diff --git a/Python/candy.py b/Python/candy.py
index eded6772a..c2c0c2e08 100644
--- a/Python/candy.py
+++ b/Python/candy.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(n)
 #
@@ -11,6 +12,7 @@
 #
 
 import operator
+from functools import reduce
 
 class Solution:
     # @param ratings, a list of integer
@@ -29,5 +31,5 @@ def candy(self, ratings):
 
 if __name__ == "__main__":
     result = Solution().candy([1, 2, 3, 2, 3, 5, 2, 5])
-    print result
+    print(result)
 
diff --git a/Python/climbing-stairs.py b/Python/climbing-stairs.py
index a6ccff427..5ef865236 100644
--- a/Python/climbing-stairs.py
+++ b/Python/climbing-stairs.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -29,4 +30,4 @@ def climbStairs1(self, n):
 
 if __name__ == "__main__":
     result = Solution().climbStairs(2)
-    print result
+    print(result)
diff --git a/Python/combination-sum-ii.py b/Python/combination-sum-ii.py
index 31975069d..fabfdf352 100644
--- a/Python/combination-sum-ii.py
+++ b/Python/combination-sum-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(k * C(n, k))
 # Space: O(k)
 #
@@ -42,4 +43,4 @@ def combinationSumRecu(self, candidates, result, start, intermediate, target):
 if __name__ == "__main__":
     candidates, target = [10, 1, 2, 7, 6, 1, 5], 8
     result = Solution().combinationSum2(candidates, target)
-    print result
+    print(result)
diff --git a/Python/combination-sum.py b/Python/combination-sum.py
index 0120a7cdb..fdb9a1c74 100644
--- a/Python/combination-sum.py
+++ b/Python/combination-sum.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(k * n^k)
 # Space: O(k)
 #
@@ -37,4 +38,4 @@ def combinationSumRecu(self, candidates, result, start, intermediate, target):
 if __name__ == "__main__":
     candidates, target = [2, 3, 6, 7], 7
     result = Solution().combinationSum(candidates, target)
-    print result
+    print(result)
diff --git a/Python/combinations.py b/Python/combinations.py
index e57640ab1..9513ec413 100644
--- a/Python/combinations.py
+++ b/Python/combinations.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(k * C(n, k))
 # Space: O(k)
 
@@ -61,4 +62,4 @@ def combineDFS(n, start, intermediate, k, result):
 
 if __name__ == "__main__":
     result = Solution().combine(4, 2)
-    print result
+    print(result)
diff --git a/Python/compare-version-numbers.py b/Python/compare-version-numbers.py
index 342dff213..2cc7ade76 100644
--- a/Python/compare-version-numbers.py
+++ b/Python/compare-version-numbers.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 
@@ -99,6 +100,6 @@ def compareVersion4(self, version1, version2):
 
 
 if __name__ == "__main__":
-    print Solution().compareVersion("21.0", "121.1.0")
-    print Solution().compareVersion("01", "1")
-    print Solution().compareVersion("1", "1.0")
+    print(Solution().compareVersion("21.0", "121.1.0"))
+    print(Solution().compareVersion("01", "1"))
+    print(Solution().compareVersion("1", "1.0"))
diff --git a/Python/construct-binary-tree-from-inorder-and-postorder-traversal.py b/Python/construct-binary-tree-from-inorder-and-postorder-traversal.py
index 294594fa5..c09e28245 100644
--- a/Python/construct-binary-tree-from-inorder-and-postorder-traversal.py
+++ b/Python/construct-binary-tree-from-inorder-and-postorder-traversal.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(n)
 #
@@ -37,6 +38,6 @@ def buildTreeRecu(self, lookup, postorder, inorder, post_end, in_start, in_end):
     inorder = [2, 1, 3]
     postorder = [2, 3, 1]
     result = Solution().buildTree(inorder, postorder)
-    print result.val
-    print result.left.val
-    print result.right.val
\ No newline at end of file
+    print(result.val)
+    print(result.left.val)
+    print(result.right.val)
\ No newline at end of file
diff --git a/Python/construct-binary-tree-from-preorder-and-inorder-traversal.py b/Python/construct-binary-tree-from-preorder-and-inorder-traversal.py
index a316ecdd2..3da09b572 100644
--- a/Python/construct-binary-tree-from-preorder-and-inorder-traversal.py
+++ b/Python/construct-binary-tree-from-preorder-and-inorder-traversal.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(n)
 #
@@ -37,6 +38,6 @@ def buildTreeRecu(self, lookup, preorder, inorder, pre_start, in_start, in_end):
     preorder = [1, 2, 3]
     inorder = [2, 1, 3]
     result = Solution().buildTree(preorder, inorder)
-    print result.val
-    print result.left.val
-    print result.right.val
+    print(result.val)
+    print(result.left.val)
+    print(result.right.val)
diff --git a/Python/container-with-most-water.py b/Python/container-with-most-water.py
index 5522e0080..6c8016d76 100644
--- a/Python/container-with-most-water.py
+++ b/Python/container-with-most-water.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -26,4 +27,4 @@ def maxArea(self, height):
 if __name__ == "__main__":
     height = [1, 2, 3, 4, 3, 2, 1, 5]
     result = Solution().maxArea(height)
-    print result
\ No newline at end of file
+    print(result)
\ No newline at end of file
diff --git a/Python/convert-sorted-array-to-binary-search-tree.py b/Python/convert-sorted-array-to-binary-search-tree.py
index ac3789fb5..57d9165bf 100644
--- a/Python/convert-sorted-array-to-binary-search-tree.py
+++ b/Python/convert-sorted-array-to-binary-search-tree.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(logn)
 #
@@ -49,6 +50,6 @@ def perfect_tree_pivot(self, n):
 if __name__ == "__main__":
     num = [1, 2, 3]
     result = Solution().sortedArrayToBST(num)
-    print result.val
-    print result.left.val
-    print result.right.val
+    print(result.val)
+    print(result.left.val)
+    print(result.right.val)
diff --git a/Python/convert-sorted-list-to-binary-search-tree.py b/Python/convert-sorted-list-to-binary-search-tree.py
index a1e2a5166..4875bcba4 100644
--- a/Python/convert-sorted-list-to-binary-search-tree.py
+++ b/Python/convert-sorted-list-to-binary-search-tree.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(logn)
 #
@@ -44,6 +45,6 @@ def sortedListToBSTRecu(self, start, end):
     head.next = ListNode(2)
     head.next.next = ListNode(3)
     result = Solution().sortedListToBST(head)
-    print result.val
-    print result.left.val
-    print result.right.val
\ No newline at end of file
+    print(result.val)
+    print(result.left.val)
+    print(result.right.val)
\ No newline at end of file
diff --git a/Python/copy-list-with-random-pointer.py b/Python/copy-list-with-random-pointer.py
index 483aa2a3e..695b144c5 100644
--- a/Python/copy-list-with-random-pointer.py
+++ b/Python/copy-list-with-random-pointer.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -71,6 +72,6 @@ def copyRandomList(self, head):
     head.next = RandomListNode(2)
     head.random = head.next
     result = Solution().copyRandomList(head)
-    print result.label
-    print result.next.label
-    print result.random.label
\ No newline at end of file
+    print(result.label)
+    print(result.next.label)
+    print(result.random.label)
\ No newline at end of file
diff --git a/Python/count-and-say.py b/Python/count-and-say.py
index 2bbfc3a4e..5b7d04825 100644
--- a/Python/count-and-say.py
+++ b/Python/count-and-say.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n * 2^n)
 # Space: O(2^n)
 #
@@ -33,6 +34,6 @@ def getNext(self, seq):
 
 if __name__ == "__main__":
     for i in xrange(1, 4):
-        print Solution().countAndSay(i)
+        print(Solution().countAndSay(i))
 
 
diff --git a/Python/counting-bits.py b/Python/counting-bits.py
index 8da8a2185..e3829c7e6 100644
--- a/Python/counting-bits.py
+++ b/Python/counting-bits.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(n)
 
