stats/meta.yml @@ -30,9 +30,14 @@ input: type: file description: BAI/CRAI file from alignment pattern: "*.{bai,crai}" + - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] - fasta: - type: optional file - description: Reference file the CRAM was created with + type: file + description: Reference file the CRAM was created with (optional) pattern: "*.{fasta,fa}" output: - meta: @@ -51,3 +56,8 @@ output: authors: - "@drpatelh" - "@FriederikeHanssen" + - "@ramprasadn" +maintainers: + - "@drpatelh" + - "@FriederikeHanssen" + - "@ramprasadn" diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test b/modules/nf-core/samtools/stats/tests/main.nf.test new file mode 100644 index 00000000..20c3efe1 --- /dev/null +++ b/modules/nf-core/samtools/stats/tests/main.nf.test @@ -0,0 +1,78 @@ +nextflow_process { + + name "Test Process SAMTOOLS_STATS" + script "../main.nf" + process "SAMTOOLS_STATS" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/stats" + + test("SAMTOOLS STATS Should run without failures") { + + when { + params { + + outdir = "$outputDir" + } + process { + """ + // define inputs of the process here. + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) + + ] + input[1] = [[],[]] + """ + + } + } + + then { + assertAll( + {assert process.success}, + {assert snapshot(process.out).match()} + ) + } + + } + + test("SAMTOOLS CRAM Should run without failures") { + + when { + params { + + outdir = "$outputDir" + } + process { + """ + // define inputs of the process here + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram_crai'], checkIfExists: true) + + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + + + } + + then { + assertAll( + {assert process.success}, + {assert snapshot(process.out).match()} + ) + } + + } + + +} diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test.snap b/modules/nf-core/samtools/stats/tests/main.nf.test.snap new file mode 100644 index 00000000..025c83a5 --- /dev/null +++ b/modules/nf-core/samtools/stats/tests/main.nf.test.snap @@ -0,0 +1,64 @@ +{ + "SAMTOOLS STATS Should run without failures": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,045a48208b1c6f5b8af4347fe31f4def" + ] + ], + "1": [ + "versions.yml:md5,650a365c6635001436008350ae83337c" + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,045a48208b1c6f5b8af4347fe31f4def" + ] + ], + "versions": [ + "versions.yml:md5,650a365c6635001436008350ae83337c" + ] + } + ], + "timestamp": "2023-12-04T11:07:28.26821485" + }, + "SAMTOOLS CRAM Should run without failures": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,dfbfa130d4a6925ddd1931dcd8354a43" + ] + ], + "1": [ + "versions.yml:md5,650a365c6635001436008350ae83337c" + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,dfbfa130d4a6925ddd1931dcd8354a43" + ] + ], + "versions": [ + "versions.yml:md5,650a365c6635001436008350ae83337c" + ] + } + ], + "timestamp": "2023-12-04T11:07:50.356233402" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/stats/tests/tags.yml b/modules/nf-core/samtools/stats/tests/tags.yml new file mode 100644 index 00000000..7c28e30f --- /dev/null +++ b/modules/nf-core/samtools/stats/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/stats: + - modules/nf-core/samtools/stats/** diff --git a/modules/nf-core/samtools/view/environment.yml b/modules/nf-core/samtools/view/environment.yml new file mode 100644 index 00000000..99aa69d0 --- /dev/null +++ b/modules/nf-core/samtools/view/environment.yml @@ -0,0 +1,7 @@ +name: samtools_view +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/view/main.nf b/modules/nf-core/samtools/view/main.nf index 729c85e5..0b5a2912 100644 --- a/modules/nf-core/samtools/view/main.nf +++ b/modules/nf-core/samtools/view/main.nf @@ -2,14 +2,14 @@ process SAMTOOLS_VIEW { tag "$meta.id" label 'process_low' - conda "bioconda::samtools=1.16.1" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' : - 'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : + 'biocontainers/samtools:1.18--h50ea8bc_1' }" input: tuple val(meta), path(input), path(index) - path fasta + tuple val(meta2), path(fasta) path qname output: @@ -53,10 +53,19 @@ process SAMTOOLS_VIEW { """ stub: + def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" + def file_type = args.contains("--output-fmt sam") ? "sam" : + args.contains("--output-fmt bam") ? "bam" : + args.contains("--output-fmt cram") ? "cram" : + input.getExtension() + if ("$input" == "${prefix}.${file_type}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + + def index = args.contains("--write-index") ? "touch ${prefix}.csi" : "" + """ - touch ${prefix}.bam - touch ${prefix}.cram + touch ${prefix}.${file_type} + ${index} cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/samtools/view/meta.yml b/modules/nf-core/samtools/view/meta.yml index 2e597d34..3dadafae 100644 --- a/modules/nf-core/samtools/view/meta.yml +++ b/modules/nf-core/samtools/view/meta.yml @@ -26,12 +26,17 @@ input: description: BAM/CRAM/SAM file pattern: "*.{bam,cram,sam}" - index: - type: optional file - description: BAM.BAI/CRAM.CRAI file - pattern: "*.{.bai,.crai}" + type: file + description: BAM.BAI/BAM.CSI/CRAM.CRAI file (optional) + pattern: "*.{.bai,.csi,.crai}" + - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] - fasta: - type: optional file - description: Reference file the CRAM was created with + type: file + description: Reference file the CRAM was created with (optional) pattern: "*.{fasta,fa}" - qname: type: file @@ -77,3 +82,8 @@ authors: - "@joseespinosa" - "@FriederikeHanssen" - "@priyanka-surana" +maintainers: + - "@drpatelh" + - "@joseespinosa" + - "@FriederikeHanssen" + - "@priyanka-surana" diff --git a/modules/nf-core/samtools/view/tests/bam.config b/modules/nf-core/samtools/view/tests/bam.config new file mode 100644 index 00000000..c10d1081 --- /dev/null +++ b/modules/nf-core/samtools/view/tests/bam.config @@ -0,0 +1,3 @@ +process { + ext.args = "--output-fmt bam" +} \ No newline at end of file diff --git a/modules/nf-core/samtools/view/tests/bam_index.config b/modules/nf-core/samtools/view/tests/bam_index.config new file mode 100644 index 00000000..771ae033 --- /dev/null +++ b/modules/nf-core/samtools/view/tests/bam_index.config @@ -0,0 +1,3 @@ +process { + ext.args = "--output-fmt bam --write-index" +} \ No newline at end of file diff --git a/modules/nf-core/samtools/view/tests/main.nf.test b/modules/nf-core/samtools/view/tests/main.nf.test new file mode 100644 index 00000000..89ed3555 --- /dev/null +++ b/modules/nf-core/samtools/view/tests/main.nf.test @@ -0,0 +1,231 @@ +nextflow_process { + + name "Test Process SAMTOOLS_VIEW" + script "../main.nf" + process "SAMTOOLS_VIEW" + + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/view" + + test("sarscov2 - [bam, []], [], []") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true), + [] + ] + input[1] = [[],[]] + input[2] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.cram, + process.out.sam, + process.out.bai, + process.out.crai, + process.out.csi, + process.out.versions + ).match() } + ) + } + + } + + test("homo_sapiens - [cram, crai], fasta, []") { + + when { + process { + """ + input[0] = [ + [ id: 'test' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true) + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.cram[0][1]).name, + process.out.bam, + process.out.sam, + process.out.bai, + process.out.crai, + process.out.csi, + process.out.versions + ).match() } + ) + } + + } + + test("homo_sapiens - [cram, []], fasta, [] - bam output") { + + config "./bam.config" + + when { + process { + """ + input[0] = [ + [ id: 'test' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + [] + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.cram, + process.out.sam, + process.out.bai, + process.out.crai, + process.out.csi, + process.out.versions + ).match() } + ) + } + + } + + test("homo_sapiens - [cram, []], fasta, [] - bam & index output") { + + config "./bam_index.config" + + when { + process { + """ + input[0] = [ + [ id: 'test' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + [] + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.cram, + process.out.sam, + file(process.out.csi[0][1]).name, + process.out.crai, + process.out.bai, + process.out.versions + ).match() } + ) + } + + } + + test("homo_sapiens - [cram, []], fasta, qname - bam & index output") { + + config "./bam_index.config" + + when { + process { + """ + input[0] = [ + [ id: 'test' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + [] + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = Channel.of("testN:2817", "testN:2814").collectFile(name: "readnames.list", newLine: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.cram, + process.out.sam, + file(process.out.csi[0][1]).name, + process.out.crai, + process.out.bai, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [bam, []], [], [] - stub") { + + options "-stub" + config "./bam_index.config" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true), + [] + ] + input[1] = [[],[]] + input[2] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.cram, + process.out.sam, + file(process.out.csi[0][1]).name, + process.out.crai, + process.out.bai, + process.out.versions + ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/samtools/view/tests/main.nf.test.snap b/modules/nf-core/samtools/view/tests/main.nf.test.snap new file mode 100644 index 00000000..83427491 --- /dev/null +++ b/modules/nf-core/samtools/view/tests/main.nf.test.snap @@ -0,0 +1,140 @@ +{ + "homo_sapiens - [cram, []], fasta, [] - bam output": { + "content": [ + "test.bam", + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b" + ] + ], + "timestamp": "2023-12-04T17:41:17.563069206" + }, + "sarscov2 - [bam, []], [], []": { + "content": [ + "test.bam", + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b" + ] + ], + "timestamp": "2023-12-04T17:41:03.206994564" + }, + "homo_sapiens - [cram, []], fasta, qname - bam & index output": { + "content": [ + "test.bam", + [ + + ], + [ + + ], + "test.bam.csi", + [ + + ], + [ + + ], + [ + "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b" + ] + ], + "timestamp": "2023-12-04T17:44:39.165289759" + }, + "homo_sapiens - [cram, []], fasta, [] - bam & index output": { + "content": [ + "test.bam", + [ + + ], + [ + + ], + "test.bam.csi", + [ + + ], + [ + + ], + [ + "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b" + ] + ], + "timestamp": "2023-12-04T17:44:32.25731224" + }, + "sarscov2 - [bam, []], [], [] - stub": { + "content": [ + "test.bam", + [ + + ], + [ + + ], + "test.csi", + [ + + ], + [ + + ], + [ + "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b" + ] + ], + "timestamp": "2023-12-04T17:44:45.81037195" + }, + "homo_sapiens - [cram, crai], fasta, []": { + "content": [ + "test.cram", + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b" + ] + ], + "timestamp": "2023-12-04T17:41:10.730011823" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/view/tests/tags.yml b/modules/nf-core/samtools/view/tests/tags.yml new file mode 100644 index 00000000..4fdf1dd1 --- /dev/null +++ b/modules/nf-core/samtools/view/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/view: + - "modules/nf-core/samtools/view/**" diff --git a/modules/nf-core/spades/environment.yml b/modules/nf-core/spades/environment.yml new file mode 100644 index 00000000..12315814 --- /dev/null +++ b/modules/nf-core/spades/environment.yml @@ -0,0 +1,7 @@ +name: spades +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::spades=3.15.5 diff --git a/modules/nf-core/spades/main.nf b/modules/nf-core/spades/main.nf index 2c58069c..010525e9 100644 --- a/modules/nf-core/spades/main.nf +++ b/modules/nf-core/spades/main.nf @@ -2,10 +2,10 @@ process SPADES { tag "$meta.id" label 'process_high' - conda "bioconda::spades=3.15.5" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/spades:3.15.5--h95f258a_1' : - 'quay.io/biocontainers/spades:3.15.5--h95f258a_1' }" + 'biocontainers/spades:3.15.5--h95f258a_1' }" input: tuple val(meta), path(illumina), path(pacbio), path(nanopore) diff --git a/modules/nf-core/spades/meta.yml b/modules/nf-core/spades/meta.yml index 701de1a7..99c482cd 100644 --- a/modules/nf-core/spades/meta.yml +++ b/modules/nf-core/spades/meta.yml @@ -84,8 +84,11 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@JoseEspinosa" - "@drpatelh" - "@d4straub" +maintainers: + - "@JoseEspinosa" + - "@drpatelh" + - "@d4straub" diff --git a/modules/nf-core/tabix/bgzip/environment.yml b/modules/nf-core/tabix/bgzip/environment.yml new file mode 100644 index 00000000..4fe40c56 --- /dev/null +++ b/modules/nf-core/tabix/bgzip/environment.yml @@ -0,0 +1,7 @@ +name: tabix_bgzip +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::tabix=1.11 diff --git a/modules/nf-core/tabix/bgzip/main.nf b/modules/nf-core/tabix/bgzip/main.nf index 6dd4e202..7772e9ad 100644 --- a/modules/nf-core/tabix/bgzip/main.nf +++ b/modules/nf-core/tabix/bgzip/main.nf @@ -2,10 +2,10 @@ process TABIX_BGZIP { tag "$meta.id" label 'process_single' - conda "bioconda::tabix=1.11" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/tabix:1.11--hdfd78af_0' : - 'quay.io/biocontainers/tabix:1.11--hdfd78af_0' }" + 'biocontainers/tabix:1.11--hdfd78af_0' }" input: tuple val(meta), path(input) diff --git a/modules/nf-core/tabix/bgzip/meta.yml b/modules/nf-core/tabix/bgzip/meta.yml index c3ea2107..621d49ea 100644 --- a/modules/nf-core/tabix/bgzip/meta.yml +++ b/modules/nf-core/tabix/bgzip/meta.yml @@ -45,3 +45,8 @@ authors: - "@drpatelh" - "@maxulysse" - "@nvnieuwk" +maintainers: + - "@joseespinosa" + - "@drpatelh" + - "@maxulysse" + - "@nvnieuwk" diff --git a/modules/nf-core/tabix/tabix/environment.yml b/modules/nf-core/tabix/tabix/environment.yml new file mode 100644 index 00000000..7167fb87 --- /dev/null +++ b/modules/nf-core/tabix/tabix/environment.yml @@ -0,0 +1,7 @@ +name: tabix_tabix +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::tabix=1.11 diff --git a/modules/nf-core/tabix/tabix/main.nf b/modules/nf-core/tabix/tabix/main.nf index 9a404db9..c304a8a3 100644 --- a/modules/nf-core/tabix/tabix/main.nf +++ b/modules/nf-core/tabix/tabix/main.nf @@ -2,10 +2,10 @@ process TABIX_TABIX { tag "$meta.id" label 'process_single' - conda "bioconda::tabix=1.11" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/tabix:1.11--hdfd78af_0' : - 'quay.io/biocontainers/tabix:1.11--hdfd78af_0' }" + 'biocontainers/tabix:1.11--hdfd78af_0' }" input: tuple val(meta), path(tab) diff --git a/modules/nf-core/tabix/tabix/meta.yml b/modules/nf-core/tabix/tabix/meta.yml index fcc6e524..ae5b4f43 100644 --- a/modules/nf-core/tabix/tabix/meta.yml +++ b/modules/nf-core/tabix/tabix/meta.yml @@ -43,3 +43,7 @@ authors: - "@joseespinosa" - "@drpatelh" - "@maxulysse" +maintainers: + - "@joseespinosa" + - "@drpatelh" + - "@maxulysse" diff --git a/modules/nf-core/unicycler/environment.yml b/modules/nf-core/unicycler/environment.yml new file mode 100644 index 00000000..bf5c977b --- /dev/null +++ b/modules/nf-core/unicycler/environment.yml @@ -0,0 +1,7 @@ +name: unicycler +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::unicycler=0.4.8 diff --git a/modules/nf-core/unicycler/main.nf b/modules/nf-core/unicycler/main.nf index 8981c433..58d60cbe 100644 --- a/modules/nf-core/unicycler/main.nf +++ b/modules/nf-core/unicycler/main.nf @@ -2,10 +2,10 @@ process UNICYCLER { tag "$meta.id" label 'process_high' - conda "bioconda::unicycler=0.4.8" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/unicycler:0.4.8--py38h8162308_3' : - 'quay.io/biocontainers/unicycler:0.4.8--py38h8162308_3' }" + 'biocontainers/unicycler:0.4.8--py38h8162308_3' }" input: tuple val(meta), path(shortreads), path(longreads) diff --git a/modules/nf-core/unicycler/meta.yml b/modules/nf-core/unicycler/meta.yml index 918faaf8..406b1470 100644 --- a/modules/nf-core/unicycler/meta.yml +++ b/modules/nf-core/unicycler/meta.yml @@ -58,3 +58,7 @@ authors: - "@JoseEspinosa" - "@drpatelh" - "@d4straub" +maintainers: + - "@JoseEspinosa" + - "@drpatelh" + - "@d4straub" diff --git a/modules/nf-core/untar/environment.yml b/modules/nf-core/untar/environment.yml new file mode 100644 index 00000000..d6917da3 --- /dev/null +++ b/modules/nf-core/untar/environment.yml @@ -0,0 +1,9 @@ +name: untar +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - conda-forge::sed=4.7 + - conda-forge::grep=3.11 + - conda-forge::tar=1.34 diff --git a/modules/nf-core/untar/main.nf b/modules/nf-core/untar/main.nf index 8cd1856c..8a75bb95 100644 --- a/modules/nf-core/untar/main.nf +++ b/modules/nf-core/untar/main.nf @@ -2,7 +2,7 @@ process UNTAR { tag "$archive" label 'process_single' - conda "conda-forge::sed=4.7 bioconda::grep=3.4 conda-forge::tar=1.34" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : 'nf-core/ubuntu:20.04' }" diff --git a/modules/nf-core/untar/meta.yml b/modules/nf-core/untar/meta.yml index ea7a3f38..a9a2110f 100644 --- a/modules/nf-core/untar/meta.yml +++ b/modules/nf-core/untar/meta.yml @@ -3,6 +3,7 @@ description: Extract files. keywords: - untar - uncompress + - extract tools: - untar: description: | @@ -38,3 +39,8 @@ authors: - "@drpatelh" - "@matthdsm" - "@jfy133" +maintainers: + - "@joseespinosa" + - "@drpatelh" + - "@matthdsm" + - "@jfy133" diff --git a/modules/nf-core/untar/tests/main.nf.test b/modules/nf-core/untar/tests/main.nf.test new file mode 100644 index 00000000..d40db13d --- /dev/null +++ b/modules/nf-core/untar/tests/main.nf.test @@ -0,0 +1,77 @@ +nextflow_process { + + name "Test Process UNTAR" + script "../main.nf" + process "UNTAR" + + tag "modules" + tag "modules_nfcore" + tag "untar" + + test("test_untar") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ [], file(params.test_data['sarscov2']['genome']['kraken2_tar_gz'], checkIfExists: true) ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.untar).match("test_untar") }, + ) + } + + } + + test("test_untar_different_output_path") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ [], file(params.test_data['homo_sapiens']['illumina']['test_flowcell'], checkIfExists: true) ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.untar).match("test_untar_different_output_path") }, + ) + } + + } + + test("test_untar_onlyfiles") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ [], file(params.test_data['generic']['tar']['tar_gz'], checkIfExists: true) ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.untar).match("test_untar_onlyfiles") }, + ) + } + + } + +} diff --git a/modules/nf-core/untar/tests/main.nf.test.snap b/modules/nf-core/untar/tests/main.nf.test.snap new file mode 100644 index 00000000..146c8678 --- /dev/null +++ b/modules/nf-core/untar/tests/main.nf.test.snap @@ -0,0 +1,513 @@ +{ + "test_untar_different_output_path": { + "content": [ + [ + [ + [ + + ], + [ + [ + [ + [ + [ + [ + "s_1_1101.bcl:md5,ad01889e2ff43e2f194224e20bdb600c", + "s_1_1101.stats:md5,4bbbf103454b37fbc3138fadf1b4446b" + ], + [ + "s_1_1101.bcl:md5,565384bbe67a694dfd690bae6d1d30c2", + "s_1_1101.stats:md5,55e5abd8f129ff38ef169873547abdb8" + ], + [ + "s_1_1101.bcl:md5,650fa58a630a9148835ba79e323d4237", + "s_1_1101.stats:md5,77403669ca1b05340c390dff64425c1e" + ], + [ + "s_1_1101.bcl:md5,54471c9e97299cd141e202e204637702", + "s_1_1101.stats:md5,67b14c9a89b7f8556674a7524d5cfb2d" + ], + [ + "s_1_1101.bcl:md5,74e4f929fc7476c380fd9d741ddb6700", + "s_1_1101.stats:md5,5730a4c35463eaa12a06b6758710b98c" + ], + [ + "s_1_1101.bcl:md5,c785f472f4350c120c02c888c8189590", + "s_1_1101.stats:md5,fee4ec63895ea81007e06ee6a36ba5e0" + ], + [ + "s_1_1101.bcl:md5,b7ea50bb25f08d43c301741d77050a9b", + "s_1_1101.stats:md5,fa7c68f3122c74d14364e6f7b011af70" + ], + [ + "s_1_1101.bcl:md5,9d5087dc4bcae39d66486363d4f68ecf", + "s_1_1101.stats:md5,23cdceee4d82c4b8e7c60018b9276ace" + ], + [ + "s_1_1101.bcl:md5,581e0c5ee94e8f2de14b2b1d8e777530", + "s_1_1101.stats:md5,9a3536d573c97f66bb56b49463612607" + ], + [ + "s_1_1101.bcl:md5,296fc026bb34c67bbe2b44845fe0d1de", + "s_1_1101.stats:md5,a7f57a7770fb9c5ae2a0fb1ef403ec4f" + ], + [ + "s_1_1101.bcl:md5,2a3ca15531556c36d10d132a9e051de8", + "s_1_1101.stats:md5,2d0bcdb0a1b51d3d79e415db2ab2d3b1" + ], + [ + "s_1_1101.bcl:md5,1150d46a2ccd4ac58aee0585d3e4ffd7", + "s_1_1101.stats:md5,2e97550bd5b5864ffd0565bb7a3f6d40" + ], + [ + "s_1_1101.bcl:md5,0b85c4b3da0de95e7b862d849c5333ae", + "s_1_1101.stats:md5,6eab9746fbeb783b0cd70398f44e0c1a" + ], + [ + "s_1_1101.bcl:md5,e0e9c91f4698804d7a6d1058ef68b34f", + "s_1_1101.stats:md5,790022cdc7878a02b2ebd166e1ddf0a7" + ], + [ + "s_1_1101.bcl:md5,38cd0ad4de359e651c8ac0d5777ea625", + "s_1_1101.stats:md5,a1b1d5ea5371d326abb029774483c5e6" + ], + [ + "s_1_1101.bcl:md5,b0ddc05c4012ccba24e712a1cfec748f", + "s_1_1101.stats:md5,af3d232f839d720f76f40ba06caa2987" + ], + [ + "s_1_1101.bcl:md5,af32fcc5dc3b836cf7a5ba3db85a75dd", + "s_1_1101.stats:md5,f93f2c09bd4e486c74a5f6e2040f7296" + ], + [ + "s_1_1101.bcl:md5,54b7428e037ca87816107647d4a3d9db", + "s_1_1101.stats:md5,e5ac77a72cd7bed5e9bf03cccda0e48c" + ], + [ + "s_1_1101.bcl:md5,fc8b4eacd493bf3d0b20bc23998dc7ff", + "s_1_1101.stats:md5,190315e159e2f4bc4c057ded7470dc52" + ], + [ + "s_1_1101.bcl:md5,9484ecffda489927fce424ac6a44fa9d", + "s_1_1101.stats:md5,0825feeb457ecc9efcf6f8526ba32311" + ], + [ + "s_1_1101.bcl:md5,eec59e21036e31c95ce1e847bfb0a9c4", + "s_1_1101.stats:md5,9acc13f63c98e5a8445e7be70d49222b" + ], + [ + "s_1_1101.bcl:md5,a9fb24476f87cba4fba68e2b3c3f2c07", + "s_1_1101.stats:md5,dc0aa7db9790733291c3e6480ca2a0fc" + ], + [ + "s_1_1101.bcl:md5,ed950b3e82c500927c2e236c9df005c6", + "s_1_1101.stats:md5,dccb71ec47d1f9d33a192da6d5660a45" + ], + [ + "s_1_1101.bcl:md5,b3e992025e995ca56b5ea2820144ef47", + "s_1_1101.stats:md5,a6a829bf2cffb26ac5d9dc3012057699" + ], + [ + "s_1_1101.bcl:md5,89edc726a5a4e0b4ff8ca3899ed0232b", + "s_1_1101.stats:md5,5b9b4fd8110577a59b82d0c419519d29" + ], + [ + "s_1_1101.bcl:md5,4dc696149169f232c451225f563cb5cd", + "s_1_1101.stats:md5,d3514a71ea3adc60e2943c6b8f6e2598" + ], + [ + "s_1_1101.bcl:md5,35b992d0318afb7c825ceaa31b0755e6", + "s_1_1101.stats:md5,2826093acc175c16c3795de7c4ca8f07" + ], + [ + "s_1_1101.bcl:md5,7bc927f56a362e49c00b5d76ee048901", + "s_1_1101.stats:md5,e47d862b795fd6b88a31d7d482ab22f6" + ], + [ + "s_1_1101.bcl:md5,84742233ff2a651626fe9036f27f7cb2", + "s_1_1101.stats:md5,b78fad11d3c50bc76b722cdc03e3028b" + ], + [ + "s_1_1101.bcl:md5,3935341c86263a7938e8c49620ef39f8", + "s_1_1101.stats:md5,cc6585b2daac5354073d150874da9704" + ], + [ + "s_1_1101.bcl:md5,3627f4fd548bf6e64aaf08fba3a342be", + "s_1_1101.stats:md5,120ae4831ae004ff7d16728aef36e82f" + ], + [ + "s_1_1101.bcl:md5,07631014bc35124149fabd80ef19f933", + "s_1_1101.stats:md5,eadd63d91f47cc6db6b6f0a967a23927" + ], + [ + "s_1_1101.bcl:md5,a1149c80415dc2f34d768eeb397c43fb", + "s_1_1101.stats:md5,ca89a9def67611a9151c6ce685b7cce1" + ], + [ + "s_1_1101.bcl:md5,eb5f71d4741d2f40618756bc72eaf8b4", + "s_1_1101.stats:md5,90f48501e735e5915b843478e23d1ae2" + ], + [ + "s_1_1101.bcl:md5,9bf270fe3f6add1a591ebc24fff10078", + "s_1_1101.stats:md5,a4e429671d4098034293c638aa655e16" + ], + [ + "s_1_1101.bcl:md5,219bedcbd24bae54fe4cf05dae05282c", + "s_1_1101.stats:md5,dd97525b65b68207137d51fcf19132c7" + ], + [ + "s_1_1101.bcl:md5,5163bc00a68fd57ae50cae0b76350892", + "s_1_1101.stats:md5,b606a5368eff1f012f3ea5d11ccdf2e0" + ], + [ + "s_1_1101.bcl:md5,fc429195a5af59a59e0cc4c48e6c05ea", + "s_1_1101.stats:md5,d809aa19698053f90d639da4dcad8008" + ], + [ + "s_1_1101.bcl:md5,383340219a1dd77076a092a64a71a7e4", + "s_1_1101.stats:md5,b204a5cf256378679ffc906c15cc1bae" + ], + [ + "s_1_1101.bcl:md5,0c369540d3e24696cf1f9c55bab69315", + "s_1_1101.stats:md5,a2bc69a4031a22ce9621dcc623a0bf4b" + ], + [ + "s_1_1101.bcl:md5,3127abc8016ba8eb954f8f8015dff387", + "s_1_1101.stats:md5,5deafff31150b7bf757f814e49a53bc2" + ], + [ + "s_1_1101.bcl:md5,045f40c82de676bafec3d59f91376a7a", + "s_1_1101.stats:md5,890700edc20687c090ef52248c7884b1" + ], + [ + "s_1_1101.bcl:md5,78af269aa2b39a1d765703f0a4739a86", + "s_1_1101.stats:md5,303cf457aa1543a8208544f694cbc531" + ], + [ + "s_1_1101.bcl:md5,0ab8c781959b783b62888e9274364a46", + "s_1_1101.stats:md5,2605b0e8322f83aa4d0dae5da4ec7a7a" + ], + [ + "s_1_1101.bcl:md5,d0cf823ffe352e8b3f75d589544ab617", + "s_1_1101.stats:md5,efa3c0e01e3db71e12fd961cb2d03739" + ], + [ + "s_1_1101.bcl:md5,db4ca4ab7a01e03c246f9160c3758d82", + "s_1_1101.stats:md5,f61550d9e4a90df6b860e68f41f82f60" + ], + [ + "s_1_1101.bcl:md5,1af39a2c7e5ff20ece91cb8160b51d17", + "s_1_1101.stats:md5,d0e20879afcaf6dfcd88c73f1c5c78cf" + ], + [ + "s_1_1101.bcl:md5,4cf7123bb0fffcd79266df03aef01665", + "s_1_1101.stats:md5,29bff4075109a121b087116b58d7e927" + ], + [ + "s_1_1101.bcl:md5,aa9980428cb60cd6320f4b48f4dd0d74", + "s_1_1101.stats:md5,6b0e20bde93133117a8d1a6df3d6f37b" + ], + [ + "s_1_1101.bcl:md5,0f6e440374e15b9b491d52fb83a8adfe", + "s_1_1101.stats:md5,55cb5eb0ecdabd23dca39ab8c4607598" + ], + [ + "s_1_1101.bcl:md5,2c645d7bdaddaa403f6e304d36df9e4b", + "s_1_1101.stats:md5,53acf33d21f832779b400c2447386ce4" + ], + [ + "s_1_1101.bcl:md5,3bbf0863b423b770c879203644420206", + "s_1_1101.stats:md5,579bdc7293cac8c3d7407249cacf4c25" + ], + [ + "s_1_1101.bcl:md5,6658a08409e81d29cfeb2d096b491985", + "s_1_1101.stats:md5,bb559ffbea46d612f9933cefa84c4c03" + ], + [ + "s_1_1101.bcl:md5,1700d9a13d3d4f7643af2943ef838acb", + "s_1_1101.stats:md5,f01cb6050ebfb15da1e0399ebd791eb4" + ], + [ + "s_1_1101.bcl:md5,1ac7aa9ffae25eb103f755f33e4a39c6", + "s_1_1101.stats:md5,0b9d45d7929ccf336d5e5b95373ed3c2" + ], + [ + "s_1_1101.bcl:md5,812a97af2e983a53226e18c75190b06c", + "s_1_1101.stats:md5,d2410c7b0e506dab2972e77e2398de1e" + ], + [ + "s_1_1101.bcl:md5,c981e8e4dcc434956c2b86159da268bc", + "s_1_1101.stats:md5,e9c826e85361ce673f1f248786c9a611" + ], + [ + "s_1_1101.bcl:md5,88e09e99a0a4ef3357b203a41b22f77c", + "s_1_1101.stats:md5,ef06f2e5ad667bbd383f9ed6a05b7b42" + ], + [ + "s_1_1101.bcl:md5,461c8b146fc8a7938be38689978ecd09", + "s_1_1101.stats:md5,65115693935da66f9791b27136e22fb0" + ], + [ + "s_1_1101.bcl:md5,c7b827df5ce20e0f21916fe60860ca3f", + "s_1_1101.stats:md5,87be73613aeb507847f94d3cac5bb30a" + ], + [ + "s_1_1101.bcl:md5,7c4cc3dc9c8a1b0f15917b282dfb40ce", + "s_1_1101.stats:md5,bdd9181fa89debbfafe7b6ea3e064065" + ], + [ + "s_1_1101.bcl:md5,19f4debaf91e118aca8934517179ac33", + "s_1_1101.stats:md5,1143082719e136241d21b14a6b19b8a2" + ], + [ + "s_1_1101.bcl:md5,38aa256ad2d697d84b0b2c0e876a3eba", + "s_1_1101.stats:md5,64dd82f03df23f7f437eede2671ed4fe" + ], + [ + "s_1_1101.bcl:md5,b7929970378949571fed922c1b8cab32", + "s_1_1101.stats:md5,3d6d7985a41629fe196e4342d7fe36aa" + ], + [ + "s_1_1101.bcl:md5,fb2ed0bf6e89d79624ee78754e773491", + "s_1_1101.stats:md5,f34940810ff255aee79953496a12716d" + ], + [ + "s_1_1101.bcl:md5,4f8a8311f5f9c3a7629c1a973a7b280e", + "s_1_1101.stats:md5,4fd7cd28c09f4e152e7c2ad1ab541cd2" + ], + [ + "s_1_1101.bcl:md5,9eb46c903d0344e25af51f88cc311d60", + "s_1_1101.stats:md5,df3abd5f620d9e7f99496098d9fd3f7f" + ], + [ + "s_1_1101.bcl:md5,3ecbc17f3660e2014b58d7fe70ae62d5", + "s_1_1101.stats:md5,8e89a13c85a6d6ab3ccd251b66d1f165" + ], + [ + "s_1_1101.bcl:md5,5d59cc2499a77791233a64f73fe82894", + "s_1_1101.stats:md5,32ec99cd400f4b80cb26e2fa8e07ece0" + ], + [ + "s_1_1101.bcl:md5,1c052da47b9ae8554388f0fa3aade482", + "s_1_1101.stats:md5,d23f438772673688aa7bc92421dc6dce" + ], + [ + "s_1_1101.bcl:md5,1a52bd4f23130c0c96bc967ccd448a2b", + "s_1_1101.stats:md5,9b597e3388d59ef1f61aba30ac90ea79" + ], + [ + "s_1_1101.bcl:md5,8a1e84b79cf3f80794c20e3a0cc84688", + "s_1_1101.stats:md5,9561f7b6ef4b1849afc72b2bb49792bd" + ], + [ + "s_1_1101.bcl:md5,75c00111051f3fa95d04286823cb9109", + "s_1_1101.stats:md5,1fe786cdf8181767deafbd60b3c76610" + ], + [ + "s_1_1101.bcl:md5,529255d8deee0873ed5565e6d1a2ebda", + "s_1_1101.stats:md5,3fa7f467e97a75880f32d17b7429d316" + ], + [ + "s_1_1101.bcl:md5,ea4d960e3d9355d2149da71b88a21df4", + "s_1_1101.stats:md5,2540fe65586e8e800c1ddd8cddd1e8cd" + ], + [ + "s_1_1101.bcl:md5,0dfe1fd92a2dce2f23119aa483429744", + "s_1_1101.stats:md5,78257b2169fb9f0cf40966e06e847e86" + ], + [ + "s_1_1101.bcl:md5,f692ddc9aa3ab849271d07c666d0b3b9", + "s_1_1101.stats:md5,aa2ec6a3e3a9c116e34fe74a21e6459e" + ], + [ + "s_1_1101.bcl:md5,29cc4c239eae7c871c9a1adf92ebdb98", + "s_1_1101.stats:md5,263184813090acd740a5bf25304aed3a" + ], + [ + "s_1_1101.bcl:md5,e005af6a84925e326afbfe264241f047", + "s_1_1101.stats:md5,b6fb20868eebaffcc19daa694a449795" + ], + [ + "s_1_1101.bcl:md5,02f1a699b1ba9967accccf99a7af3d24", + "s_1_1101.stats:md5,4f007efacecaf26dc0e0231aede28754" + ], + [ + "s_1_1101.bcl:md5,df308c72a2dcc655cd95e98f5457187a", + "s_1_1101.stats:md5,130c4b07f4c14030bab012824cbe34da" + ], + [ + "s_1_1101.bcl:md5,f3ce10d8d2406b72355023bfa8c96822", + "s_1_1101.stats:md5,2638f4db393ed5b699ec2ce59ff0ec19" + ], + [ + "s_1_1101.bcl:md5,cc2f6d675ad1593ff96f734b172d249e", + "s_1_1101.stats:md5,f5b13f1e1ababc9e1a7a73b0b993cbf1" + ], + [ + "s_1_1101.bcl:md5,7938a0b21448305a951b023b1845b3a7", + "s_1_1101.stats:md5,fcd57511adabfc3ba1ac045165330006" + ], + [ + "s_1_1101.bcl:md5,44879bc6a38df1fee8def61868115041", + "s_1_1101.stats:md5,517e20e4b58a8023a37f9af62e0e2036" + ], + [ + "s_1_1101.bcl:md5,8749611e62406a7d2f34c610a55e56af", + "s_1_1101.stats:md5,8ccf24b3676ef84f2e513be8f2a9f3d1" + ], + [ + "s_1_1101.bcl:md5,a9846a037611cda3721958088f714c0e", + "s_1_1101.stats:md5,6438fa5a1892f328cab1605a95d80a3b" + ], + [ + "s_1_1101.bcl:md5,d6c4a2a726496476eb826532f974ed5f", + "s_1_1101.stats:md5,8c2c65b5e8b00dbf61ada65252aeb266" + ], + [ + "s_1_1101.bcl:md5,be3dde6cae7dd85855a6bf295ebfacfe", + "s_1_1101.stats:md5,93bc13f3b0749b2b8d8bcb0b1199f4f0" + ], + [ + "s_1_1101.bcl:md5,7c64514735a6cf1565b60647edd17d20", + "s_1_1101.stats:md5,4a0aa6c49b24f876415e5878cef7f805" + ], + [ + "s_1_1101.bcl:md5,3983b4043bc9df4b505202a5134ccf03", + "s_1_1101.stats:md5,1c9d9a8558adc1279ca27c96bc1b9758" + ], + [ + "s_1_1101.bcl:md5,a0b8d77f116ec95975f9253dcb768136", + "s_1_1101.stats:md5,c3992b786756e7ec42f65ef4b13b50d4" + ], + [ + "s_1_1101.bcl:md5,43c95ba35d06bb7c57fbd16f3d1cfd6c", + "s_1_1101.stats:md5,3cb69d04698c39f97f962e5bf1eea7f0" + ], + [ + "s_1_1101.bcl:md5,3dbeea0cad7052f19f53ff6f19dd4d90", + "s_1_1101.stats:md5,58bbc8254f0f5f4a244531e8e9c12a04" + ], + [ + "s_1_1101.bcl:md5,da56d088996376c898d855b6cd0a7dfc", + "s_1_1101.stats:md5,9f2d78af6908ce1576b89cdc059844ff" + ], + [ + "s_1_1101.bcl:md5,7b641a5565f095e9a6ffcad9e4305033", + "s_1_1101.stats:md5,3ada06c59b4fb41b83ab6abd0979e9fc" + ], + [ + "s_1_1101.bcl:md5,a3843d397a01d51657825bb652c191e5", + "s_1_1101.stats:md5,19341e52a4bfc7d9d48e9d2acc68c519" + ], + [ + "s_1_1101.bcl:md5,048e3ebfc8efeb8012def6b741c9060d", + "s_1_1101.stats:md5,88bd38deca1e87d700effab1fd099565" + ], + [ + "s_1_1101.bcl:md5,b340db0e07e829dd5da22371916a1a9e", + "s_1_1101.stats:md5,e44cfaddcc4ffb968e5b1a2f41ac48a5" + ], + [ + "s_1_1101.bcl:md5,e6011ec6eabbc2b8792deb283c621ce0", + "s_1_1101.stats:md5,090875dcd1a431af24bc631333f089c4" + ], + [ + "s_1_1101.bcl:md5,a08f216e3352345031ed100ec4245082", + "s_1_1101.stats:md5,97b949ef4b96219e1369f673cf5f8a6c" + ], + [ + "s_1_1101.bcl:md5,b43337c76fb037dfcf5f8f7bcb3618e5", + "s_1_1101.stats:md5,ddef585805e79951f69d23ab7354f69b" + ], + [ + "s_1_1101.bcl:md5,8c61fd004104397b360855e058bbf1bf", + "s_1_1101.stats:md5,0f8d253816d594dcfea3ccf48c826401" + ], + [ + "s_1_1101.bcl:md5,594d06310d328b188aa0b3edfff22cb2", + "s_1_1101.stats:md5,3160bf271b39aeb7590e4fd2984710ba" + ], + [ + "s_1_1101.bcl:md5,4c9eada67c9d55437211d83e111961d5", + "s_1_1101.stats:md5,2901b46ab16ec4863d30e4c84ec29c97" + ], + [ + "s_1_1101.bcl:md5,e03971ae5282f0accc0c1b7374d9ef1b", + "s_1_1101.stats:md5,60d2a19ce59bf70a21a28555484cead8" + ], + [ + "s_1_1101.bcl:md5,e1c6f7a06e63d149895d3e48e63df155", + "s_1_1101.stats:md5,44beb10af847ea3dddaf06dda7031126" + ], + [ + "s_1_1101.bcl:md5,960a99bf29a8f9d936e9b8582d46c9c6", + "s_1_1101.stats:md5,544cd1a7aaaa841914b40ece43399334" + ], + [ + "s_1_1101.bcl:md5,5706679f349fd4a6b6313bc2c41c7a42", + "s_1_1101.stats:md5,627eea844b26dae033848c2f9f69177b" + ], + [ + "s_1_1101.bcl:md5,21da5abc4b0402bbac14b5ab998b0b4f", + "s_1_1101.stats:md5,515bd140b095ad90473ca7a9a69877ab" + ], + "s_1_1101.control:md5,08a72e2198ae95150718e8adf011d105", + "s_1_1101.filter:md5,3a72bc73b323c8cb0ac5bfeb62d98989" + ] + ], + [ + "s_1_1101.locs:md5,0827ea802e5257cc5b20e757a33d4c98" + ], + "RTAConfiguration.xml:md5,c7d6e257bc374f142dc64b9d2281d4c9", + "config.xml:md5,9a4cc7ec01fefa2f1ce9bcb45bbad6e9" + ] + ], + [ + "ControlMetricsOut.bin:md5,6d77b38d0793a6e1ce1e85706e488953", + "CorrectedIntMetricsOut.bin:md5,2bbf84d3be72734addaa2fe794711434", + "ErrorMetricsOut.bin:md5,38c88def138e9bb832539911affdb286", + "ExtractionMetricsOut.bin:md5,7497c3178837eea8f09350b5cd252e99", + "IndexMetricsOut.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "QMetricsOut.bin:md5,7e9f198d53ebdfbb699a5f94cf1ed51c", + "TileMetricsOut.bin:md5,83891751ec1c91a425a524b476b6ca3c" + ], + "RunInfo.xml:md5,03038959f4dd181c86bc97ae71fe270a" + ] + ] + ] + ], + "timestamp": "2023-10-18T11:56:39.562418" + }, + "test_untar_onlyfiles": { + "content": [ + [ + [ + [ + + ], + [ + "hello.txt:md5,e59ff97941044f85df5297e1c302d260" + ] + ] + ] + ], + "timestamp": "2023-10-18T11:56:46.878844" + }, + "test_untar": { + "content": [ + [ + [ + [ + + ], + [ + "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9", + "opts.k2d:md5,a033d00cf6759407010b21700938f543", + "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c" + ] + ] + ] + ], + "timestamp": "2023-10-18T11:56:08.16574" + } +} \ No newline at end of file diff --git a/modules/nf-core/untar/tests/tags.yml b/modules/nf-core/untar/tests/tags.yml new file mode 100644 index 00000000..feb6f15c --- /dev/null +++ b/modules/nf-core/untar/tests/tags.yml @@ -0,0 +1,2 @@ +untar: + - modules/nf-core/untar/** diff --git a/modules/nf-core/vcflib/vcfuniq/environment.yml b/modules/nf-core/vcflib/vcfuniq/environment.yml new file mode 100644 index 00000000..dff6ed89 --- /dev/null +++ b/modules/nf-core/vcflib/vcfuniq/environment.yml @@ -0,0 +1,7 @@ +name: vcflib_vcfuniq +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::vcflib=1.0.3 diff --git a/modules/nf-core/vcflib/vcfuniq/main.nf b/modules/nf-core/vcflib/vcfuniq/main.nf index 6b09dc4d..15899b0a 100644 --- a/modules/nf-core/vcflib/vcfuniq/main.nf +++ b/modules/nf-core/vcflib/vcfuniq/main.nf @@ -3,10 +3,10 @@ process VCFLIB_VCFUNIQ { label 'process_low' // WARN: Version information not provided by tool on CLI. Please update version string below when bumping container versions. - conda "bioconda::vcflib=1.0.3" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/vcflib:1.0.3--hecb563c_1': - 'quay.io/biocontainers/vcflib:1.0.3--hecb563c_1' }" + 'biocontainers/vcflib:1.0.3--hecb563c_1' }" input: tuple val(meta), path(vcf), path(tbi) diff --git a/modules/nf-core/vcflib/vcfuniq/meta.yml b/modules/nf-core/vcflib/vcfuniq/meta.yml index 8b5e9e89..8adf6b62 100644 --- a/modules/nf-core/vcflib/vcfuniq/meta.yml +++ b/modules/nf-core/vcflib/vcfuniq/meta.yml @@ -11,7 +11,6 @@ tools: documentation: https://github.com/vcflib/vcflib#USAGE doi: "10.1101/2021.05.21.445151" licence: ["MIT"] - input: - meta: type: map @@ -26,7 +25,6 @@ input: type: file description: Index of VCF file pattern: "*.vcf.gz.tbi" - output: - meta: type: map @@ -41,6 +39,7 @@ output: type: file description: Compressed VCF file pattern: "*.vcf.gz" - authors: - "@drpatelh" +maintainers: + - "@drpatelh" diff --git a/subworkflows/nf-core/bam_markduplicates_picard/meta.yml b/subworkflows/nf-core/bam_markduplicates_picard/meta.yml index 822c6132..fe63068e 100644 --- a/subworkflows/nf-core/bam_markduplicates_picard/meta.yml +++ b/subworkflows/nf-core/bam_markduplicates_picard/meta.yml @@ -1,3 +1,4 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json name: "bam_markduplicates_picard" description: Picard MarkDuplicates, index BAM file and run samtools stats, flagstat and idxstats keywords: @@ -5,14 +6,13 @@ keywords: - bam - sam - cram - -modules: +components: - picard/markduplicates - samtools/index - samtools/stats - samtools/idxstats - samtools/flagstat - + - bam_stats_samtools input: - ch_bam: description: | @@ -58,3 +58,6 @@ output: authors: - "@dmarron" - "@drpatelh" +maintainers: + - "@dmarron" + - "@drpatelh" diff --git a/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test new file mode 100644 index 00000000..e721f30c --- /dev/null +++ b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test @@ -0,0 +1,92 @@ +nextflow_workflow { + + name "Test Workflow BAM_MARKDUPLICATES_PICARD" + script "../main.nf" + workflow "BAM_MARKDUPLICATES_PICARD" + + tag "picard" + tag "picard/markduplicates" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "bam_markduplicates_picard" + tag "subworkflows/bam_markduplicates_picard" + tag "subworkflows/bam_stats_samtools" + tag "bam_stats_samtools" + tag "samtools" + tag "samtools/flagstat" + tag "samtools/idxstats" + tag "samtools/index" + tag "samtools/stats" + + test("homo_sapiens - bam") { + + when { + workflow { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [ + [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + path(workflow.out.bam[0][1]), + path(workflow.out.bai[0][1]), + path(workflow.out.flagstat[0][1]), + path(workflow.out.idxstats[0][1]), + path(workflow.out.stats[0][1]), + ).match("homo_sapiens - bam") }, + { assert path(workflow.out.metrics.get(0).get(1)).getText().contains("97") } + ) + } + } + + test("homo_sapiens - cram") { + + when { + workflow { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true) + ] + input[1] = [ [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + path(workflow.out.bam[0][1]), + path(workflow.out.bai[0][1]), + path(workflow.out.flagstat[0][1]), + path(workflow.out.idxstats[0][1]), + path(workflow.out.stats[0][1]), + ).match("homo_sapiens - cram") }, + { assert path(workflow.out.metrics.get(0).get(1)).getText().contains("0.999986") } + ) + } + } + +} diff --git a/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap new file mode 100644 index 00000000..b1907385 --- /dev/null +++ b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap @@ -0,0 +1,22 @@ +{ + "homo_sapiens - cram": { + "content": [ + "test.bam:md5,6641dc05efa8384a061f378d86d922cd", + "test.bam.bai:md5,c41c60d8a94adebe53b6df80b6e90d38", + "test.flagstat:md5,93b0ef463df947ede1f42ff60396c34d", + "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15", + "test.stats:md5,0035ac8900d85e9a790f4c1f48b76947" + ], + "timestamp": "2023-12-05T17:45:12.484869" + }, + "homo_sapiens - bam": { + "content": [ + "test.bam:md5,3091fe6ba1b7530f382fe40b9fd8f45b", + "test.bam.bai:md5,4d3ae8d013444b55e17aa0149a2ab404", + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783", + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2", + "test.stats:md5,e32e7e49dce1fbe327a89e0fb7bc01b1" + ], + "timestamp": "2023-12-05T17:43:58.582652" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/bam_markduplicates_picard/tests/tags.yml b/subworkflows/nf-core/bam_markduplicates_picard/tests/tags.yml new file mode 100644 index 00000000..10b85270 --- /dev/null +++ b/subworkflows/nf-core/bam_markduplicates_picard/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/bam_markduplicates_picard: + - subworkflows/nf-core/bam_markduplicates_picard/** diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/main.nf b/subworkflows/nf-core/bam_sort_stats_samtools/main.nf index 617871fe..fc1c652b 100644 --- a/subworkflows/nf-core/bam_sort_stats_samtools/main.nf +++ b/subworkflows/nf-core/bam_sort_stats_samtools/main.nf @@ -9,7 +9,7 @@ include { BAM_STATS_SAMTOOLS } from '../bam_stats_samtools/main' workflow BAM_SORT_STATS_SAMTOOLS { take: ch_bam // channel: [ val(meta), [ bam ] ] - ch_fasta // channel: [ fasta ] + ch_fasta // channel: [ val(meta), path(fasta) ] main: diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml b/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml index 131065be..e01f9ccf 100644 --- a/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml +++ b/subworkflows/nf-core/bam_sort_stats_samtools/meta.yml @@ -1,3 +1,4 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json name: bam_sort_stats_samtools description: Sort SAM/BAM/CRAM file keywords: @@ -5,12 +6,13 @@ keywords: - bam - sam - cram -modules: +components: - samtools/sort - samtools/index - samtools/stats - samtools/idxstats - samtools/flagstat + - bam_stats_samtools input: - meta: type: map @@ -63,3 +65,6 @@ output: authors: - "@drpatelh" - "@ewels" +maintainers: + - "@drpatelh" + - "@ewels" diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test new file mode 100644 index 00000000..59b749d8 --- /dev/null +++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test @@ -0,0 +1,78 @@ +nextflow_workflow { + + name "Test Workflow BAM_SORT_STATS_SAMTOOLS" + script "../main.nf" + workflow "BAM_SORT_STATS_SAMTOOLS" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "subworkflows/bam_sort_stats_samtools" + tag "bam_sort_stats_samtools" + tag "subworkflows/bam_stats_samtools" + tag "bam_stats_samtools" + tag "samtools" + tag "samtools/index" + tag "samtools/sort" + tag "samtools/stats" + tag "samtools/idxstats" + tag "samtools/flagstat" + + test("test_bam_sort_stats_samtools_single_end") { + + when { + params { + outdir = "$outputDir" + } + workflow { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_single_end_bam'], checkIfExists: true) + ] + input[1] = [ [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"}, + { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"}, + { assert snapshot(workflow.out.stats).match("test_bam_sort_stats_samtools_single_end_stats") }, + { assert snapshot(workflow.out.flagstat).match("test_bam_sort_stats_samtools_single_end_flagstats") }, + { assert snapshot(workflow.out.idxstats).match("test_bam_sort_stats_samtools_single_end_idxstats") } + ) + } + } + + test("test_bam_sort_stats_samtools_paired_end") { + + when { + params { + outdir = "$outputDir" + } + workflow { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) + ] + input[1] = [ [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"}, + { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"}, + { assert snapshot(workflow.out.stats).match("test_bam_sort_stats_samtools_paired_end_stats") }, + { assert snapshot(workflow.out.flagstat).match("test_bam_sort_stats_samtools_paired_end_flagstats") }, + { assert snapshot(workflow.out.idxstats).match("test_bam_sort_stats_samtools_paired_end_idxstats") } + ) + } + } +} diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap new file mode 100644 index 00000000..77afbf17 --- /dev/null +++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap @@ -0,0 +1,86 @@ +{ + "test_bam_sort_stats_samtools_paired_end_flagstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ] + ], + "timestamp": "2023-10-22T20:25:03.687121177" + }, + "test_bam_sort_stats_samtools_paired_end_idxstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + ] + ] + ], + "timestamp": "2023-10-22T20:25:03.709648916" + }, + "test_bam_sort_stats_samtools_single_end_stats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,f281507081517414eb1a04b2d9c855b2" + ] + ] + ], + "timestamp": "2023-12-04T11:06:50.951881479" + }, + "test_bam_sort_stats_samtools_paired_end_stats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,e32e7e49dce1fbe327a89e0fb7bc01b1" + ] + ] + ], + "timestamp": "2023-12-04T11:06:59.253905951" + }, + "test_bam_sort_stats_samtools_single_end_idxstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20" + ] + ] + ], + "timestamp": "2023-10-22T20:25:58.451364604" + }, + "test_bam_sort_stats_samtools_single_end_flagstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53" + ] + ] + ], + "timestamp": "2023-10-22T20:25:58.416859285" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml b/subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml new file mode 100644 index 00000000..30b69d6a --- /dev/null +++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/bam_sort_stats_samtools: + - subworkflows/nf-core/bam_sort_stats_samtools/** diff --git a/subworkflows/nf-core/bam_stats_samtools/main.nf b/subworkflows/nf-core/bam_stats_samtools/main.nf index c9d7c8b7..44d4c010 100644 --- a/subworkflows/nf-core/bam_stats_samtools/main.nf +++ b/subworkflows/nf-core/bam_stats_samtools/main.nf @@ -9,7 +9,7 @@ include { SAMTOOLS_FLAGSTAT } from '../../../modules/nf-core/samtools/flagstat/m workflow BAM_STATS_SAMTOOLS { take: ch_bam_bai // channel: [ val(meta), path(bam), path(bai) ] - ch_fasta // channel: [ path(fasta) ] + ch_fasta // channel: [ val(meta), path(fasta) ] main: ch_versions = Channel.empty() diff --git a/subworkflows/nf-core/bam_stats_samtools/meta.yml b/subworkflows/nf-core/bam_stats_samtools/meta.yml index b6072686..809bf736 100644 --- a/subworkflows/nf-core/bam_stats_samtools/meta.yml +++ b/subworkflows/nf-core/bam_stats_samtools/meta.yml @@ -1,3 +1,4 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json name: bam_stats_samtools description: Produces comprehensive statistics from SAM/BAM/CRAM file keywords: @@ -6,7 +7,7 @@ keywords: - bam - sam - cram -modules: +components: - samtools/stats - samtools/idxstats - samtools/flagstat @@ -38,3 +39,5 @@ output: Structure: [ path(versions.yml) ] authors: - "@drpatelh" +maintainers: + - "@drpatelh" diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test new file mode 100644 index 00000000..97210890 --- /dev/null +++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test @@ -0,0 +1,102 @@ +nextflow_workflow { + + name "Test Workflow BAM_STATS_SAMTOOLS" + script "../main.nf" + workflow "BAM_STATS_SAMTOOLS" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "bam_stats_samtools" + tag "subworkflows/bam_stats_samtools" + tag "samtools" + tag "samtools/flagstat" + tag "samtools/idxstats" + tag "samtools/stats" + + test("test_bam_stats_samtools_single_end") { + + when { + params { + outdir = "$outputDir" + } + workflow { + """ + input[0] = [ [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_single_end_sorted_bam'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_single_end_sorted_bam_bai'], checkIfExists: true) + ] + input[1] = [ [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_single_end_stats") }, + { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_single_end_flagstats") }, + { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_single_end_idxstats") } + ) + } + } + + test("test_bam_stats_samtools_paired_end") { + + when { + params { + outdir = "$outputDir" + } + workflow { + """ + input[0] = [ [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) + ] + input[1] = [ [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_stats") }, + { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_flagstats") }, + { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_idxstats") } + ) + } + } + + test("test_bam_stats_samtools_paired_end_cram") { + + when { + params { + outdir = "$outputDir" + } + workflow { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true) + ] + input[1] = [ [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_cram_stats") }, + { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_cram_flagstats") }, + { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_cram_idxstats") } + ) + } + } + +} diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap new file mode 100644 index 00000000..d3af1376 --- /dev/null +++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap @@ -0,0 +1,128 @@ +{ + "test_bam_stats_samtools_paired_end_cram_flagstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,a53f3d26e2e9851f7d528442bbfe9781" + ] + ] + ], + "timestamp": "2023-11-06T09:31:26.194017574" + }, + "test_bam_stats_samtools_paired_end_stats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,49e2b43344ff92bc4c02463a58f7ba4a" + ] + ] + ], + "timestamp": "2023-12-04T11:07:13.965061942" + }, + "test_bam_stats_samtools_paired_end_flagstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ] + ], + "timestamp": "2023-11-06T09:31:11.668517251" + }, + "test_bam_stats_samtools_single_end_flagstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53" + ] + ] + ], + "timestamp": "2023-11-06T09:26:10.340046381" + }, + "test_bam_stats_samtools_paired_end_cram_idxstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15" + ] + ] + ], + "timestamp": "2023-11-06T09:31:26.207052003" + }, + "test_bam_stats_samtools_single_end_stats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,5a6667d97806e5002731e9cf23674fad" + ] + ] + ], + "timestamp": "2023-12-04T11:07:06.676820877" + }, + "test_bam_stats_samtools_paired_end_idxstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + ] + ] + ], + "timestamp": "2023-11-06T09:31:11.68246157" + }, + "test_bam_stats_samtools_single_end_idxstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20" + ] + ] + ], + "timestamp": "2023-11-06T09:26:10.349439801" + }, + "test_bam_stats_samtools_paired_end_cram_stats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,2cf2fe93596ee3d74f946097b204a629" + ] + ] + ], + "timestamp": "2023-12-04T11:07:22.30295557" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml b/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml new file mode 100644 index 00000000..ec2f2d68 --- /dev/null +++ b/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/bam_stats_samtools: + - subworkflows/nf-core/bam_stats_samtools/** diff --git a/subworkflows/nf-core/bam_variant_demix_boot_freyja/meta.yml b/subworkflows/nf-core/bam_variant_demix_boot_freyja/meta.yml index 2515b4fb..3afe864a 100644 --- a/subworkflows/nf-core/bam_variant_demix_boot_freyja/meta.yml +++ b/subworkflows/nf-core/bam_variant_demix_boot_freyja/meta.yml @@ -1,16 +1,15 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json name: "bam_variant_demix_boot_freyja" description: Recover relative lineage abundances from mixed SARS-CoV-2 samples from a sequencing dataset (BAM aligned to the Hu-1 reference) keywords: - bam - variants - cram - -modules: +components: - freyja/variants - freyja/demix - freyja/update - freyja/boot - input: - ch_bam: type: file @@ -38,7 +37,6 @@ input: description: | Structure: path(lineages_meta) File containing lineage metadata that correspond to barcodes - output: - meta: type: map @@ -72,15 +70,15 @@ output: a csv file that includes the lineages present but summarized by constellation and their corresponding abundances - barcodes: type: file - description: path(barcodes) - a csv file that includes the lineages present but summarized by constellation and their corresponding abundances + description: path(barcodes) a csv file that includes the lineages present but summarized by constellation and their corresponding abundances - lineages_meta: type: file - description: path(lineages_meta) - a csv file that includes the lineages present but summarized by constellation and their corresponding abundances + description: path(lineages_meta) a csv file that includes the lineages present but summarized by constellation and their corresponding abundances - versions: type: file description: File containing software versions pattern: "versions.yml" authors: - "@Joon-Klaps" +maintainers: + - "@Joon-Klaps" diff --git a/subworkflows/nf-core/fastq_align_bowtie2/main.nf b/subworkflows/nf-core/fastq_align_bowtie2/main.nf index eaf4ac5e..ba4420f7 100644 --- a/subworkflows/nf-core/fastq_align_bowtie2/main.nf +++ b/subworkflows/nf-core/fastq_align_bowtie2/main.nf @@ -21,18 +21,18 @@ workflow FASTQ_ALIGN_BOWTIE2 { // Map reads with Bowtie2 // BOWTIE2_ALIGN ( ch_reads, ch_index, save_unaligned, sort_bam ) - ch_versions = ch_versions.mix(BOWTIE2_ALIGN.out.versions.first()) + ch_versions = ch_versions.mix(BOWTIE2_ALIGN.out.versions) // // Sort, index BAM file and run samtools stats, flagstat and idxstats // - BAM_SORT_STATS_SAMTOOLS ( BOWTIE2_ALIGN.out.bam, ch_fasta ) + BAM_SORT_STATS_SAMTOOLS ( BOWTIE2_ALIGN.out.aligned, ch_fasta ) ch_versions = ch_versions.mix(BAM_SORT_STATS_SAMTOOLS.out.versions) emit: - bam_orig = BOWTIE2_ALIGN.out.bam // channel: [ val(meta), bam ] - log_out = BOWTIE2_ALIGN.out.log // channel: [ val(meta), log ] - fastq = BOWTIE2_ALIGN.out.fastq // channel: [ val(meta), fastq ] + bam_orig = BOWTIE2_ALIGN.out.aligned // channel: [ val(meta), aligned ] + log_out = BOWTIE2_ALIGN.out.log // channel: [ val(meta), log ] + fastq = BOWTIE2_ALIGN.out.fastq // channel: [ val(meta), fastq ] bam = BAM_SORT_STATS_SAMTOOLS.out.bam // channel: [ val(meta), [ bam ] ] bai = BAM_SORT_STATS_SAMTOOLS.out.bai // channel: [ val(meta), [ bai ] ] diff --git a/subworkflows/nf-core/fastq_align_bowtie2/meta.yml b/subworkflows/nf-core/fastq_align_bowtie2/meta.yml index ad378077..58023a89 100644 --- a/subworkflows/nf-core/fastq_align_bowtie2/meta.yml +++ b/subworkflows/nf-core/fastq_align_bowtie2/meta.yml @@ -1,3 +1,4 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json name: fastq_align_bowtie2 description: Align reads to a reference genome using bowtie2 then sort with samtools keywords: @@ -5,13 +6,14 @@ keywords: - fasta - genome - reference -modules: +components: - bowtie2/align - samtools/sort - samtools/index - samtools/stats - samtools/idxstats - samtools/flagstat + - bam_sort_stats_samtools input: - meta: type: map @@ -33,9 +35,10 @@ input: Save reads that do not map to the reference (true) or discard them (false) (default: false) - sort_bam: + type: boolean description: | Save reads that do not map to the reference (true) or discard them (false) - (default: false) + default: false - ch_fasta: type: file description: Reference fasta file @@ -58,6 +61,7 @@ output: type: file description: Alignment log pattern: "*.log" -# TODO Add samtools outputs authors: - "@drpatelh" +maintainers: + - "@drpatelh" From 7f2923b567aa0372e7fc3f57d4b5637370471082 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Sara=20Monz=C3=B3n?