Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

product fails with nested Devices #9

Open
tim-tx opened this issue Jan 4, 2019 · 0 comments
Open

product fails with nested Devices #9

tim-tx opened this issue Jan 4, 2019 · 0 comments

Comments

@tim-tx
Copy link

tim-tx commented Jan 4, 2019

The following input fails with the error reported below.

PartType promoter;

promoter I14018(.SEQUENCE("tacataggcgagtactctgttatgg"));

Device fproms(+I14018, +I14018);
Device heirarchical(fproms, promoter);
product(heirarchical);

Error:

org.cidarlab.eugene.exception.EugeneException: org.cidarlab.minieugene.dom.Component cannot be cast to org.cidarlab.minieugene.dom.ComponentType
at org.cidarlab.eugene.interp.Interp.productPrimitiveDevice(Interp.java:959)
at org.cidarlab.eugene.interp.Interp.productCompositeDevice(Interp.java:843)
at org.cidarlab.eugene.interp.Interp.product(Interp.java:695)
at org.cidarlab.eugene.parser.EugeneParser.built_in_function(EugeneParser.java:13014)
at org.cidarlab.eugene.parser.EugeneParser.statement(EugeneParser.java:1600)
at org.cidarlab.eugene.parser.EugeneParser.prog(EugeneParser.java:1204)
at org.cidarlab.eugene.Eugene.executeScript(Eugene.java:283)
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Labels
None yet
Projects
None yet
Development

No branches or pull requests

1 participant