@@ -52,4 +53,4 @@ def countBits2(self, num):
 if __name__ == '__main__':
     s = Solution()
     r = s.countBits2(5)
-    print r
+    print(r)
diff --git a/Python/course-schedule-iii.py b/Python/course-schedule-iii.py
index 605f9cc19..7ad66c09e 100644
--- a/Python/course-schedule-iii.py
+++ b/Python/course-schedule-iii.py
@@ -35,7 +35,7 @@ def scheduleCourse(self, courses):
         :type courses: List[List[int]]
         :rtype: int
         """
-        courses.sort(key=lambda(t, end): end)
+        courses.sort(key=lambda t_end: t_end[1])
         max_heap = []
         now = 0
         for t, end in courses:
diff --git a/Python/course-schedule.py b/Python/course-schedule.py
index ddd5fc3de..73711a1db 100644
--- a/Python/course-schedule.py
+++ b/Python/course-schedule.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(|V| + |E|)
 # Space: O(|E|)
 #
@@ -72,4 +73,4 @@ def canFinish(self, numCourses, prerequisites):
 
 
 if __name__ == "__main__":
-    print Solution().canFinish(1, [])
+    print(Solution().canFinish(1, []))
diff --git a/Python/decode-ways.py b/Python/decode-ways.py
index 7d60cfa09..d5c3b9be4 100644
--- a/Python/decode-ways.py
+++ b/Python/decode-ways.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -36,4 +37,4 @@ def numDecodings(self, s):
 
 if __name__ == "__main__":
     for i in ["0", "10", "10", "103", "1032", "10323"]:
-        print Solution().numDecodings(i)
+        print(Solution().numDecodings(i))
diff --git a/Python/distinct-subsequences.py b/Python/distinct-subsequences.py
index 5d4aad7bc..747aeee53 100644
--- a/Python/distinct-subsequences.py
+++ b/Python/distinct-subsequences.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n^2)
 # Space: O(n)
 #
@@ -28,5 +29,5 @@ def numDistinct(self, S, T):
     S = "rabbbit"
     T = "rabbit"
     result = Solution().numDistinct(S, T)
-    print result
+    print(result)
 
diff --git a/Python/divide-two-integers.py b/Python/divide-two-integers.py
index 9e2bd8193..b5f7341e9 100644
--- a/Python/divide-two-integers.py
+++ b/Python/divide-two-integers.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logn) = O(1)
 # Space: O(1)
 #
@@ -46,7 +47,7 @@ def divide2(self, dividend, divisor):
         return min(max(-2147483648, res), 2147483647)
 
 if __name__ == "__main__":
-    print Solution().divide(123, 12)
-    print Solution().divide(123, -12)
-    print Solution().divide(-123, 12)
-    print Solution().divide(-123, -12)
+    print(Solution().divide(123, 12))
+    print(Solution().divide(123, -12))
+    print(Solution().divide(-123, 12))
+    print(Solution().divide(-123, -12))
diff --git a/Python/dungeon-game.py b/Python/dungeon-game.py
index d42e5d1a3..b02b08ecc 100644
--- a/Python/dungeon-game.py
+++ b/Python/dungeon-game.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(m * n)
 # Space: O(m + n)
 #
@@ -98,10 +99,10 @@ def DP(self, dungeon, HP):
     dungeon = [[ -2,  -3,  3], \
                [ -5, -10,  1], \
                [ 10,  30, -5]]
-    print Solution().calculateMinimumHP(dungeon)
+    print(Solution().calculateMinimumHP(dungeon))
 
     dungeon = [[ -200]]
-    print Solution().calculateMinimumHP(dungeon)
+    print(Solution().calculateMinimumHP(dungeon))
 
     dungeon = [[0, -3]]
-    print Solution().calculateMinimumHP(dungeon)
\ No newline at end of file
+    print(Solution().calculateMinimumHP(dungeon))
\ No newline at end of file
diff --git a/Python/edit-distance.py b/Python/edit-distance.py
index 2ca1e67c4..f1daec88e 100644
--- a/Python/edit-distance.py
+++ b/Python/edit-distance.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n * m)
 # Space: O(n + m)
 #
@@ -53,6 +54,6 @@ def minDistance(self, word1, word2):
         return distance[-1][-1]
 
 if __name__ == "__main__":
-    print Solution().minDistance("Rabbit", "Racket")
-    print Solution2().minDistance("Rabbit", "Rabket")
-    print Solution().minDistance("Rabbit", "Rabbitt")
+    print(Solution().minDistance("Rabbit", "Racket"))
+    print(Solution2().minDistance("Rabbit", "Rabket"))
+    print(Solution().minDistance("Rabbit", "Rabbitt"))
diff --git a/Python/evaluate-reverse-polish-notation.py b/Python/evaluate-reverse-polish-notation.py
index b64bad971..50606d757 100644
--- a/Python/evaluate-reverse-polish-notation.py
+++ b/Python/evaluate-reverse-polish-notation.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(n)
 #
@@ -25,6 +26,6 @@ def evalRPN(self, tokens):
         return numerals.pop()
 
 if __name__ == "__main__":
-    print Solution().evalRPN(["2", "1", "+", "3", "*"])
-    print Solution().evalRPN(["4", "13", "5", "/", "+"])
-    print Solution().evalRPN(["10","6","9","3","+","-11","*","/","*","17","+","5","+"])
\ No newline at end of file
+    print(Solution().evalRPN(["2", "1", "+", "3", "*"]))
+    print(Solution().evalRPN(["4", "13", "5", "/", "+"]))
+    print(Solution().evalRPN(["10","6","9","3","+","-11","*","/","*","17","+","5","+"]))
\ No newline at end of file
diff --git a/Python/excel-sheet-column-number.py b/Python/excel-sheet-column-number.py
index ad16cb326..ceac0cb02 100644
--- a/Python/excel-sheet-column-number.py
+++ b/Python/excel-sheet-column-number.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 
@@ -29,4 +30,4 @@ def titleToNumber(self, s):
 
 
 if __name__ == "__main__":
-    print Solution().titleToNumber("AAAB")
+    print(Solution().titleToNumber("AAAB"))
diff --git a/Python/excel-sheet-column-title.py b/Python/excel-sheet-column-title.py
index 041031253..0b833b155 100644
--- a/Python/excel-sheet-column-title.py
+++ b/Python/excel-sheet-column-title.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logn)
 # Space: O(1)
 
@@ -30,4 +31,4 @@ def convertToTitle(self, n):
 
 if __name__ == "__main__":
     for i in xrange(1, 29):
-        print Solution().convertToTitle(i)
+        print(Solution().convertToTitle(i))
diff --git a/Python/factorial-trailing-zeroes.py b/Python/factorial-trailing-zeroes.py
index bccfd7e75..f071fd710 100644
--- a/Python/factorial-trailing-zeroes.py
+++ b/Python/factorial-trailing-zeroes.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logn) = O(1)
 # Space: O(1)
 #
@@ -16,4 +17,4 @@ def trailingZeroes(self, n):
         return result
 
 if __name__ == "__main__":
-    print Solution().trailingZeroes(100)
+    print(Solution().trailingZeroes(100))
diff --git a/Python/find-all-numbers-disappeared-in-an-array.py b/Python/find-all-numbers-disappeared-in-an-array.py
index cde02ffa0..6461968c6 100644
--- a/Python/find-all-numbers-disappeared-in-an-array.py
+++ b/Python/find-all-numbers-disappeared-in-an-array.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 
@@ -54,4 +55,4 @@ def findDisappearedNumbers3(self, nums):
 if __name__ == '__main__':
     s = Solution()
     r = s.findDisappearedNumbers([4, 3, 2, 7, 8, 2, 3, 1])
-    print r
+    print(r)
diff --git a/Python/find-minimum-in-rotated-sorted-array-ii.py b/Python/find-minimum-in-rotated-sorted-array-ii.py
index 911eacbb7..7ca773143 100644
--- a/Python/find-minimum-in-rotated-sorted-array-ii.py
+++ b/Python/find-minimum-in-rotated-sorted-array-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logn) ~ O(n)
 # Space: O(1)
 #
@@ -55,5 +56,5 @@ def findMin(self, nums):
 
 
 if __name__ == "__main__":
-    print Solution().findMin([3, 1, 1, 2, 2, 3])
-    print Solution2().findMin([2, 2, 2, 3, 3, 1])
+    print(Solution().findMin([3, 1, 1, 2, 2, 3]))
+    print(Solution2().findMin([2, 2, 2, 3, 3, 1]))
diff --git a/Python/find-minimum-in-rotated-sorted-array.py b/Python/find-minimum-in-rotated-sorted-array.py
index 87bf741e8..e850ea1cf 100644
--- a/Python/find-minimum-in-rotated-sorted-array.py
+++ b/Python/find-minimum-in-rotated-sorted-array.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logn)
 # Space: O(1)
 #
@@ -49,8 +50,8 @@ def findMin(self, nums):
 
 
 if __name__ == "__main__":
-    print Solution().findMin([1])
-    print Solution().findMin([1, 2])
-    print Solution().findMin([2, 1])
-    print Solution().findMin([3, 1, 2])
-    print Solution().findMin([2, 3, 1])
+    print(Solution().findMin([1]))
+    print(Solution().findMin([1, 2]))
+    print(Solution().findMin([2, 1]))
+    print(Solution().findMin([3, 1, 2]))
+    print(Solution().findMin([2, 3, 1]))
diff --git a/Python/find-peak-element.py b/Python/find-peak-element.py
index b986c43bf..4d6569ac5 100644
--- a/Python/find-peak-element.py
+++ b/Python/find-peak-element.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logn)
 # Space: O(1)
 