= Date: Tue, 19 Dec 2023 20:45:18 +0100 Subject: [PATCH 19/45] fixing modules call according to updates --- subworkflows/local/assembly_qc.nf | 4 +--- subworkflows/local/consensus_qc.nf | 4 +--- subworkflows/local/variants_long_table.nf | 4 ++-- subworkflows/local/vcf_tabix_stats.nf | 4 +++- workflows/illumina.nf | 2 -- 5 files changed, 7 insertions(+), 11 deletions(-) diff --git a/subworkflows/local/assembly_qc.nf b/subworkflows/local/assembly_qc.nf index 6ca9fc78..feb813a3 100644 --- a/subworkflows/local/assembly_qc.nf +++ b/subworkflows/local/assembly_qc.nf @@ -50,9 +50,7 @@ workflow ASSEMBLY_QC { QUAST ( scaffolds.collect{ it[1] }, fasta, - gff, - true, - params.gff + gff ) ch_quast_results = QUAST.out.results ch_quast_tsv = QUAST.out.tsv diff --git a/subworkflows/local/consensus_qc.nf b/subworkflows/local/consensus_qc.nf index 3e686f6f..39572001 100644 --- a/subworkflows/local/consensus_qc.nf +++ b/subworkflows/local/consensus_qc.nf @@ -27,9 +27,7 @@ workflow CONSENSUS_QC { QUAST ( consensus.collect{ it[1] }, fasta, - gff, - true, - params.gff + gff ) ch_quast_results = QUAST.out.results ch_quast_tsv = QUAST.out.tsv diff --git a/subworkflows/local/variants_long_table.nf b/subworkflows/local/variants_long_table.nf index a3ad6b0b..e0919055 100644 --- a/subworkflows/local/variants_long_table.nf +++ b/subworkflows/local/variants_long_table.nf @@ -25,14 +25,14 @@ workflow VARIANTS_LONG_TABLE { ch_versions = ch_versions.mix(BCFTOOLS_QUERY.out.versions.first()) MAKE_VARIANTS_LONG_TABLE ( - BCFTOOLS_QUERY.out.txt.collect{it[1]}, + BCFTOOLS_QUERY.out.output.collect{it[1]}, snpsift.collect{it[1]}.ifEmpty([]), pangolin.collect{it[1]}.ifEmpty([]) ) ch_versions = ch_versions.mix(MAKE_VARIANTS_LONG_TABLE.out.versions) emit: - query_table = BCFTOOLS_QUERY.out.txt // channel: [ val(meta), [ txt ] ] + query_table = BCFTOOLS_QUERY.out.output // channel: [ val(meta), [ txt ] ] long_table = MAKE_VARIANTS_LONG_TABLE.out.csv // channel: [ val(meta), [ csv ] ] versions = ch_versions // channel: [ versions.yml ] diff --git a/subworkflows/local/vcf_tabix_stats.nf b/subworkflows/local/vcf_tabix_stats.nf index c99321ae..2198fc95 100644 --- a/subworkflows/local/vcf_tabix_stats.nf +++ b/subworkflows/local/vcf_tabix_stats.nf @@ -25,7 +25,9 @@ workflow VCF_TABIX_STATS { vcf.join(TABIX_TABIX.out.tbi, by: [0]), regions, targets, - samples + samples, + [ [:], [] ], + [ [:], [] ] ) ch_versions = ch_versions.mix(BCFTOOLS_STATS.out.versions.first()) diff --git a/workflows/illumina.nf b/workflows/illumina.nf index 51d0d6eb..3ad67a02 100644 --- a/workflows/illumina.nf +++ b/workflows/illumina.nf @@ -395,7 +395,6 @@ workflow ILLUMINA { MOSDEPTH_GENOME ( ch_bam.join(ch_bai, by: [0]), [ [:], [] ], - [ [:], [] ] ) ch_mosdepth_multiqc = MOSDEPTH_GENOME.out.global_txt ch_versions = ch_versions.mix(MOSDEPTH_GENOME.out.versions.first().ifEmpty(null)) @@ -409,7 +408,6 @@ workflow ILLUMINA { MOSDEPTH_AMPLICON ( ch_bam.join(ch_bai, by: [0]), PREPARE_GENOME.out.primer_collapsed_bed.map { [ [:], it ] }, - [ [:], [] ] ) ch_versions = ch_versions.mix(MOSDEPTH_AMPLICON.out.versions.first().ifEmpty(null)) From 3bd897e73d84494d62cc37f9f0ecfa16cee76563 Mon Sep 17 00:00:00 2001 From: svarona Date: Wed, 20 Dec 2023 12:28:13 +0100 Subject: [PATCH 20/45] Fixed lint --- modules.json | 244 ++++++++++++++++++++++++++++++++++++++------------- 1 file changed, 183 insertions(+), 61 deletions(-) diff --git a/modules.json b/modules.json index 286c15ac..730942c3 100644 --- a/modules.json +++ b/modules.json @@ -8,277 +8,388 @@ "abacas": { "branch": "master", "git_sha": "3304b04f6022222e217bd17bc117f0babc8cbd6a", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "artic/guppyplex": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "artic/minion": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bandage/image": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bcftools/consensus": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bcftools/filter": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bcftools/mpileup": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bcftools/norm": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bcftools/query": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bcftools/sort": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bcftools/stats": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bedtools/getfasta": { "branch": "master", "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bedtools/maskfasta": { "branch": "master", "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bedtools/merge": { "branch": "master", "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "blast/blastn": { "branch": "master", "git_sha": "f0d13ae7e1f9b24a705764f8673af859268d7077", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "blast/makeblastdb": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bowtie2/align": { "branch": "master", "git_sha": "3c77ca9aac783e76c3614a06db3bfe4fef619bde", - "installed_by": ["fastq_align_bowtie2"] + "installed_by": [ + "fastq_align_bowtie2" + ] }, "bowtie2/build": { "branch": "master", "git_sha": "1fea64f5132a813ec97c1c6d3a74e0aee7142b6d", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "cat/fastq": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "custom/dumpsoftwareversions": { "branch": "master", "git_sha": "bba7e362e4afead70653f84d8700588ea28d0f9e", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "custom/getchromsizes": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "fastp": { "branch": "master", "git_sha": "3c77ca9aac783e76c3614a06db3bfe4fef619bde", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "fastqc": { "branch": "master", "git_sha": "65ad3e0b9a4099592e1102e92e10455dc661cf53", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "freyja/boot": { "branch": "master", "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", - "installed_by": ["bam_variant_demix_boot_freyja"] + "installed_by": [ + "bam_variant_demix_boot_freyja" + ] }, "freyja/demix": { "branch": "master", "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", - "installed_by": ["bam_variant_demix_boot_freyja"] + "installed_by": [ + "bam_variant_demix_boot_freyja" + ] }, "freyja/update": { "branch": "master", "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", - "installed_by": ["bam_variant_demix_boot_freyja"] + "installed_by": [ + "bam_variant_demix_boot_freyja" + ] }, "freyja/variants": { "branch": "master", "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", - "installed_by": ["bam_variant_demix_boot_freyja"] + "installed_by": [ + "bam_variant_demix_boot_freyja" + ] }, "gunzip": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "ivar/consensus": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "ivar/trim": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "ivar/variants": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "kraken2/kraken2": { "branch": "master", "git_sha": "d6549f46c3c1c3fe3def110f3d18059a68a65cc6", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "minia": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "mosdepth": { "branch": "master", "git_sha": "69e3eb17fb31b772b18f134d6e8f8b93ee980e65", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "nanoplot": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "nextclade/datasetget": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "nextclade/run": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "pangolin": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "picard/collectmultiplemetrics": { "branch": "master", "git_sha": "20b0918591d4ba20047d7e13e5094bcceba81447", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "picard/markduplicates": { "branch": "master", "git_sha": "20b0918591d4ba20047d7e13e5094bcceba81447", - "installed_by": ["bam_markduplicates_picard"] + "installed_by": [ + "bam_markduplicates_picard" + ] }, "plasmidid": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "pycoqc": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "quast": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "samtools/flagstat": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["bam_stats_samtools"] + "installed_by": [ + "bam_stats_samtools" + ] }, "samtools/idxstats": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["bam_stats_samtools"] + "installed_by": [ + "bam_stats_samtools" + ] }, "samtools/index": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["bam_markduplicates_picard", "bam_sort_stats_samtools"] + "installed_by": [ + "bam_markduplicates_picard", + "bam_sort_stats_samtools" + ] }, "samtools/sort": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["bam_sort_stats_samtools"] + "installed_by": [ + "bam_sort_stats_samtools" + ] }, "samtools/stats": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["bam_stats_samtools"] + "installed_by": [ + "bam_stats_samtools" + ] }, "samtools/view": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "spades": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "tabix/bgzip": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "tabix/tabix": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "unicycler": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "untar": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "vcflib/vcfuniq": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] } } }, @@ -287,30 +398,41 @@ "bam_markduplicates_picard": { "branch": "master", "git_sha": "eeb9d37c6c8b0ab864b8fe68aa6531c5b2beba01", - "installed_by": ["subworkflows"] + "installed_by": [ + "subworkflows" + ] }, "bam_sort_stats_samtools": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["fastq_align_bowtie2"] + "installed_by": [ + "fastq_align_bowtie2" + ] }, "bam_stats_samtools": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["bam_markduplicates_picard", "bam_sort_stats_samtools"] + "installed_by": [ + "bam_markduplicates_picard", + "bam_sort_stats_samtools" + ] }, "bam_variant_demix_boot_freyja": { "branch": "master", "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f", - "installed_by": ["subworkflows"] + "installed_by": [ + "subworkflows" + ] }, "fastq_align_bowtie2": { "branch": "master", "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f", - "installed_by": ["subworkflows"] + "installed_by": [ + "subworkflows" + ] } } } } } -} +} \ No newline at end of file From 48f8032a37ae8c8c589f82ece6e7afdbcf83aecf Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Wed, 20 Dec 2023 17:05:43 +0000 Subject: [PATCH 21/45] Template update for nf-core/tools version 2.11.1 --- .../{release-announcments.yml => release-announcements.yml} | 0 nextflow.config | 4 ++-- 2 files changed, 2 insertions(+), 2 deletions(-) rename .github/workflows/{release-announcments.yml => release-announcements.yml} (100%) diff --git a/.github/workflows/release-announcments.yml b/.github/workflows/release-announcements.yml similarity index 100% rename from .github/workflows/release-announcments.yml rename to .github/workflows/release-announcements.yml diff --git a/nextflow.config b/nextflow.config index 33ba5afb..2690733c 100644 --- a/nextflow.config +++ b/nextflow.config @@ -111,10 +111,10 @@ profiles { shifter.enabled = false charliecloud.enabled = false apptainer.enabled = false - runOptions = '-u $(id -u):$(id -g)' + docker.runOptions = '-u $(id -u):$(id -g)' } arm { - docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64' + docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64' } singularity { singularity.enabled = true From fa532f65816acbc89f52e74e76249154cf79a787 Mon Sep 17 00:00:00 2001 From: svarona Date: Thu, 21 Dec 2023 16:48:08 +0100 Subject: [PATCH 22/45] Fix prettier --- modules.json | 247 +++++++++++++++++++++++++++++++++++++-------------- 1 file changed, 182 insertions(+), 65 deletions(-) diff --git a/modules.json b/modules.json index 0b19b56d..730942c3 100644 --- a/modules.json +++ b/modules.json @@ -8,282 +8,388 @@ "abacas": { "branch": "master", "git_sha": "3304b04f6022222e217bd17bc117f0babc8cbd6a", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "artic/guppyplex": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "artic/minion": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bandage/image": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bcftools/consensus": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bcftools/filter": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bcftools/mpileup": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bcftools/norm": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bcftools/query": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bcftools/sort": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bcftools/stats": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bedtools/getfasta": { "branch": "master", "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bedtools/maskfasta": { "branch": "master", "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bedtools/merge": { "branch": "master", "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "blast/blastn": { "branch": "master", "git_sha": "f0d13ae7e1f9b24a705764f8673af859268d7077", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "blast/makeblastdb": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bowtie2/align": { "branch": "master", "git_sha": "3c77ca9aac783e76c3614a06db3bfe4fef619bde", - "installed_by": ["fastq_align_bowtie2"] + "installed_by": [ + "fastq_align_bowtie2" + ] }, "bowtie2/build": { "branch": "master", "git_sha": "1fea64f5132a813ec97c1c6d3a74e0aee7142b6d", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "cat/fastq": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "custom/dumpsoftwareversions": { "branch": "master", "git_sha": "bba7e362e4afead70653f84d8700588ea28d0f9e", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "custom/getchromsizes": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "fastp": { "branch": "master", "git_sha": "3c77ca9aac783e76c3614a06db3bfe4fef619bde", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "fastqc": { "branch": "master", "git_sha": "65ad3e0b9a4099592e1102e92e10455dc661cf53", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "freyja/boot": { "branch": "master", "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", - "installed_by": ["bam_variant_demix_boot_freyja"] + "installed_by": [ + "bam_variant_demix_boot_freyja" + ] }, "freyja/demix": { "branch": "master", "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", - "installed_by": ["bam_variant_demix_boot_freyja"] + "installed_by": [ + "bam_variant_demix_boot_freyja" + ] }, "freyja/update": { "branch": "master", "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", - "installed_by": ["bam_variant_demix_boot_freyja"] + "installed_by": [ + "bam_variant_demix_boot_freyja" + ] }, "freyja/variants": { "branch": "master", "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", - "installed_by": ["bam_variant_demix_boot_freyja"] + "installed_by": [ + "bam_variant_demix_boot_freyja" + ] }, "gunzip": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "ivar/consensus": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "ivar/trim": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "ivar/variants": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "kraken2/kraken2": { "branch": "master", "git_sha": "d6549f46c3c1c3fe3def110f3d18059a68a65cc6", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "minia": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "mosdepth": { "branch": "master", "git_sha": "69e3eb17fb31b772b18f134d6e8f8b93ee980e65", - "installed_by": ["modules"] - }, - "multiqc": { - "branch": "master", - "git_sha": "4ab13872435962dadc239979554d13709e20bf29", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "nanoplot": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "nextclade/datasetget": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "nextclade/run": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "pangolin": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "picard/collectmultiplemetrics": { "branch": "master", "git_sha": "20b0918591d4ba20047d7e13e5094bcceba81447", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "picard/markduplicates": { "branch": "master", "git_sha": "20b0918591d4ba20047d7e13e5094bcceba81447", - "installed_by": ["bam_markduplicates_picard"] + "installed_by": [ + "bam_markduplicates_picard" + ] }, "plasmidid": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "pycoqc": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "quast": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "samtools/flagstat": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["bam_stats_samtools"] + "installed_by": [ + "bam_stats_samtools" + ] }, "samtools/idxstats": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["bam_stats_samtools"] + "installed_by": [ + "bam_stats_samtools" + ] }, "samtools/index": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["bam_markduplicates_picard", "bam_sort_stats_samtools"] + "installed_by": [ + "bam_markduplicates_picard", + "bam_sort_stats_samtools" + ] }, "samtools/sort": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["bam_sort_stats_samtools"] + "installed_by": [ + "bam_sort_stats_samtools" + ] }, "samtools/stats": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["bam_stats_samtools"] + "installed_by": [ + "bam_stats_samtools" + ] }, "samtools/view": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "spades": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "tabix/bgzip": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "tabix/tabix": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "unicycler": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "untar": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "vcflib/vcfuniq": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] } } }, @@ -292,27 +398,38 @@ "bam_markduplicates_picard": { "branch": "master", "git_sha": "eeb9d37c6c8b0ab864b8fe68aa6531c5b2beba01", - "installed_by": ["subworkflows"] + "installed_by": [ + "subworkflows" + ] }, "bam_sort_stats_samtools": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["fastq_align_bowtie2"] + "installed_by": [ + "fastq_align_bowtie2" + ] }, "bam_stats_samtools": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": ["bam_markduplicates_picard", "bam_sort_stats_samtools"] + "installed_by": [ + "bam_markduplicates_picard", + "bam_sort_stats_samtools" + ] }, "bam_variant_demix_boot_freyja": { "branch": "master", "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f", - "installed_by": ["subworkflows"] + "installed_by": [ + "subworkflows" + ] }, "fastq_align_bowtie2": { "branch": "master", "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f", - "installed_by": ["subworkflows"] + "installed_by": [ + "subworkflows" + ] } } } From dcc56b2f92836ecb47855ecada47d3f416bfe040 Mon Sep 17 00:00:00 2001 From: svarona Date: Thu, 21 Dec 2023 16:59:41 +0100 Subject: [PATCH 23/45] pixed prettier --- modules.json | 244 +++++++++++++-------------------------------------- 1 file changed, 61 insertions(+), 183 deletions(-) diff --git a/modules.json b/modules.json index 730942c3..286c15ac 100644 --- a/modules.json +++ b/modules.json @@ -8,388 +8,277 @@ "abacas": { "branch": "master", "git_sha": "3304b04f6022222e217bd17bc117f0babc8cbd6a", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "artic/guppyplex": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "artic/minion": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bandage/image": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bcftools/consensus": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bcftools/filter": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bcftools/mpileup": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bcftools/norm": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bcftools/query": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bcftools/sort": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bcftools/stats": { "branch": "master", "git_sha": "44096c08ffdbc694f5f92ae174ea0f7ba0f37e09", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bedtools/getfasta": { "branch": "master", "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bedtools/maskfasta": { "branch": "master", "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bedtools/merge": { "branch": "master", "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "blast/blastn": { "branch": "master", "git_sha": "f0d13ae7e1f9b24a705764f8673af859268d7077", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "blast/makeblastdb": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bowtie2/align": { "branch": "master", "git_sha": "3c77ca9aac783e76c3614a06db3bfe4fef619bde", - "installed_by": [ - "fastq_align_bowtie2" - ] + "installed_by": ["fastq_align_bowtie2"] }, "bowtie2/build": { "branch": "master", "git_sha": "1fea64f5132a813ec97c1c6d3a74e0aee7142b6d", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "cat/fastq": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "custom/dumpsoftwareversions": { "branch": "master", "git_sha": "bba7e362e4afead70653f84d8700588ea28d0f9e", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "custom/getchromsizes": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "fastp": { "branch": "master", "git_sha": "3c77ca9aac783e76c3614a06db3bfe4fef619bde", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "fastqc": { "branch": "master", "git_sha": "65ad3e0b9a4099592e1102e92e10455dc661cf53", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "freyja/boot": { "branch": "master", "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", - "installed_by": [ - "bam_variant_demix_boot_freyja" - ] + "installed_by": ["bam_variant_demix_boot_freyja"] }, "freyja/demix": { "branch": "master", "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", - "installed_by": [ - "bam_variant_demix_boot_freyja" - ] + "installed_by": ["bam_variant_demix_boot_freyja"] }, "freyja/update": { "branch": "master", "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", - "installed_by": [ - "bam_variant_demix_boot_freyja" - ] + "installed_by": ["bam_variant_demix_boot_freyja"] }, "freyja/variants": { "branch": "master", "git_sha": "7e33bdd8b4faf45be1be6a6f49979f0f0820d243", - "installed_by": [ - "bam_variant_demix_boot_freyja" - ] + "installed_by": ["bam_variant_demix_boot_freyja"] }, "gunzip": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "ivar/consensus": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "ivar/trim": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "ivar/variants": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "kraken2/kraken2": { "branch": "master", "git_sha": "d6549f46c3c1c3fe3def110f3d18059a68a65cc6", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "minia": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "mosdepth": { "branch": "master", "git_sha": "69e3eb17fb31b772b18f134d6e8f8b93ee980e65", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "nanoplot": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "nextclade/datasetget": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "nextclade/run": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "pangolin": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "picard/collectmultiplemetrics": { "branch": "master", "git_sha": "20b0918591d4ba20047d7e13e5094bcceba81447", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "picard/markduplicates": { "branch": "master", "git_sha": "20b0918591d4ba20047d7e13e5094bcceba81447", - "installed_by": [ - "bam_markduplicates_picard" - ] + "installed_by": ["bam_markduplicates_picard"] }, "plasmidid": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "pycoqc": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "quast": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "samtools/flagstat": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": [ - "bam_stats_samtools" - ] + "installed_by": ["bam_stats_samtools"] }, "samtools/idxstats": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": [ - "bam_stats_samtools" - ] + "installed_by": ["bam_stats_samtools"] }, "samtools/index": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": [ - "bam_markduplicates_picard", - "bam_sort_stats_samtools" - ] + "installed_by": ["bam_markduplicates_picard", "bam_sort_stats_samtools"] }, "samtools/sort": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": [ - "bam_sort_stats_samtools" - ] + "installed_by": ["bam_sort_stats_samtools"] }, "samtools/stats": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": [ - "bam_stats_samtools" - ] + "installed_by": ["bam_stats_samtools"] }, "samtools/view": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "spades": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "tabix/bgzip": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "tabix/tabix": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "unicycler": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "untar": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "vcflib/vcfuniq": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] } } }, @@ -398,41 +287,30 @@ "bam_markduplicates_picard": { "branch": "master", "git_sha": "eeb9d37c6c8b0ab864b8fe68aa6531c5b2beba01", - "installed_by": [ - "subworkflows" - ] + "installed_by": ["subworkflows"] }, "bam_sort_stats_samtools": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": [ - "fastq_align_bowtie2" - ] + "installed_by": ["fastq_align_bowtie2"] }, "bam_stats_samtools": { "branch": "master", "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", - "installed_by": [ - "bam_markduplicates_picard", - "bam_sort_stats_samtools" - ] + "installed_by": ["bam_markduplicates_picard", "bam_sort_stats_samtools"] }, "bam_variant_demix_boot_freyja": { "branch": "master", "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f", - "installed_by": [ - "subworkflows" - ] + "installed_by": ["subworkflows"] }, "fastq_align_bowtie2": { "branch": "master", "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f", - "installed_by": [ - "subworkflows" - ] + "installed_by": ["subworkflows"] } } } } } -} \ No newline at end of file +} From bf5fd9db6e905233b25fc35515f36838370cb1c4 Mon Sep 17 00:00:00 2001 From: svarona Date: Fri, 22 Dec 2023 14:08:33 +0100 Subject: [PATCH 24/45] Fixed some conflicts --- CITATIONS.md | 2 +- README.md | 5 ++--- docs/usage.md | 2 +- nextflow.config | 1 - 4 files changed, 4 insertions(+), 6 deletions(-) diff --git a/CITATIONS.md b/CITATIONS.md index 4896c07e..cc0ca9c7 100644 --- a/CITATIONS.md +++ b/CITATIONS.md @@ -50,7 +50,7 @@ - [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) - > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. + > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/). - [iVar](https://www.ncbi.nlm.nih.gov/pubmed/30621750/) diff --git a/README.md b/README.md index a3f39f11..51938feb 100644 --- a/README.md +++ b/README.md @@ -85,11 +85,10 @@ A number of improvements were made to the pipeline recently, mainly with regard ## Usage -:::note -If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how +> [!NOTE] +> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) with `-profile test` before running the workflow on actual data. -::: First, prepare a samplesheet with your input data that looks as follows: diff --git a/docs/usage.md b/docs/usage.md index 04c3ba33..93c0c4b0 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -22,7 +22,7 @@ You will need to create a samplesheet with information about the samples you wou The `sample` identifiers have to be the same when you have re-sequenced the same sample more than once e.g. to increase sequencing depth. The pipeline will concatenate the raw reads before performing any downstream analysis. Below is an example for the same sample sequenced across 3 lanes: -```console +```csv