@@ -38,4 +39,4 @@ def findPeakElement(self, nums):
 
 if __name__ == "__main__":
    # print Solution().findPeakElement([1,2,1])
-    print Solution().findPeakElement([1,2,3,1])
+    print(Solution().findPeakElement([1,2,3,1]))
diff --git a/Python/find-the-difference.py b/Python/find-the-difference.py
index d661e7967..691f63a9e 100644
--- a/Python/find-the-difference.py
+++ b/Python/find-the-difference.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 
@@ -22,6 +23,7 @@
 
 import operator
 import collections
+from functools import reduce
 
 
 class Solution(object):
@@ -59,4 +61,4 @@ def findTheDifference5(self, s, t):
 if __name__ == '__main__':
     s = Solution()
     r = s.findTheDifference2('abcd', 'abcde')
-    print r
+    print(r)
diff --git a/Python/first-missing-positive.py b/Python/first-missing-positive.py
index eb09936d4..0fec5e20d 100644
--- a/Python/first-missing-positive.py
+++ b/Python/first-missing-positive.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -27,5 +28,5 @@ def firstMissingPositive(self, A):
         return len(A) + 1
 
 if __name__ == "__main__":
-    print Solution().firstMissingPositive([1,2,0])
-    print Solution().firstMissingPositive([3,4,-1,1])
+    print(Solution().firstMissingPositive([1,2,0]))
+    print(Solution().firstMissingPositive([3,4,-1,1]))
diff --git a/Python/fizz-buzz.py b/Python/fizz-buzz.py
index 0e46b90e1..9c56e8524 100644
--- a/Python/fizz-buzz.py
+++ b/Python/fizz-buzz.py
@@ -71,4 +71,4 @@ def fizzBuzz3(self, n):
         return ['Fizz' * (not i % 3) + 'Buzz' * (not i % 5) or str(i) for i in range(1, n + 1)]
 
     def fizzBuzz4(self, n):
-        return ['FizzBuzz'[i % -3 & -4:i % -5 & 8 ^ 12] or `i` for i in range(1, n + 1)]
+        return ['FizzBuzz'[i % -3 & -4:i % -5 & 8 ^ 12] or repr(i) for i in range(1, n + 1)]
diff --git a/Python/flatten-binary-tree-to-linked-list.py b/Python/flatten-binary-tree-to-linked-list.py
index 581275cb0..92e726125 100644
--- a/Python/flatten-binary-tree-to-linked-list.py
+++ b/Python/flatten-binary-tree-to-linked-list.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(h), h is height of binary tree
 #
@@ -69,9 +70,9 @@ def flatten(self, root):
     root.right = TreeNode(5)
     root.right.right = TreeNode(6)
     result = Solution().flatten(root)
-    print result.val
-    print result.right.val
-    print result.right.right.val
-    print result.right.right.right.val
-    print result.right.right.right.right.val
-    print result.right.right.right.right.right.val
+    print(result.val)
+    print(result.right.val)
+    print(result.right.right.val)
+    print(result.right.right.right.val)
+    print(result.right.right.right.right.val)
+    print(result.right.right.right.right.right.val)
diff --git a/Python/fraction-to-recurring-decimal.py b/Python/fraction-to-recurring-decimal.py
index 7fed92fb2..02b14c678 100644
--- a/Python/fraction-to-recurring-decimal.py
+++ b/Python/fraction-to-recurring-decimal.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logn), where logn is the length of result strings
 # Space: O(1)
 
@@ -44,7 +45,7 @@ def fractionToDecimal(self, numerator, denominator):
 
 
 if __name__ == "__main__":
-    print Solution().fractionToDecimal(1, 9)
-    print Solution().fractionToDecimal(-50, 8)
-    print Solution().fractionToDecimal(22, 2)
-    print Solution().fractionToDecimal(-22, -2)
+    print(Solution().fractionToDecimal(1, 9))
+    print(Solution().fractionToDecimal(-50, 8))
+    print(Solution().fractionToDecimal(22, 2))
+    print(Solution().fractionToDecimal(-22, -2))
diff --git a/Python/gas-station.py b/Python/gas-station.py
index 30a6fe5cc..45413aa93 100644
--- a/Python/gas-station.py
+++ b/Python/gas-station.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -31,7 +32,7 @@ def canCompleteCircuit(self, gas, cost):
         return -1
 
 if __name__ == "__main__":
-    print Solution().canCompleteCircuit([1, 2, 3], [3, 2, 1])
-    print Solution().canCompleteCircuit([1, 2, 3], [2, 2, 2])
-    print Solution().canCompleteCircuit([1, 2, 3], [1, 2, 3])
-    print Solution().canCompleteCircuit([1, 2, 3], [1, 2, 4])
+    print(Solution().canCompleteCircuit([1, 2, 3], [3, 2, 1]))
+    print(Solution().canCompleteCircuit([1, 2, 3], [2, 2, 2]))
+    print(Solution().canCompleteCircuit([1, 2, 3], [1, 2, 3]))
+    print(Solution().canCompleteCircuit([1, 2, 3], [1, 2, 4]))
diff --git a/Python/generate-parentheses.py b/Python/generate-parentheses.py
index 2ffcfc194..113f59077 100644
--- a/Python/generate-parentheses.py
+++ b/Python/generate-parentheses.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(4^n / n^(3/2)) ~= Catalan numbers
 # Space: O(n)
 #
@@ -26,4 +27,4 @@ def generateParenthesisRecu(self, result, current, left, right):
             self.generateParenthesisRecu(result, current + ")", left, right - 1)
 
 if __name__ == "__main__":
-    print Solution().generateParenthesis(3)
\ No newline at end of file
+    print(Solution().generateParenthesis(3))
\ No newline at end of file
diff --git a/Python/gray-code.py b/Python/gray-code.py
index f54b9b421..8cd9f0411 100644
--- a/Python/gray-code.py
+++ b/Python/gray-code.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(2^n)
 # Space: O(1)
 
@@ -46,5 +47,5 @@ def grayCode(self, n):
 
 
 if __name__ == "__main__":
-    print Solution().grayCode(0)
-    print Solution().grayCode(2)
+    print(Solution().grayCode(0))
+    print(Solution().grayCode(2))
diff --git a/Python/group-anagrams.py b/Python/group-anagrams.py
index f1a51e789..ade7079f8 100644
--- a/Python/group-anagrams.py
+++ b/Python/group-anagrams.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n * glogg), g is the max size of groups.
 # Space: O(n)
 #
@@ -27,4 +28,4 @@ def groupAnagrams(self, strs):
 
 if __name__ == "__main__":
     result = Solution().groupAnagrams(["cat", "dog", "act", "mac"])
-    print result
+    print(result)
diff --git a/Python/house-robber-ii.py b/Python/house-robber-ii.py
index 5f1b2fbff..fdbe57a29 100644
--- a/Python/house-robber-ii.py
+++ b/Python/house-robber-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -34,4 +35,4 @@ def robRange(self, nums, start, end):
         return num_i
 
 if __name__ == '__main__':
-        print Solution().rob([8,4,8,5,9,6,5,4,4,10])
+        print(Solution().rob([8,4,8,5,9,6,5,4,4,10]))
diff --git a/Python/house-robber.py b/Python/house-robber.py
index d94ae3b53..4dfec5567 100644
--- a/Python/house-robber.py
+++ b/Python/house-robber.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -38,4 +39,4 @@ def rob2(self, nums):
 
 
 if __name__ == '__main__':
-        print Solution().rob([8,4,8,5,9,6,5,4,4,10])
+        print(Solution().rob([8,4,8,5,9,6,5,4,4,10]))
diff --git a/Python/implement-strstr.py b/Python/implement-strstr.py
index 1e7a5919a..b7f812d80 100644
--- a/Python/implement-strstr.py
+++ b/Python/implement-strstr.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n + k)
 # Space: O(k)
 #
@@ -61,5 +62,5 @@ def strStr(self, haystack, needle):
 
 
 if __name__ == "__main__":
-    print Solution().strStr("a", "")
-    print Solution().strStr("abababcdab", "ababcdx")
+    print(Solution().strStr("a", ""))
+    print(Solution().strStr("abababcdab", "ababcdx"))
diff --git a/Python/insert-interval.py b/Python/insert-interval.py
index 33dd83cec..695f19cdd 100644
--- a/Python/insert-interval.py
+++ b/Python/insert-interval.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 
@@ -45,4 +46,4 @@ def insert(self, intervals, newInterval):
 
 
 if __name__ == "__main__":
-    print Solution().insert([Interval(1, 2), Interval(3, 5), Interval(6, 7), Interval(8, 10), Interval(12, 16)], Interval(4, 9))
+    print(Solution().insert([Interval(1, 2), Interval(3, 5), Interval(6, 7), Interval(8, 10), Interval(12, 16)], Interval(4, 9)))
diff --git a/Python/insertion-sort-list.py b/Python/insertion-sort-list.py
index 30a8a7500..d92f95881 100644
--- a/Python/insertion-sort-list.py
+++ b/Python/insertion-sort-list.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n ^ 2)
 # Space: O(1)
 #
@@ -49,4 +50,4 @@ def isSorted(self, head):
     head = ListNode(3)
     head.next = ListNode(2)
     head.next.next = ListNode(1)
-    print Solution().insertionSortList(head)
+    print(Solution().insertionSortList(head))
diff --git a/Python/integer-to-roman.py b/Python/integer-to-roman.py
index 672201a80..1d4e591f9 100644
--- a/Python/integer-to-roman.py
+++ b/Python/integer-to-roman.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -28,5 +29,5 @@ def intToRoman(self, num):
 
 
 if __name__ == "__main__":
-    print Solution().intToRoman(999)
-    print Solution().intToRoman(3999)
+    print(Solution().intToRoman(999))
+    print(Solution().intToRoman(3999))
diff --git a/Python/interleaving-string.py b/Python/interleaving-string.py
index 8e0ff98c6..4c90b3bec 100644
--- a/Python/interleaving-string.py
+++ b/Python/interleaving-string.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(m * n)
 # Space: O(m + n)
 #
@@ -82,6 +83,6 @@ def isInterleaveRecu(self, s1, s2, s3, a, b, c):
         return result
 
 if __name__ == "__main__":
-    print Solution().isInterleave("a", "", "a")
-    print Solution().isInterleave("aabcc", "dbbca", "aadbbcbcac")
-    print Solution().isInterleave("aabcc", "dbbca", "aadbbbaccc")
+    print(Solution().isInterleave("a", "", "a"))
+    print(Solution().isInterleave("aabcc", "dbbca", "aadbbcbcac"))
+    print(Solution().isInterleave("aabcc", "dbbca", "aadbbbaccc"))
diff --git a/Python/jump-game-ii.py b/Python/jump-game-ii.py
index d99f97642..50c30b2dc 100644
--- a/Python/jump-game-ii.py
+++ b/Python/jump-game-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -32,5 +33,5 @@ def jump(self, A):
 
 
 if __name__ == "__main__":
-    print Solution().jump([2,3,1,1,4])
-    print Solution().jump([3,2,1,0,4])
+    print(Solution().jump([2,3,1,1,4]))
+    print(Solution().jump([3,2,1,0,4]))
diff --git a/Python/jump-game.py b/Python/jump-game.py
index de25a28b3..8cd87f9c5 100644
--- a/Python/jump-game.py
+++ b/Python/jump-game.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -24,5 +25,5 @@ def canJump(self, A):
         return reachable >= len(A) - 1
 
 if __name__ == "__main__":
-    print Solution().canJump([2,3,1,1,4])
-    print Solution().canJump([3,2,1,0,4])
\ No newline at end of file
+    print(Solution().canJump([2,3,1,1,4]))
+    print(Solution().canJump([3,2,1,0,4]))
\ No newline at end of file
diff --git a/Python/largest-number.py b/Python/largest-number.py
index 008d5e0e7..c1bd3c1df 100644
--- a/Python/largest-number.py
+++ b/Python/largest-number.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(nlogn)
 # Space: O(1)
 #
@@ -19,4 +20,4 @@ def largestNumber(self, num):
 
 if __name__ == "__main__":
     num = [3, 30, 34, 5, 9]
-    print Solution().largestNumber(num)
+    print(Solution().largestNumber(num))
diff --git a/Python/largest-rectangle-in-histogram.py b/Python/largest-rectangle-in-histogram.py
index 3e4d6fa82..db40803f7 100644
--- a/Python/largest-rectangle-in-histogram.py
+++ b/Python/largest-rectangle-in-histogram.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(n)
 #
@@ -28,6 +29,6 @@ def largestRectangleArea(self, height):
         return area
 
 if __name__ == "__main__":
-    print Solution().largestRectangleArea([2, 0, 2])
-    print Solution().largestRectangleArea([2, 1, 5, 6, 2, 3])
+    print(Solution().largestRectangleArea([2, 0, 2]))
+    print(Solution().largestRectangleArea([2, 1, 5, 6, 2, 3]))
 
diff --git a/Python/length-of-last-word.py b/Python/length-of-last-word.py
index ec1c239e0..8630b312e 100644
--- a/Python/length-of-last-word.py
+++ b/Python/length-of-last-word.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -34,5 +35,5 @@ def lengthOfLastWord(self, s):
         return len(s.strip().split(" ")[-1])
 
 if __name__ == "__main__":
-    print Solution().lengthOfLastWord("Hello World")
-    print Solution2().lengthOfLastWord("")
+    print(Solution().lengthOfLastWord("Hello World"))
+    print(Solution2().lengthOfLastWord(""))
diff --git a/Python/letter-combinations-of-a-phone-number.py b/Python/letter-combinations-of-a-phone-number.py
index ca3d1c347..bc85125db 100644
--- a/Python/letter-combinations-of-a-phone-number.py
+++ b/Python/letter-combinations-of-a-phone-number.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n * 4^n)
 # Space: O(n)
 #
@@ -55,4 +56,4 @@ def letterCombinationsRecu(self, result, digits, lookup, cur, n):
                 self.letterCombinationsRecu(result, digits, lookup, cur + choice, n + 1)
 
 if __name__ == "__main__":
-    print Solution().letterCombinations("23")
+    print(Solution().letterCombinations("23"))
diff --git a/Python/linked-list-cycle-ii.py b/Python/linked-list-cycle-ii.py
index 281e465fc..3cfb64a41 100644
--- a/Python/linked-list-cycle-ii.py
+++ b/Python/linked-list-cycle-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -38,4 +39,4 @@ def detectCycle(self, head):
     head.next = ListNode(2)
     head.next.next = ListNode(3)
     head.next.next.next = head.next
-    print Solution().detectCycle(head)
\ No newline at end of file
+    print(Solution().detectCycle(head))
\ No newline at end of file
diff --git a/Python/linked-list-cycle.py b/Python/linked-list-cycle.py
index 6073a78be..8910df7c1 100644
--- a/Python/linked-list-cycle.py
+++ b/Python/linked-list-cycle.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -29,4 +30,4 @@ def hasCycle(self, head):
     head.next = ListNode(2)
     head.next.next = ListNode(3)
     head.next.next.next = head.next
-    print Solution().hasCycle(head)
\ No newline at end of file
+    print(Solution().hasCycle(head))
\ No newline at end of file
diff --git a/Python/longest-common-prefix.py b/Python/longest-common-prefix.py
index f5a918469..a05860d10 100644
--- a/Python/longest-common-prefix.py
+++ b/Python/longest-common-prefix.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n * k), k is the length of the common prefix
 # Space: O(1)
 
@@ -21,4 +22,4 @@ def longestCommonPrefix(self, strs):
 
 
 if __name__ == "__main__":
-    print Solution().longestCommonPrefix(["hello", "heaven", "heavy"])
+    print(Solution().longestCommonPrefix(["hello", "heaven", "heavy"]))
diff --git a/Python/longest-consecutive-sequence.py b/Python/longest-consecutive-sequence.py
index 240b109e0..b8d05a320 100644
--- a/Python/longest-consecutive-sequence.py
+++ b/Python/longest-consecutive-sequence.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(n)
 #
@@ -24,4 +25,4 @@ def longestConsecutive(self, num):
         return result
 
 if __name__ == "__main__":
-    print Solution().longestConsecutive([100, 4, 200, 1, 3, 2])
\ No newline at end of file
+    print(Solution().longestConsecutive([100, 4, 200, 1, 3, 2]))
\ No newline at end of file
diff --git a/Python/longest-palindromic-substring.py b/Python/longest-palindromic-substring.py
index 2621a208d..7eae3f3f2 100644
--- a/Python/longest-palindromic-substring.py
+++ b/Python/longest-palindromic-substring.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(n)
 #
@@ -48,4 +49,4 @@ def preProcess(s):
 
 
 if __name__ == "__main__":
-    print Solution().longestPalindrome("abb")
+    print(Solution().longestPalindrome("abb"))
diff --git a/Python/longest-substring-with-at-most-two-distinct-characters.py b/Python/longest-substring-with-at-most-two-distinct-characters.py
index 0eb42603b..9f9afb8ee 100644
--- a/Python/longest-substring-with-at-most-two-distinct-characters.py
+++ b/Python/longest-substring-with-at-most-two-distinct-characters.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -29,4 +30,4 @@ def lengthOfLongestSubstringTwoDistinct(self, s):
         return longest
 
 if __name__ == "__main__":
-    print Solution().lengthOfLongestSubstringTwoDistinct("eceba")
+    print(Solution().lengthOfLongestSubstringTwoDistinct("eceba"))
diff --git a/Python/longest-substring-without-repeating-characters.py b/Python/longest-substring-without-repeating-characters.py
index 8208f643c..29f7aceaf 100644
--- a/Python/longest-substring-without-repeating-characters.py
+++ b/Python/longest-substring-without-repeating-characters.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -22,4 +23,4 @@ def lengthOfLongestSubstring(self, s):
         return longest
 
 if __name__ == "__main__":
-    print Solution().lengthOfLongestSubstring("abcabcbb")
+    print(Solution().lengthOfLongestSubstring("abcabcbb"))
diff --git a/Python/longest-valid-parentheses.py b/Python/longest-valid-parentheses.py
index 3c8888175..47a503b55 100644
--- a/Python/longest-valid-parentheses.py
+++ b/Python/longest-valid-parentheses.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -53,5 +54,5 @@ def longestValidParentheses(self, s):
         return longest
 
 if __name__ == "__main__":
-    print Solution().longestValidParentheses("()")
-    print Solution().longestValidParentheses(")()())")
+    print(Solution().longestValidParentheses("()"))
+    print(Solution().longestValidParentheses(")()())"))
diff --git a/Python/lru-cache.py b/Python/lru-cache.py
index 9913918fc..25e02e3de 100644
--- a/Python/lru-cache.py
+++ b/Python/lru-cache.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(1), per operation.
 # Space: O(k), k is the capacity of cache.
 