title="samplesheet.csv" sample,fastq_1,fastq_2 SAMPLE_1,AEG588A1_S1_L002_R1_001.fastq.gz,AEG588A1_S1_L002_R2_001.fastq.gz SAMPLE_1,AEG588A1_S1_L003_R1_001.fastq.gz,AEG588A1_S1_L003_R2_001.fastq.gz diff --git a/nextflow.config b/nextflow.config index a6f189bb..61bf0344 100644 --- a/nextflow.config +++ b/nextflow.config @@ -17,7 +17,6 @@ params { // Reference genome options genome = null igenomes_base = 's3://ngi-igenomes/igenomes/' - igenomes_ignore = false primer_set = null primer_set_version = null primer_fasta = null From 28ce0d2cffec0ec603a646a42ac21ffc7cc21722 Mon Sep 17 00:00:00 2001 From: svarona Date: Wed, 27 Dec 2023 10:07:11 +0100 Subject: [PATCH 25/45] Updated modules --- modules.json | 2 +- modules/nf-core/fastp/main.nf | 18 ++ modules/nf-core/fastp/tests/main.nf.test | 241 ++++++++++++++++++ modules/nf-core/fastp/tests/main.nf.test.snap | 55 ++++ 4 files changed, 315 insertions(+), 1 deletion(-) diff --git a/modules.json b/modules.json index 286c15ac..087c09c2 100644 --- a/modules.json +++ b/modules.json @@ -112,7 +112,7 @@ }, "fastp": { "branch": "master", - "git_sha": "3c77ca9aac783e76c3614a06db3bfe4fef619bde", + "git_sha": "d086322563bdbb08c94bf15a7db58a39ccdb1520", "installed_by": ["modules"] }, "fastqc": { diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf index 5fac3c1a..2a3b679e 100644 --- a/modules/nf-core/fastp/main.nf +++ b/modules/nf-core/fastp/main.nf @@ -99,4 +99,22 @@ process FASTP { END_VERSIONS """ } + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + def is_single_output = task.ext.args?.contains('--interleaved_in') || meta.single_end + def touch_reads = is_single_output ? "${prefix}.fastp.fastq.gz" : "${prefix}_1.fastp.fastq.gz ${prefix}_2.fastp.fastq.gz" + def touch_merged = (!is_single_output && save_merged) ? "touch ${prefix}.merged.fastq.gz" : "" + """ + touch $touch_reads + touch "${prefix}.fastp.json" + touch "${prefix}.fastp.html" + touch "${prefix}.fastp.log" + $touch_merged + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + fastp: \$(fastp --version 2>&1 | sed -e "s/fastp //g") + END_VERSIONS + """ } diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test index f610b735..17dce8ac 100644 --- a/modules/nf-core/fastp/tests/main.nf.test +++ b/modules/nf-core/fastp/tests/main.nf.test @@ -57,6 +57,67 @@ nextflow_process { { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } } }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_single_end-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("test_fastp_single_end-stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = [ + [ id:'test', single_end:true ], + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ] + ] + + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_single_end-for_stub_match") + }, { assert snapshot(process.out.versions).match("versions") } ) } @@ -127,6 +188,67 @@ nextflow_process { { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } } }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("test_fastp_paired_end-stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end-for_stub_match") + }, { assert snapshot(process.out.versions).match("versions") } ) } @@ -181,6 +303,66 @@ nextflow_process { { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } } }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_interleaved-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("fastp test_fastp_interleaved-stub") { + + options '-stub' + + config './nextflow.config' + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = [ [ id:'test', single_end:true ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_interleaved_fastq_gz'], checkIfExists: true) ] + ] + + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_interleaved-for_stub_match") + }, { assert snapshot(process.out.versions).match("versions") } ) } @@ -399,6 +581,65 @@ nextflow_process { { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } } }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end_merged-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("test_fastp_paired_end_merged-stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = true + + input[0] = [ [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end_merged-for_stub_match") + }, { assert snapshot(process.out.versions).match("versions") } ) } diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap index 0fa68c7d..1b7d2419 100644 --- a/modules/nf-core/fastp/tests/main.nf.test.snap +++ b/modules/nf-core/fastp/tests/main.nf.test.snap @@ -1,4 +1,19 @@ { + "test_fastp_paired_end-for_stub_match": { + "content": [ + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=false}" + ] + ], + "timestamp": "2023-12-21T09:44:37.202512" + }, "fastp test_fastp_interleaved_json": { "content": [ [ @@ -13,6 +28,22 @@ ], "timestamp": "2023-10-17T11:04:45.794175881" }, + "test_fastp_paired_end_merged-for_stub_match": { + "content": [ + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "test.merged.fastq.gz", + "{id=test, single_end=false}" + ] + ], + "timestamp": "2023-12-21T09:53:45.237014" + }, "test_fastp_single_end_json": { "content": [ [ @@ -35,6 +66,30 @@ ], "timestamp": "2023-10-17T11:04:10.582076024" }, + "test_fastp_interleaved-for_stub_match": { + "content": [ + [ + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "timestamp": "2023-12-21T09:48:43.148485" + }, + "test_fastp_single_end-for_stub_match": { + "content": [ + [ + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "timestamp": "2023-12-21T09:20:07.254788" + }, "test_fastp_single_end_trim_fail_json": { "content": [ [ From a8ce52a1b7e29e1ecbdcbf8e6b839067910205ee Mon Sep 17 00:00:00 2001 From: svarona Date: Wed, 27 Dec 2023 11:19:47 +0100 Subject: [PATCH 26/45] Fixed quast process --- subworkflows/local/assembly_qc.nf | 11 ++++++++--- subworkflows/local/consensus_qc.nf | 11 ++++++++--- workflows/nanopore.nf | 6 +++++- 3 files changed, 21 insertions(+), 7 deletions(-) diff --git a/subworkflows/local/assembly_qc.nf b/subworkflows/local/assembly_qc.nf index feb813a3..24c1dc12 100644 --- a/subworkflows/local/assembly_qc.nf +++ b/subworkflows/local/assembly_qc.nf @@ -47,10 +47,15 @@ workflow ASSEMBLY_QC { ch_quast_results = Channel.empty() ch_quast_tsv = Channel.empty() if (!params.skip_assembly_quast) { + scaffolds + .collect{ it[1] } + .map { scaffolds_collect -> tuple([id: "quast"], scaffolds_collect) } + .set { ch_to_quast } + QUAST ( - scaffolds.collect{ it[1] }, - fasta, - gff + ch_to_quast, + fasta.map { [ [:], it ] }, + gff.map { [ [:], it ] } ) ch_quast_results = QUAST.out.results ch_quast_tsv = QUAST.out.tsv diff --git a/subworkflows/local/consensus_qc.nf b/subworkflows/local/consensus_qc.nf index 39572001..3a7a5880 100644 --- a/subworkflows/local/consensus_qc.nf +++ b/subworkflows/local/consensus_qc.nf @@ -24,10 +24,15 @@ workflow CONSENSUS_QC { ch_quast_results = Channel.empty() ch_quast_tsv = Channel.empty() if (!params.skip_variants_quast) { + consensus + .collect{ it[1] } + .map { consensus_collect -> tuple([id: "quast"], consensus_collect) } + .set { ch_to_quast } + QUAST ( - consensus.collect{ it[1] }, - fasta, - gff + ch_to_quast, + fasta.map { [ [:], it ] }, + gff.map { [ [:], it ] } ) ch_quast_results = QUAST.out.results ch_quast_tsv = QUAST.out.tsv diff --git a/workflows/nanopore.nf b/workflows/nanopore.nf index b370d525..42da64bc 100644 --- a/workflows/nanopore.nf +++ b/workflows/nanopore.nf @@ -459,8 +459,12 @@ workflow NANOPORE { // ch_quast_multiqc = Channel.empty() if (!params.skip_variants_quast) { + ARTIC_MINION.out.fasta + .collect{ it[1] } + .map { consensus_collect -> tuple([id: "quast"], consensus_collect) } + .set { ch_to_quast } QUAST ( - ARTIC_MINION.out.fasta.collect{ it[1] }, + ch_to_quast, PREPARE_GENOME.out.fasta.collect(), params.gff ? PREPARE_GENOME.out.gff : [], true, From 8d578968ccf105d7484c6620903bbae2951022d7 Mon Sep 17 00:00:00 2001 From: svarona Date: Wed, 27 Dec 2023 11:38:08 +0100 Subject: [PATCH 27/45] Fixed quast for multiqc --- workflows/illumina.nf | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/workflows/illumina.nf b/workflows/illumina.nf index 3ad67a02..d31dbcc9 100644 --- a/workflows/illumina.nf +++ b/workflows/illumina.nf @@ -660,13 +660,13 @@ workflow ILLUMINA { ch_ivar_counts_multiqc.collect{it[1]}.ifEmpty([]), ch_bcftools_stats_multiqc.collect{it[1]}.ifEmpty([]), ch_snpeff_multiqc.collect{it[1]}.ifEmpty([]), - ch_quast_multiqc.collect().ifEmpty([]), + ch_quast_multiqc.collect{it[1]}.ifEmpty([]), ch_pangolin_multiqc.collect{it[1]}.ifEmpty([]), ch_nextclade_multiqc.collectFile(name: 'nextclade_clade_mqc.tsv').ifEmpty([]), ch_cutadapt_multiqc.collect{it[1]}.ifEmpty([]), - ch_spades_quast_multiqc.collect().ifEmpty([]), - ch_unicycler_quast_multiqc.collect().ifEmpty([]), - ch_minia_quast_multiqc.collect().ifEmpty([]) + ch_spades_quast_multiqc.collect{it[1]}.ifEmpty([]), + ch_unicycler_quast_multiqc.collect{it[1]}.ifEmpty([]), + ch_minia_quast_multiqc.collect{it[1]}.ifEmpty([]) ) multiqc_report = MULTIQC.out.report.toList() } From 5d63daf572ec934dafec49c9e13458a63ed197e8 Mon Sep 17 00:00:00 2001 From: svarona Date: Wed, 27 Dec 2023 11:38:41 +0100 Subject: [PATCH 28/45] Fixed ref fasta channel --- workflows/illumina.nf | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/workflows/illumina.nf b/workflows/illumina.nf index d31dbcc9..b3f3b922 100644 --- a/workflows/illumina.nf +++ b/workflows/illumina.nf @@ -292,7 +292,7 @@ workflow ILLUMINA { PREPARE_GENOME.out.bowtie2_index, params.save_unaligned, false, - PREPARE_GENOME.out.fasta + PREPARE_GENOME.out.fasta.map { [ [:], it ] } ) ch_bam = FASTQ_ALIGN_BOWTIE2.out.bam ch_bai = FASTQ_ALIGN_BOWTIE2.out.bai @@ -350,7 +350,7 @@ workflow ILLUMINA { BAM_TRIM_PRIMERS_IVAR ( ch_bam.join(ch_bai, by: [0]), PREPARE_GENOME.out.primer_bed, - PREPARE_GENOME.out.fasta + PREPARE_GENOME.out.fasta.map { [ [:], it ] } ) ch_bam = BAM_TRIM_PRIMERS_IVAR.out.bam ch_bai = BAM_TRIM_PRIMERS_IVAR.out.bai @@ -365,7 +365,7 @@ workflow ILLUMINA { if (!params.skip_variants && !params.skip_markduplicates) { BAM_MARKDUPLICATES_PICARD ( ch_bam, - PREPARE_GENOME.out.fasta, + PREPARE_GENOME.out.fasta.map { [ [:], it ] }, PREPARE_GENOME.out.fai ) ch_bam = BAM_MARKDUPLICATES_PICARD.out.bam From 96cdeb77ecfd8c312712625b1857fb0f888f9949 Mon Sep 17 00:00:00 2001 From: svarona Date: Wed, 27 Dec 2023 11:39:08 +0100 Subject: [PATCH 29/45] Fixed ref fasta channel --- subworkflows/local/prepare_genome_illumina.nf | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/subworkflows/local/prepare_genome_illumina.nf b/subworkflows/local/prepare_genome_illumina.nf index 4b7c1dda..f55aef83 100644 --- a/subworkflows/local/prepare_genome_illumina.nf +++ b/subworkflows/local/prepare_genome_illumina.nf @@ -206,7 +206,7 @@ workflow PREPARE_GENOME { } } else { BLAST_MAKEBLASTDB ( - ch_fasta + ch_fasta.map { [ [:], it ] } ) ch_blast_db = BLAST_MAKEBLASTDB.out.db ch_versions = ch_versions.mix(BLAST_MAKEBLASTDB.out.versions) From cfea905f51e67e19b7875bd916a0048e734c0e37 Mon Sep 17 00:00:00 2001 From: svarona Date: Wed, 27 Dec 2023 11:39:31 +0100 Subject: [PATCH 30/45] Fixed empty channels --- subworkflows/local/snpeff_snpsift.nf | 6 +++--- subworkflows/local/variants_ivar.nf | 6 +++--- 2 files changed, 6 insertions(+), 6 deletions(-) diff --git a/subworkflows/local/snpeff_snpsift.nf b/subworkflows/local/snpeff_snpsift.nf index 92a6a669..a3c6c7f7 100644 --- a/subworkflows/local/snpeff_snpsift.nf +++ b/subworkflows/local/snpeff_snpsift.nf @@ -28,9 +28,9 @@ workflow SNPEFF_SNPSIFT { VCF_BGZIP_TABIX_STATS ( SNPEFF_ANN.out.vcf, - [], - [], - [] + [ [:], [] ], + [ [:], [] ], + [ [:], [] ] ) ch_versions = ch_versions.mix(VCF_BGZIP_TABIX_STATS.out.versions) diff --git a/subworkflows/local/variants_ivar.nf b/subworkflows/local/variants_ivar.nf index 26e460aa..eceab2bd 100644 --- a/subworkflows/local/variants_ivar.nf +++ b/subworkflows/local/variants_ivar.nf @@ -60,9 +60,9 @@ workflow VARIANTS_IVAR { VCF_TABIX_STATS ( BCFTOOLS_SORT.out.vcf, - [], - [], - [] + [ [:], [] ], + [ [:], [] ], + [ [:], [] ] ) ch_versions = ch_versions.mix(VCF_TABIX_STATS.out.versions) From eb7a82db49ec338079986c1467d1feeaaac7531d Mon Sep 17 00:00:00 2001 From: svarona Date: Wed, 27 Dec 2023 11:55:38 +0100 Subject: [PATCH 31/45] Fixed mosdepth process --- workflows/illumina.nf | 10 +++++++--- 1 file changed, 7 insertions(+), 3 deletions(-) diff --git a/workflows/illumina.nf b/workflows/illumina.nf index b3f3b922..6d7efe0a 100644 --- a/workflows/illumina.nf +++ b/workflows/illumina.nf @@ -393,7 +393,9 @@ workflow ILLUMINA { ch_amplicon_heatmap_multiqc = Channel.empty() if (!params.skip_variants && !params.skip_mosdepth) { MOSDEPTH_GENOME ( - ch_bam.join(ch_bai, by: [0]), + ch_bam + .join(ch_bai, by: [0]) + .map { meta, bam, bai -> [ meta, bam, bai, [] ] }, [ [:], [] ], ) ch_mosdepth_multiqc = MOSDEPTH_GENOME.out.global_txt @@ -406,8 +408,10 @@ workflow ILLUMINA { if (params.protocol == 'amplicon') { MOSDEPTH_AMPLICON ( - ch_bam.join(ch_bai, by: [0]), - PREPARE_GENOME.out.primer_collapsed_bed.map { [ [:], it ] }, + ch_bam + .join(ch_bai, by: [0]) + .join(PREPARE_GENOME.out.primer_collapsed_bed), + [ [:], [] ], ) ch_versions = ch_versions.mix(MOSDEPTH_AMPLICON.out.versions.first().ifEmpty(null)) From 6d5b405f54a89b2a80718cb980b8263777f81ec4 Mon Sep 17 00:00:00 2001 From: svarona Date: Wed, 27 Dec 2023 15:23:46 +0100 Subject: [PATCH 32/45] Fixed empty fields --- workflows/nanopore.nf | 10 ++++++---- 1 file changed, 6 insertions(+), 4 deletions(-) diff --git a/workflows/nanopore.nf b/workflows/nanopore.nf index 42da64bc..5f02e241 100644 --- a/workflows/nanopore.nf +++ b/workflows/nanopore.nf @@ -347,9 +347,11 @@ workflow NANOPORE { // BCFTOOLS_STATS ( VCFLIB_VCFUNIQ.out.vcf.join(TABIX_TABIX.out.tbi, by: [0]), - [], - [], - [] + [ [:], [] ], + [ [:], [] ], + [ [:], [] ], + [ [:], [] ], + [ [:], [] ] ) ch_versions = ch_versions.mix(BCFTOOLS_STATS.out.versions.first().ifEmpty(null)) @@ -358,7 +360,7 @@ workflow NANOPORE { // FILTER_BAM_SAMTOOLS ( ARTIC_MINION.out.bam.join(ARTIC_MINION.out.bai, by: [0]), - [] + [ [:], [] ] ) ch_versions = ch_versions.mix(FILTER_BAM_SAMTOOLS.out.versions) From ad5b38a230ea7280baf9582d9c8eca15bbb0fd88 Mon Sep 17 00:00:00 2001 From: svarona Date: Wed, 27 Dec 2023 15:24:11 +0100 Subject: [PATCH 33/45] Fixed quast --- workflows/nanopore.nf | 8 +++----- 1 file changed, 3 insertions(+), 5 deletions(-) diff --git a/workflows/nanopore.nf b/workflows/nanopore.nf index 5f02e241..8125ed9d 100644 --- a/workflows/nanopore.nf +++ b/workflows/nanopore.nf @@ -467,10 +467,8 @@ workflow NANOPORE { .set { ch_to_quast } QUAST ( ch_to_quast, - PREPARE_GENOME.out.fasta.collect(), - params.gff ? PREPARE_GENOME.out.gff : [], - true, - params.gff + PREPARE_GENOME.out.fasta.collect().map { [ [:], it ] }, + params.gff ? PREPARE_GENOME.out.gff.map { [ [:], it ] } : [], ) ch_quast_multiqc = QUAST.out.tsv ch_versions = ch_versions.mix(QUAST.out.versions) @@ -563,7 +561,7 @@ workflow NANOPORE { FILTER_BAM_SAMTOOLS.out.flagstat.collect{it[1]}.ifEmpty([]), BCFTOOLS_STATS.out.stats.collect{it[1]}.ifEmpty([]), ch_mosdepth_multiqc.collect{it[1]}.ifEmpty([]), - ch_quast_multiqc.collect().ifEmpty([]), + ch_quast_multiqc.collect{it[1]}.ifEmpty([]), ch_snpeff_multiqc.collect{it[1]}.ifEmpty([]), ch_pangolin_multiqc.collect{it[1]}.ifEmpty([]), ch_nextclade_multiqc.collectFile(name: 'nextclade_clade_mqc.tsv').ifEmpty([]) From 5ccac088279504d17b4e94db63d5266f12273855 Mon Sep 17 00:00:00 2001 From: svarona Date: Wed, 27 Dec 2023 15:24:21 +0100 Subject: [PATCH 34/45] Fixed mosdepth --- workflows/nanopore.nf | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/workflows/nanopore.nf b/workflows/nanopore.nf index 8125ed9d..2064bc9c 100644 --- a/workflows/nanopore.nf +++ b/workflows/nanopore.nf @@ -372,8 +372,9 @@ workflow NANOPORE { if (!params.skip_mosdepth) { MOSDEPTH_GENOME ( - ARTIC_MINION.out.bam_primertrimmed.join(ARTIC_MINION.out.bai_primertrimmed, by: [0]), - [ [:], [] ], + ARTIC_MINION.out.bam_primertrimmed + .join(ARTIC_MINION.out.bai_primertrimmed, by: [0]) + .map { meta, bam, bai -> [ meta, bam, bai, [] ] }, [ [:], [] ] ) ch_mosdepth_multiqc = MOSDEPTH_GENOME.out.global_txt @@ -385,8 +386,7 @@ workflow NANOPORE { ch_versions = ch_versions.mix(PLOT_MOSDEPTH_REGIONS_GENOME.out.versions) MOSDEPTH_AMPLICON ( - ARTIC_MINION.out.bam_primertrimmed.join(ARTIC_MINION.out.bai_primertrimmed, by: [0]), - PREPARE_GENOME.out.primer_collapsed_bed.map { [ [:], it ] }.collect(), + ARTIC_MINION.out.bam_primertrimmed.join(ARTIC_MINION.out.bai_primertrimmed, by: [0]).join(PREPARE_GENOME.out.primer_collapsed_bed), [ [:], [] ] ) ch_versions = ch_versions.mix(MOSDEPTH_AMPLICON.out.versions.first().ifEmpty(null)) From 78a4143983078bf54507969553fa8c1b9626ca68 Mon Sep 17 00:00:00 2001 From: svarona Date: Wed, 27 Dec 2023 17:31:19 +0100 Subject: [PATCH 35/45] Fixed empty channels --- subworkflows/local/variants_bcftools.nf | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/subworkflows/local/variants_bcftools.nf b/subworkflows/local/variants_bcftools.nf index 103ba725..bda0dc00 100644 --- a/subworkflows/local/variants_bcftools.nf +++ b/subworkflows/local/variants_bcftools.nf @@ -63,9 +63,9 @@ workflow VARIANTS_BCFTOOLS { VCF_TABIX_STATS ( BCFTOOLS_NORM.out.vcf, - [], - [], - [] + [ [:], [] ], + [ [:], [] ], + [ [:], [] ] ) ch_versions = ch_versions.mix(VCF_TABIX_STATS.out.versions) From 661ec680549d35805c59baacee1db8400d804786 Mon Sep 17 00:00:00 2001 From: svarona Date: Wed, 27 Dec 2023 17:31:37 +0100 Subject: [PATCH 36/45] Fixed fasta channel --- subworkflows/local/variants_bcftools.nf | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/subworkflows/local/variants_bcftools.nf b/subworkflows/local/variants_bcftools.nf index bda0dc00..e4a78c72 100644 --- a/subworkflows/local/variants_bcftools.nf +++ b/subworkflows/local/variants_bcftools.nf @@ -26,7 +26,7 @@ workflow VARIANTS_BCFTOOLS { // BCFTOOLS_MPILEUP ( bam.map{ meta, bam_file -> [ meta, bam_file, [] ] }, - fasta, + fasta.map { [ [:], it ] }, params.save_mpileup ) ch_versions = ch_versions.mix(BCFTOOLS_MPILEUP.out.versions.first()) @@ -57,7 +57,7 @@ workflow VARIANTS_BCFTOOLS { // BCFTOOLS_NORM ( ch_vcf.join(ch_tbi, by: [0]), - fasta + fasta.map { [ [:], it ] } ) ch_versions = ch_versions.mix(BCFTOOLS_NORM.out.versions.first()) From 508e2709a7fcdfeb41134aa4c491f97b07ad7bec Mon Sep 17 00:00:00 2001 From: svarona Date: Wed, 27 Dec 2023 18:20:46 +0100 Subject: [PATCH 37/45] Fixed gff channel for empty path --- subworkflows/local/assembly_qc.nf | 2 +- subworkflows/local/consensus_qc.nf | 2 +- workflows/illumina.nf | 10 +++++----- 3 files changed, 7 insertions(+), 7 deletions(-) diff --git a/subworkflows/local/assembly_qc.nf b/subworkflows/local/assembly_qc.nf index 24c1dc12..ac98c56b 100644 --- a/subworkflows/local/assembly_qc.nf +++ b/subworkflows/local/assembly_qc.nf @@ -55,7 +55,7 @@ workflow ASSEMBLY_QC { QUAST ( ch_to_quast, fasta.map { [ [:], it ] }, - gff.map { [ [:], it ] } + gff ) ch_quast_results = QUAST.out.results ch_quast_tsv = QUAST.out.tsv diff --git a/subworkflows/local/consensus_qc.nf b/subworkflows/local/consensus_qc.nf index 3a7a5880..f498a9be 100644 --- a/subworkflows/local/consensus_qc.nf +++ b/subworkflows/local/consensus_qc.nf @@ -32,7 +32,7 @@ workflow CONSENSUS_QC { QUAST ( ch_to_quast, fasta.map { [ [:], it ] }, - gff.map { [ [:], it ] } + gff ) ch_quast_results = QUAST.out.results ch_quast_tsv = QUAST.out.tsv diff --git a/workflows/illumina.nf b/workflows/illumina.nf index 6d7efe0a..1c369a78 100644 --- a/workflows/illumina.nf +++ b/workflows/illumina.nf @@ -499,7 +499,7 @@ workflow ILLUMINA { CONSENSUS_IVAR ( ch_bam, PREPARE_GENOME.out.fasta, - params.gff ? PREPARE_GENOME.out.gff : [], + params.gff ? PREPARE_GENOME.out.gff.map { [ [:], it ] } : [ [:], [] ], PREPARE_GENOME.out.nextclade_db ) @@ -518,7 +518,7 @@ workflow ILLUMINA { ch_vcf, ch_tbi, PREPARE_GENOME.out.fasta, - params.gff ? PREPARE_GENOME.out.gff : [], + params.gff ? PREPARE_GENOME.out.gff.map { [ [:], it ] } : [ [:], [] ], PREPARE_GENOME.out.nextclade_db ) @@ -591,7 +591,7 @@ workflow ILLUMINA { params.spades_mode, ch_spades_hmm, PREPARE_GENOME.out.fasta, - params.gff ? PREPARE_GENOME.out.gff : [], + params.gff ? PREPARE_GENOME.out.gff.map { [ [:], it ] } : [ [:], [] ], PREPARE_GENOME.out.blast_db, ch_blast_outfmt6_header ) @@ -607,7 +607,7 @@ workflow ILLUMINA { ASSEMBLY_UNICYCLER ( ch_assembly_fastq.map { meta, fastq -> [ meta, fastq, [] ] }, PREPARE_GENOME.out.fasta, - params.gff ? PREPARE_GENOME.out.gff : [], + params.gff ? PREPARE_GENOME.out.gff.map { [ [:], it ] } : [ [:], [] ], PREPARE_GENOME.out.blast_db, ch_blast_outfmt6_header ) @@ -623,7 +623,7 @@ workflow ILLUMINA { ASSEMBLY_MINIA ( ch_assembly_fastq, PREPARE_GENOME.out.fasta, - params.gff ? PREPARE_GENOME.out.gff : [], + params.gff ? PREPARE_GENOME.out.gff.map { [ [:], it ] } : [ [:], [] ], PREPARE_GENOME.out.blast_db, ch_blast_outfmt6_header ) From 566837aff925a670bb8ed4a45ce599d94903d98d Mon Sep 17 00:00:00 2001 From: svarona Date: Thu, 28 Dec 2023 10:54:33 +0100 Subject: [PATCH 38/45] Fixed prettier --- README.md | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/README.md b/README.md index 51938feb..3eac4923 100644 --- a/README.md +++ b/README.md @@ -87,8 +87,8 @@ A number of improvements were made to the pipeline recently, mainly with regard > [!NOTE] > If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how -to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) -with `-profile test` before running the workflow on actual data. +> to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) +> with `-profile test` before running the workflow on actual data. First, prepare a samplesheet with your input data that looks as follows: From bb665604aa92e5de1925ca0edf63b870fef6acf0 Mon Sep 17 00:00:00 2001 From: svarona Date: Thu, 28 Dec 2023 12:43:45 +0100 Subject: [PATCH 39/45] Fixed empty channels --- workflows/nanopore.nf | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/workflows/nanopore.nf b/workflows/nanopore.nf index 2064bc9c..698220cd 100644 --- a/workflows/nanopore.nf +++ b/workflows/nanopore.nf @@ -468,7 +468,7 @@ workflow NANOPORE { QUAST ( ch_to_quast, PREPARE_GENOME.out.fasta.collect().map { [ [:], it ] }, - params.gff ? PREPARE_GENOME.out.gff.map { [ [:], it ] } : [], + params.gff ? PREPARE_GENOME.out.gff.map { [ [:], it ] } : [ [:], [] ], ) ch_quast_multiqc = QUAST.out.tsv ch_versions = ch_versions.mix(QUAST.out.versions) From b3d2dbb55ee28d1d9a0e84651e7c9dd310bd449d Mon Sep 17 00:00:00 2001 From: svarona Date: Mon, 15 Jan 2024 11:11:45 +0100 Subject: [PATCH 40/45] Download medaka model for nanopore test --- .github/workflows/ci.yml | 5 ++++- 1 file changed, 4 insertions(+), 1 deletion(-) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index 653e74e7..edae0526 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -103,7 +103,7 @@ jobs: - "--min_barcode_reads 10000" - "--min_guppyplex_reads 10000" - "--artic_minion_caller medaka --sequencing_summary false --fast5_dir false" - - "--artic_minion_caller medaka --sequencing_summary false --fast5_dir false --artic_minion_medaka_model r941_min_high_g360" + - "--artic_minion_caller medaka --sequencing_summary false --fast5_dir false --artic_minion_medaka_model ./r941_min_high_g360_model.hdf5" steps: - name: Check out pipeline code uses: actions/checkout@v2 @@ -112,6 +112,9 @@ jobs: run: | wget -qO- get.nextflow.io | bash sudo mv nextflow /usr/local/bin/ + - name: Download medaka model + run: | + wget https://github.com/nanoporetech/medaka/raw/master/medaka/data/r941_min_high_g360_model.hdf5 - name: Run pipeline with minimal Nanopore data and various options run: | From 249146aa54fe73cce88b09a2790f6be4ce3c6270 Mon Sep 17 00:00:00 2001 From: svarona Date: Tue, 16 Jan 2024 13:08:33 +0100 Subject: [PATCH 41/45] Removed TODO comment --- main.nf | 3 --- 1 file changed, 3 deletions(-) diff --git a/main.nf b/main.nf index 6424fbc5..e51c832d 100644 --- a/main.nf +++ b/main.nf @@ -28,9 +28,6 @@ if (params.platform == 'illumina' && params.protocol == 'amplicon') { params.artic_scheme = WorkflowMain.getGenomeAttribute(params, 'scheme', log, primer_set, primer_set_version) } -// TODO nf-core: Remove this line if you don't need a FASTA file -// This is an example of how to use getGenomeAttribute() to fetch parameters -// from igenomes.config using `--genome` params.fasta = WorkflowMain.getGenomeAttribute(params, 'fasta' , log, primer_set, primer_set_version) params.gff = WorkflowMain.getGenomeAttribute(params, 'gff' , log, primer_set, primer_set_version) params.bowtie2_index = WorkflowMain.getGenomeAttribute(params, 'bowtie2' , log, primer_set, primer_set_version) From 4c850ba6315bb7d645ecf751c45ead94d86d2c1e Mon Sep 17 00:00:00 2001 From: svarona Date: Tue, 16 Jan 2024 13:22:45 +0100 Subject: [PATCH 42/45] Removed igenomes_base --- nextflow.config | 1 - 1 file changed, 1 deletion(-) diff --git a/nextflow.config b/nextflow.config index 61bf0344..96e8dba9 100644 --- a/nextflow.config +++ b/nextflow.config @@ -16,7 +16,6 @@ params { // Reference genome options genome = null - igenomes_base = 's3://ngi-igenomes/igenomes/' primer_set = null primer_set_version = null primer_fasta = null From 8df9b78fa840c06f71d9356e92d160b15fc04757 Mon Sep 17 00:00:00 2001 From: svarona Date: Tue, 16 Jan 2024 13:38:37 +0100 Subject: [PATCH 43/45] removed igenomes_base from validationSchemaIgnoreParams --- nextflow.config | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/nextflow.config b/nextflow.config index 96e8dba9..03e9c48b 100644 --- a/nextflow.config +++ b/nextflow.config @@ -122,7 +122,7 @@ params { // Schema validation default options validationFailUnrecognisedParams = false validationLenientMode = false - validationSchemaIgnoreParams = 'genomes,igenomes_base' + validationSchemaIgnoreParams = 'genomes' validationShowHiddenParams = false validate_params = true From 7b19b0a1cb1d3f0f8df59ff0802359ddaf7a7389 Mon Sep 17 00:00:00 2001 From: svarona Date: Tue, 16 Jan 2024 15:06:21 +0100 Subject: [PATCH 44/45] added primer set artic to usage example --- README.md | 1 + 1 file changed, 1 insertion(+) diff --git a/README.md b/README.md index 3eac4923..46fbea6a 100644 --- a/README.md +++ b/README.md @@ -138,6 +138,7 @@ nextflow run nf-core/viralrecon \ --outdir \ --platform nanopore \ --genome 'MN908947.3' \ + --primer_set 'artic' \ --primer_set_version 3 \ --fastq_dir fastq_pass/ \ --fast5_dir fast5_pass/ \ From d6ff06cd8e43b69897cd91225464bf62c3655132 Mon Sep 17 00:00:00 2001 From: svarona Date: Tue, 16 Jan 2024 15:07:49 +0100 Subject: [PATCH 45/45] added primerset artic to usage examples --- docs/usage.md | 2 ++ 1 file changed, 2 insertions(+) diff --git a/docs/usage.md b/docs/usage.md index 93c0c4b0..c5aacc24 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -104,6 +104,7 @@ nextflow run nf-core/viralrecon \ --outdir \ --platform nanopore \ --genome 'MN908947.3' \ + --primer_set 'artic' \ --primer_set_version 3 \ --fastq_dir fastq_pass/ \ --fast5_dir fast5_pass/ \ @@ -123,6 +124,7 @@ nextflow run nf-core/viralrecon \ --outdir \ --platform nanopore \ --genome 'MN908947.3' \ + --primer_set 'artic' \ --primer_set_version 3 \ --fastq_dir fastq_pass/ \ --artic_minion_caller medaka \