@@ -121,7 +122,7 @@ def put(self, key, value):
     cache.set(1, 1)
     cache.set(2, 2)
     cache.set(3, 3)
-    print cache.get(1)
+    print(cache.get(1))
     cache.set(4, 4)
-    print cache.get(2)
+    print(cache.get(2))
 
diff --git a/Python/majority-element.py b/Python/majority-element.py
index 2f39c0403..d4fc73781 100644
--- a/Python/majority-element.py
+++ b/Python/majority-element.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -35,4 +36,4 @@ def majorityElement2(self, nums):
         return sorted(collections.Counter(nums).items(), key=lambda a: a[1], reverse=True)[0][0]
 
 if __name__ == "__main__":
-    print Solution().majorityElement([1, 2, 3, 4, 5, 5, 5, 5, 5, 5, 6])
\ No newline at end of file
+    print(Solution().majorityElement([1, 2, 3, 4, 5, 5, 5, 5, 5, 5, 6]))
\ No newline at end of file
diff --git a/Python/max-points-on-a-line.py b/Python/max-points-on-a-line.py
index 79467c9a3..7655881d1 100644
--- a/Python/max-points-on-a-line.py
+++ b/Python/max-points-on-a-line.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n^2)
 # Space: O(n)
 #
@@ -41,4 +42,4 @@ def maxPoints(self, points):
         return max_points
 
 if __name__ == "__main__":
-    print Solution().maxPoints([Point(), Point(), Point()])
+    print(Solution().maxPoints([Point(), Point(), Point()]))
diff --git a/Python/maximal-rectangle.py b/Python/maximal-rectangle.py
index f4f7f374f..5d7754c37 100644
--- a/Python/maximal-rectangle.py
+++ b/Python/maximal-rectangle.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n^2)
 # Space: O(n)
 
@@ -86,4 +87,4 @@ def maximalRectangle(self, matrix):
               "11110",
               "11111",
               "00000"]
-    print Solution().maximalRectangle(matrix)
+    print(Solution().maximalRectangle(matrix))
diff --git a/Python/maximum-depth-of-binary-tree.py b/Python/maximum-depth-of-binary-tree.py
index 2889d824a..b0d4292d0 100644
--- a/Python/maximum-depth-of-binary-tree.py
+++ b/Python/maximum-depth-of-binary-tree.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(h), h is height of binary tree
 #
@@ -27,4 +28,4 @@ def maxDepth(self, root):
     root.left = TreeNode(2)
     root.right = TreeNode(3)
     root.left.left = TreeNode(4)
-    print Solution().maxDepth(root)
+    print(Solution().maxDepth(root))
diff --git a/Python/maximum-gap.py b/Python/maximum-gap.py
index 06d771637..5dd4b7ccc 100644
--- a/Python/maximum-gap.py
+++ b/Python/maximum-gap.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(n)
 
@@ -79,4 +80,4 @@ def maximumGap(self, nums):
 
 
 if __name__ == "__main__":
-    print Solution().maximumGap([3, 1, 1, 1, 5, 5, 5, 5])
+    print(Solution().maximumGap([3, 1, 1, 1, 5, 5, 5, 5]))
diff --git a/Python/maximum-product-subarray.py b/Python/maximum-product-subarray.py
index cf502bd5f..b776fb259 100644
--- a/Python/maximum-product-subarray.py
+++ b/Python/maximum-product-subarray.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -31,5 +32,5 @@ def maxProduct(self, A):
         return global_max
 
 if __name__ == "__main__":
-    print Solution().maxProduct([2, 3, -2, 4])
-    print Solution().maxProduct([-4,-3])
\ No newline at end of file
+    print(Solution().maxProduct([2, 3, -2, 4]))
+    print(Solution().maxProduct([-4,-3]))
\ No newline at end of file
diff --git a/Python/maximum-subarray.py b/Python/maximum-subarray.py
index 07a0fcafe..de9a3a4b1 100644
--- a/Python/maximum-subarray.py
+++ b/Python/maximum-subarray.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -28,4 +29,4 @@ def maxSubArray(self, nums):
 
 
 if __name__ == "__main__":
-    print Solution().maxSubArray([-2,1,-3,4,-1,2,1,-5,4])
+    print(Solution().maxSubArray([-2,1,-3,4,-1,2,1,-5,4]))
diff --git a/Python/median-of-two-sorted-arrays.py b/Python/median-of-two-sorted-arrays.py
index a5d2e957e..5e8c460b5 100644
--- a/Python/median-of-two-sorted-arrays.py
+++ b/Python/median-of-two-sorted-arrays.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(log(min(m, n)))
 # Space: O(1)
 
@@ -121,7 +122,7 @@ def findMedianSortedArrays(self, A, B):
             return C[indexM2] / 1.0
 
 if __name__ == "__main__":
-    print Solution().findMedianSortedArrays([1, 3, 5, 7], [2, 4, 6])
-    print Solution_Generic().findMedianSortedArrays([1, 3, 5], [2, 4, 6])
-    print Solution_3().findMedianSortedArrays([1, 3, 5], [2, 4, 6])
+    print(Solution().findMedianSortedArrays([1, 3, 5, 7], [2, 4, 6]))
+    print(Solution_Generic().findMedianSortedArrays([1, 3, 5], [2, 4, 6]))
+    print(Solution_3().findMedianSortedArrays([1, 3, 5], [2, 4, 6]))
 
diff --git a/Python/merge-intervals.py b/Python/merge-intervals.py
index 1e279e4d6..dad170b34 100644
--- a/Python/merge-intervals.py
+++ b/Python/merge-intervals.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(nlogn)
 # Space: O(1)
 #
@@ -38,4 +39,4 @@ def merge(self, intervals):
 
 
 if __name__ == "__main__":
-    print Solution().merge([Interval(1, 3), Interval(2, 6), Interval(8, 10), Interval(15,18)])
+    print(Solution().merge([Interval(1, 3), Interval(2, 6), Interval(8, 10), Interval(15,18)]))
diff --git a/Python/merge-k-sorted-lists.py b/Python/merge-k-sorted-lists.py
index 0acffe1af..37b677712 100644
--- a/Python/merge-k-sorted-lists.py
+++ b/Python/merge-k-sorted-lists.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(nlogk)
 # Space: O(1)
 
@@ -111,4 +112,4 @@ def mergeKLists(self, lists):
     list2 = ListNode(2)
     list2.next = ListNode(4)
 
-    print Solution().mergeKLists([list1, list2])
+    print(Solution().mergeKLists([list1, list2]))
diff --git a/Python/merge-sorted-array.py b/Python/merge-sorted-array.py
index b8ace9bb5..411451fc0 100644
--- a/Python/merge-sorted-array.py
+++ b/Python/merge-sorted-array.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -33,7 +34,7 @@ def merge(self, A, m, B, n):
     A = [1, 3, 5, 0, 0, 0, 0]
     B = [2, 4, 6, 7]
     Solution().merge(A, 3, B, 4)
-    print A
+    print(A)
 
 
 # Time:  O(n)
diff --git a/Python/merge-two-sorted-lists.py b/Python/merge-two-sorted-lists.py
index c94df5a8b..26c2ec5c5 100644
--- a/Python/merge-two-sorted-lists.py
+++ b/Python/merge-two-sorted-lists.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -41,6 +42,6 @@ def mergeTwoLists(self, l1, l2):
     l1.next = ListNode(1)
     l2 = ListNode (2)
     l2.next = ListNode(3)
-    print Solution().mergeTwoLists(l1, l2)
+    print(Solution().mergeTwoLists(l1, l2))
 
 
diff --git a/Python/minimum-depth-of-binary-tree.py b/Python/minimum-depth-of-binary-tree.py
index 709093e51..5421138ce 100644
--- a/Python/minimum-depth-of-binary-tree.py
+++ b/Python/minimum-depth-of-binary-tree.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(h), h is height of binary tree
 #
@@ -28,4 +29,4 @@ def minDepth(self, root):
 if __name__ == "__main__":
     root = TreeNode(1)
     root.left = TreeNode(2)
-    print Solution().minDepth(root)
+    print(Solution().minDepth(root))
diff --git a/Python/minimum-path-sum.py b/Python/minimum-path-sum.py
index af07387ca..cedfa2733 100644
--- a/Python/minimum-path-sum.py
+++ b/Python/minimum-path-sum.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(m * n)
 # Space: O(m + n)
 #
@@ -23,8 +24,8 @@ def minPathSum(self, grid):
         return sum[-1]
 
 if __name__ == "__main__":
-    print Solution().minPathSum([[0,1]
-                                ,[1,0]])
-    print Solution().minPathSum([[1,3,1]
+    print(Solution().minPathSum([[0,1]
+                                ,[1,0]]))
+    print(Solution().minPathSum([[1,3,1]
                                 ,[1,5,1]
-                                ,[4,2,1]])
\ No newline at end of file
+                                ,[4,2,1]]))
\ No newline at end of file
diff --git a/Python/minimum-window-substring.py b/Python/minimum-window-substring.py
index d70f8c212..3936f8c74 100644
--- a/Python/minimum-window-substring.py
+++ b/Python/minimum-window-substring.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(k), k is the number of different characters
 
@@ -53,4 +54,4 @@ def minWindow(self, s, t):
 
 
 if __name__ == "__main__":
-    print Solution().minWindow("ADOBECODEBANC", "ABC")
+    print(Solution().minWindow("ADOBECODEBANC", "ABC"))
diff --git a/Python/missing-ranges.py b/Python/missing-ranges.py
index 16f3a36a5..3af0ae2c5 100644
--- a/Python/missing-ranges.py
+++ b/Python/missing-ranges.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -38,4 +39,4 @@ def getRange(lower, upper):
 
 
 if __name__ == "__main__":
-    print Solution().findMissingRanges([0, 1, 3, 50, 75], 0, 99)
+    print(Solution().findMissingRanges([0, 1, 3, 50, 75], 0, 99))
diff --git a/Python/move-zeroes.py b/Python/move-zeroes.py
index 410eb8ffe..26caf64dd 100644
--- a/Python/move-zeroes.py
+++ b/Python/move-zeroes.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 
@@ -52,4 +53,4 @@ def moveZeroes(self, nums):
 if __name__ == '__main__':
     s = Solution()
     r = s.moveZeroes([0, 1, 0, 3, 12])
-    print r
+    print(r)
diff --git a/Python/multiply-strings.py b/Python/multiply-strings.py
index cfb6d12d8..fd4fdeb90 100644
--- a/Python/multiply-strings.py
+++ b/Python/multiply-strings.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(m * n)
 # Space: O(m + n)
 #
@@ -42,4 +43,4 @@ def multiply(self, num1, num2):
 
 
 if __name__ == "__main__":
-    print Solution().multiply("123", "1000")
+    print(Solution().multiply("123", "1000"))
diff --git a/Python/n-queens-ii.py b/Python/n-queens-ii.py
index ee48742e4..0c5c76c14 100644
--- a/Python/n-queens-ii.py
+++ b/Python/n-queens-ii.py
@@ -1,3 +1,5 @@
+from __future__ import print_function
+from functools import reduce
 # Time:  O(n!)
 # Space: O(n)
 #
@@ -42,4 +44,4 @@ def totalNQueensRecu(self, solution, row, n):
         return result
 
 if __name__ == "__main__":
-    print Solution().totalNQueens(8)
+    print(Solution().totalNQueens(8))
diff --git a/Python/n-queens.py b/Python/n-queens.py
index 6140a2e53..c510ca966 100644
--- a/Python/n-queens.py
+++ b/Python/n-queens.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n!)
 # Space: O(n)
 
@@ -78,4 +79,4 @@ def dfs(col_per_row, xy_diff, xy_sum):
 
 
 if __name__ == "__main__":
-    print Solution().solveNQueens(8)
+    print(Solution().solveNQueens(8))
diff --git a/Python/next-permutation.py b/Python/next-permutation.py
index def9a572d..4384fd7ea 100644
--- a/Python/next-permutation.py
+++ b/Python/next-permutation.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -36,8 +37,8 @@ def nextPermutation(self, num):
 if __name__ == "__main__":
     num = [1, 4, 3, 2]
     Solution().nextPermutation(num)
-    print num
+    print(num)
     Solution().nextPermutation(num)
-    print num
+    print(num)
     Solution().nextPermutation(num)
-    print num
+    print(num)
diff --git a/Python/number-of-1-bits.py b/Python/number-of-1-bits.py
index 065c5db7c..099a184fc 100644
--- a/Python/number-of-1-bits.py
+++ b/Python/number-of-1-bits.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logn) = O(32)
 # Space: O(1)
 #
@@ -18,4 +19,4 @@ def hammingWeight(self, n):
         return result
 
 if __name__ == '__main__':
-  print Solution().hammingWeight(11)
+  print(Solution().hammingWeight(11))
diff --git a/Python/one-edit-distance.py b/Python/one-edit-distance.py
index 25a54f523..cb61cdd9e 100644
--- a/Python/one-edit-distance.py
+++ b/Python/one-edit-distance.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(m + n)
 # Space: O(1)
 #
@@ -29,4 +30,4 @@ def isOneEditDistance(self, s, t):
 
 
 if __name__ == "__main__":
-    print Solution().isOneEditDistance("teacher", "acher")
+    print(Solution().isOneEditDistance("teacher", "acher"))
diff --git a/Python/palindrome-number.py b/Python/palindrome-number.py
index 91a16269b..df81686eb 100644
--- a/Python/palindrome-number.py
+++ b/Python/palindrome-number.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(1)
 # Space: O(1)
 #
@@ -29,6 +30,6 @@ def isPalindrome(self, x):
         return x == reverse
 
 if __name__ == "__main__":
-    print Solution().isPalindrome(12321)
-    print Solution().isPalindrome(12320)
-    print Solution().isPalindrome(-12321)
+    print(Solution().isPalindrome(12321))
+    print(Solution().isPalindrome(12320))
+    print(Solution().isPalindrome(-12321))
diff --git a/Python/palindrome-partitioning-ii.py b/Python/palindrome-partitioning-ii.py
index 192c6f0de..173eeab03 100644
--- a/Python/palindrome-partitioning-ii.py
+++ b/Python/palindrome-partitioning-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n^2)
 # Space: O(n^2)
 #
@@ -25,4 +26,4 @@ def minCut(self, s):
         return mincut[0]
 
 if __name__ == "__main__":
-    print Solution().minCut("aab")
\ No newline at end of file
+    print(Solution().minCut("aab"))
\ No newline at end of file
diff --git a/Python/palindrome-partitioning.py b/Python/palindrome-partitioning.py
index 49bec0641..640c6a208 100644
--- a/Python/palindrome-partitioning.py
+++ b/Python/palindrome-partitioning.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n^2 ~ 2^n)
 # Space: O(n^2)
 #
@@ -67,4 +68,4 @@ def isPalindrome(self, s):
         return True
 
 if __name__ == "__main__":
-    print Solution().partition("aab")
+    print(Solution().partition("aab"))
diff --git a/Python/partition-list.py b/Python/partition-list.py
index 076f277b8..48d7b74c5 100644
--- a/Python/partition-list.py
+++ b/Python/partition-list.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -49,5 +50,5 @@ def partition(self, head, x):
     head.next.next.next = ListNode(2)
     head.next.next.next.next = ListNode(5)
     head.next.next.next.next.next = ListNode(2)
-    print Solution().partition(head, 3)
+    print(Solution().partition(head, 3))
 
diff --git a/Python/pascals-triangle-ii.py b/Python/pascals-triangle-ii.py
index d5aff1748..0b9eaf12d 100644
--- a/Python/pascals-triangle-ii.py
+++ b/Python/pascals-triangle-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n^2)
 # Space: O(1)
 
@@ -63,4 +64,4 @@ def getRow(self, rowIndex):
 
 
 if __name__ == "__main__":
-    print Solution().getRow(3)
+    print(Solution().getRow(3))
diff --git a/Python/pascals-triangle.py b/Python/pascals-triangle.py
index 14194cc75..a4d915625 100644
--- a/Python/pascals-triangle.py
+++ b/Python/pascals-triangle.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n^2)
 # Space: O(1)
 #
@@ -57,4 +58,4 @@ def add(nums):
         return res
 
 if __name__ == "__main__":
-    print Solution().generate(5)
+    print(Solution().generate(5))
diff --git a/Python/path-sum-ii.py b/Python/path-sum-ii.py
index 03a2fbf3a..c92886f74 100644
--- a/Python/path-sum-ii.py
+++ b/Python/path-sum-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(h), h is height of binary tree
 #
@@ -51,4 +52,4 @@ def pathSumRecu(self, result, cur, root, sum):
 if __name__ == "__main__":
     root = TreeNode(5)
 
-    print Solution().pathSum(root, 5)
+    print(Solution().pathSum(root, 5))
diff --git a/Python/path-sum.py b/Python/path-sum.py
index 70040766d..7f9a11fb6 100644
--- a/Python/path-sum.py
+++ b/Python/path-sum.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(h), h is height of binary tree
 #
@@ -42,4 +43,4 @@ def hasPathSum(self, root, sum):
     root.right = TreeNode(8)
     root.left.left = TreeNode(11)
     root.left.left.right = TreeNode(2)
-    print Solution().hasPathSum(root, 22)
+    print(Solution().hasPathSum(root, 22))
diff --git a/Python/permutation-sequence.py b/Python/permutation-sequence.py
index 9382f662c..488f38d61 100644
--- a/Python/permutation-sequence.py
+++ b/Python/permutation-sequence.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n^2)
 # Space: O(n)
 
@@ -39,4 +40,4 @@ def getPermutation(self, n, k):
 
 
 if __name__ == "__main__":
-    print Solution().getPermutation(3, 2)
+    print(Solution().getPermutation(3, 2))
diff --git a/Python/permutations-ii.py b/Python/permutations-ii.py
index 17a03fd77..d6ee2f737 100644
--- a/Python/permutations-ii.py
+++ b/Python/permutations-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n * n!)
 # Space: O(n)
 #
@@ -52,7 +53,7 @@ def permuteUnique(self, nums):
         return solutions
 
 if __name__ == "__main__":
-    print Solution().permuteUnique([1, 1, 2])
-    print Solution().permuteUnique([1, -1, 1, 2, -1, 2, 2, -1])
+    print(Solution().permuteUnique([1, 1, 2]))
+    print(Solution().permuteUnique([1, -1, 1, 2, -1, 2, 2, -1]))
 
 
diff --git a/Python/permutations.py b/Python/permutations.py
index 0a56829ca..5e3887f62 100644
--- a/Python/permutations.py
+++ b/Python/permutations.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n * n!)
 # Space: O(n)
 #
@@ -31,5 +32,5 @@ def permuteRecu(self, result, used, cur, num):
                 used[i] = False
 
 if __name__ == "__main__":
-    print Solution().permute([1, 2, 3])
+    print(Solution().permute([1, 2, 3]))
 
diff --git a/Python/plus-one.py b/Python/plus-one.py
index d7cfb5fe2..335dcaf53 100644
--- a/Python/plus-one.py
+++ b/Python/plus-one.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 
@@ -42,4 +43,4 @@ def plusOne(self, digits):
 
 
 if __name__ == "__main__":
-    print Solution().plusOne([9, 9, 9, 9])
+    print(Solution().plusOne([9, 9, 9, 9]))
diff --git a/Python/populating-next-right-pointers-in-each-node-ii.py b/Python/populating-next-right-pointers-in-each-node-ii.py
index 2029f3293..d0d4049cb 100644
--- a/Python/populating-next-right-pointers-in-each-node-ii.py
+++ b/Python/populating-next-right-pointers-in-each-node-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -70,6 +71,6 @@ def connect(self, root):
     root, root.left, root.right = TreeNode(1), TreeNode(2), TreeNode(3)
     root.left.left, root.left.right, root.right.right = TreeNode(4), TreeNode(5), TreeNode(7)
     Solution().connect(root)
-    print root
-    print root.left
-    print root.left.left
+    print(root)
+    print(root.left)
+    print(root.left.left)
diff --git a/Python/populating-next-right-pointers-in-each-node.py b/Python/populating-next-right-pointers-in-each-node.py
index 54d7a63fc..a23163646 100644
--- a/Python/populating-next-right-pointers-in-each-node.py
+++ b/Python/populating-next-right-pointers-in-each-node.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -78,7 +79,7 @@ def connect(self, root):
     root, root.left, root.right = TreeNode(1), TreeNode(2), TreeNode(3)
     root.left.left, root.left.right, root.right.left, root.right.right = TreeNode(4), TreeNode(5), TreeNode(6), TreeNode(7)
     Solution().connect(root)
-    print root
-    print root.left
-    print root.left.left
+    print(root)
+    print(root.left)
+    print(root.left.left)
 
diff --git a/Python/powx-n.py b/Python/powx-n.py
index a787cfd82..59711eb4a 100644
--- a/Python/powx-n.py
+++ b/Python/powx-n.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logn) = O(1)
 # Space: O(1)
 
@@ -44,5 +45,5 @@ def myPow(self, x, n):
 
 
 if __name__ == "__main__":
-    print Solution().pow(3, 5)
-    print Solution().pow(3, -5)
+    print(Solution().pow(3, 5))
+    print(Solution().pow(3, -5))
diff --git a/Python/queue-reconstruction-by-height.py b/Python/queue-reconstruction-by-height.py
index afd5f76cd..844da51c4 100644
--- a/Python/queue-reconstruction-by-height.py
+++ b/Python/queue-reconstruction-by-height.py
@@ -24,7 +24,7 @@ def reconstructQueue(self, people):
         :type people: List[List[int]]
         :rtype: List[List[int]]
         """
-        people.sort(key=lambda (h, k): (-h, k))
+        people.sort(key=lambda h_k: (-h_k[0], h_k[1]))
 
         blocks = [[]]
         for p in people:
@@ -51,7 +51,7 @@ def reconstructQueue(self, people):
         :type people: List[List[int]]
         :rtype: List[List[int]]
         """
-        people.sort(key=lambda (h, k): (-h, k))
+        people.sort(key=lambda h_k1: (-h_k1[0], h_k1[1]))
         result = []
         for p in people:
             result.insert(p[1], p)
diff --git a/Python/read-n-characters-given-read4-ii-call-multiple-times.py b/Python/read-n-characters-given-read4-ii-call-multiple-times.py
index 70dccb689..d5e474d15 100644
--- a/Python/read-n-characters-given-read4-ii-call-multiple-times.py
+++ b/Python/read-n-characters-given-read4-ii-call-multiple-times.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -64,5 +65,5 @@ def read(self, buf, n):
     sol = Solution()
     buf = ['' for _ in xrange(100)]
     file_content = "ab"
-    print buf[:sol.read(buf, 1)]
-    print buf[:sol.read(buf, 2)]
+    print(buf[:sol.read(buf, 1)])
+    print(buf[:sol.read(buf, 2)])
diff --git a/Python/read-n-characters-given-read4.py b/Python/read-n-characters-given-read4.py
index 2c754e9f7..5799c9b8d 100644
--- a/Python/read-n-characters-given-read4.py
+++ b/Python/read-n-characters-given-read4.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -49,6 +50,6 @@ def read(self, buf, n):
     global file_content
     buf = ['' for _ in xrange(100)]
     file_content = "a"
-    print buf[:Solution().read(buf, 9)]
+    print(buf[:Solution().read(buf, 9)])
     file_content = "abcdefghijklmnop"
-    print buf[:Solution().read(buf, 9)]
+    print(buf[:Solution().read(buf, 9)])
diff --git a/Python/recover-binary-search-tree.py b/Python/recover-binary-search-tree.py
index 073967d9e..478a0ebf8 100644
--- a/Python/recover-binary-search-tree.py
+++ b/Python/recover-binary-search-tree.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -85,5 +86,5 @@ def detectBroken(self, broken, pre, cur):
 if __name__ == "__main__":
     root = TreeNode(0)
     root.left = TreeNode(1)
-    print root
-    print Solution().recoverTree(root)
+    print(root)
+    print(Solution().recoverTree(root))
diff --git a/Python/regular-expression-matching.py b/Python/regular-expression-matching.py
index ef240b84a..8c8fb812e 100644
--- a/Python/regular-expression-matching.py
+++ b/Python/regular-expression-matching.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(m * n)
 # Space: O(n)
 #
@@ -120,12 +121,12 @@ def isMatch(self, s, p):
             return self.isMatch(s, p[2:])
 
 if __name__ == "__main__":
-    print Solution3().isMatch("abab", "a*b*")
-    print Solution().isMatch("aaaaaaaaaaaaab", "a*a*a*a*a*a*a*a*a*a*c")
-    print Solution().isMatch("aa","a")
-    print Solution().isMatch("aa","aa")
-    print Solution().isMatch("aaa","aa")
-    print Solution().isMatch("aa", "a*")
-    print Solution().isMatch("aa", ".*")
-    print Solution().isMatch("ab", ".*")
-    print Solution().isMatch("aab", "c*a*b")
+    print(Solution3().isMatch("abab", "a*b*"))
+    print(Solution().isMatch("aaaaaaaaaaaaab", "a*a*a*a*a*a*a*a*a*a*c"))
+    print(Solution().isMatch("aa","a"))
+    print(Solution().isMatch("aa","aa"))
+    print(Solution().isMatch("aaa","aa"))
+    print(Solution().isMatch("aa", "a*"))
+    print(Solution().isMatch("aa", ".*"))
+    print(Solution().isMatch("ab", ".*"))
+    print(Solution().isMatch("aab", "c*a*b"))
diff --git a/Python/remove-duplicates-from-sorted-array-ii.py b/Python/remove-duplicates-from-sorted-array-ii.py
index 104161e0a..80fb570d1 100644
--- a/Python/remove-duplicates-from-sorted-array-ii.py
+++ b/Python/remove-duplicates-from-sorted-array-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -28,4 +29,4 @@ def removeDuplicates(self, A):
         return last + 1
 
 if __name__ == "__main__":
-    print Solution().removeDuplicates([1, 1, 1, 2, 2, 3])
+    print(Solution().removeDuplicates([1, 1, 1, 2, 2, 3]))
diff --git a/Python/remove-duplicates-from-sorted-list-ii.py b/Python/remove-duplicates-from-sorted-list-ii.py
index 9d4d364be..c0088c186 100644
--- a/Python/remove-duplicates-from-sorted-list-ii.py
+++ b/Python/remove-duplicates-from-sorted-list-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -45,5 +46,5 @@ def deleteDuplicates(self, head):
     head, head.next, head.next.next = ListNode(1), ListNode(2), ListNode(3)
     head.next.next.next, head.next.next.next.next = ListNode(3), ListNode(4)
     head.next.next.next.next.next, head.next.next.next.next.next.next = ListNode(4), ListNode(5)
-    print Solution().deleteDuplicates(head)
+    print(Solution().deleteDuplicates(head))
 
diff --git a/Python/remove-duplicates-from-sorted-list.py b/Python/remove-duplicates-from-sorted-list.py
index 1eda2ef1c..dc29c5e2c 100644
--- a/Python/remove-duplicates-from-sorted-list.py
+++ b/Python/remove-duplicates-from-sorted-list.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -49,4 +50,4 @@ def deleteDuplicates2(self, head):
 if __name__ == "__main__":
     head, head.next, head.next.next = ListNode(1), ListNode(1), ListNode(2)
     head.next.next.next, head.next.next.next.next = ListNode(3), ListNode(3)
-    print Solution().deleteDuplicates(head)
+    print(Solution().deleteDuplicates(head))
diff --git a/Python/remove-element.py b/Python/remove-element.py
index edb0f237b..0f6a3b18c 100644
--- a/Python/remove-element.py
+++ b/Python/remove-element.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -21,4 +22,4 @@ def removeElement(self, A, elem):
         return last + 1
 
 if __name__ == "__main__":
-    print Solution().removeElement([1, 2, 3, 4, 5, 2, 2], 2)
\ No newline at end of file
+    print(Solution().removeElement([1, 2, 3, 4, 5, 2, 2], 2))
\ No newline at end of file
diff --git a/Python/remove-nth-node-from-end-of-list.py b/Python/remove-nth-node-from-end-of-list.py
index 637c8c198..a79c34902 100644
--- a/Python/remove-nth-node-from-end-of-list.py
+++ b/Python/remove-nth-node-from-end-of-list.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -49,4 +50,4 @@ def removeNthFromEnd(self, head, n):
     head.next.next.next = ListNode(4)
     head.next.next.next.next = ListNode(5)
 
-    print Solution().removeNthFromEnd(head, 2)
\ No newline at end of file
+    print(Solution().removeNthFromEnd(head, 2))
\ No newline at end of file
diff --git a/Python/reorder-list.py b/Python/reorder-list.py
index 8d5541c83..6db5922c1 100644
--- a/Python/reorder-list.py
+++ b/Python/reorder-list.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -51,4 +52,4 @@ def reorderList(self, head):
     head.next.next = ListNode(3)
     head.next.next.next = ListNode(4)
     head.next.next.next.next = ListNode(5)
-    print Solution().reorderList(head)
\ No newline at end of file
+    print(Solution().reorderList(head))
\ No newline at end of file
diff --git a/Python/repeated-dna-sequences.py b/Python/repeated-dna-sequences.py
index bb9373bfa..bb15174c3 100644
--- a/Python/repeated-dna-sequences.py
+++ b/Python/repeated-dna-sequences.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(n)
 
@@ -45,6 +46,6 @@ def findRepeatedDnaSequences2(self, s):
 
 
 if __name__ == "__main__":
-    print Solution().findRepeatedDnaSequences("AAAAAAAAAA")
-    print Solution().findRepeatedDnaSequences("")
-    print Solution().findRepeatedDnaSequences("AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT")
+    print(Solution().findRepeatedDnaSequences("AAAAAAAAAA"))
+    print(Solution().findRepeatedDnaSequences(""))
+    print(Solution().findRepeatedDnaSequences("AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"))
diff --git a/Python/repeated-substring-pattern.py b/Python/repeated-substring-pattern.py
index b7925f67b..8a158f903 100644
--- a/Python/repeated-substring-pattern.py
+++ b/Python/repeated-substring-pattern.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(n)
 
@@ -55,5 +56,5 @@ def repeatedSubstringPattern2(self, str):
             return False
 
         ss = (str + str)[1:-1]
-        print ss
+        print(ss)
         return ss.find(str) != -1
diff --git a/Python/restore-ip-addresses.py b/Python/restore-ip-addresses.py
index e1e338b64..90d126060 100644
--- a/Python/restore-ip-addresses.py
+++ b/Python/restore-ip-addresses.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n^m) = O(3^4)
 # Space: O(n * m) = O(3 * 4)
 #
@@ -37,4 +38,4 @@ def isValid(self, s):
         return int(s) < 256
 
 if __name__ == "__main__":
-    print Solution().restoreIpAddresses("0000")
+    print(Solution().restoreIpAddresses("0000"))
diff --git a/Python/reverse-bits.py b/Python/reverse-bits.py
index baecdb400..9d33d712b 100644
--- a/Python/reverse-bits.py
+++ b/Python/reverse-bits.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time : O(logn) = O(32)
 # Space: O(1)
 #
@@ -31,4 +32,4 @@ def reverseBits2(self, n):
         return int(string, 2)
 
 if __name__ == '__main__':
-  print Solution().reverseBits(1)
+  print(Solution().reverseBits(1))
diff --git a/Python/reverse-integer.py b/Python/reverse-integer.py
index 8533bbe1c..7c8ae7f46 100644
--- a/Python/reverse-integer.py
+++ b/Python/reverse-integer.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logn) = O(1)
 # Space: O(1)
 #
@@ -53,10 +54,10 @@ def reverse3(self, x):
         :rtype: int
         """
         s = cmp(x, 0)
-        r = int(`s * x`[::-1])
+        r = int(repr(s * x)[::-1])
         return s * r * (r < 2 ** 31)
 
 
 if __name__ == "__main__":
-    print Solution().reverse(123)
-    print Solution().reverse(-321)
+    print(Solution().reverse(123))
+    print(Solution().reverse(-321))
diff --git a/Python/reverse-linked-list-ii.py b/Python/reverse-linked-list-ii.py
index d18404785..42fabb533 100644
--- a/Python/reverse-linked-list-ii.py
+++ b/Python/reverse-linked-list-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -49,4 +50,4 @@ def reverseBetween(self, head, m, n):
     head.next.next = ListNode(3)
     head.next.next.next = ListNode(4)
     head.next.next.next.next = ListNode(5)
-    print Solution().reverseBetween(head, 2, 4)
+    print(Solution().reverseBetween(head, 2, 4))
diff --git a/Python/reverse-linked-list.py b/Python/reverse-linked-list.py
index b000888f2..ae62a1b29 100644
--- a/Python/reverse-linked-list.py
+++ b/Python/reverse-linked-list.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -58,4 +59,4 @@ def reverseListRecu(self, head):
     head.next.next = ListNode(3)
     head.next.next.next = ListNode(4)
     head.next.next.next.next = ListNode(5)
-    print Solution2().reverseList(head)
\ No newline at end of file
+    print(Solution2().reverseList(head))
\ No newline at end of file
diff --git a/Python/reverse-nodes-in-k-group.py b/Python/reverse-nodes-in-k-group.py
index 15f95d5fa..373c7bf94 100644
--- a/Python/reverse-nodes-in-k-group.py
+++ b/Python/reverse-nodes-in-k-group.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -67,4 +68,4 @@ def reverse(self, begin, end):
     head.next.next = ListNode(3)
     head.next.next.next = ListNode(4)
     head.next.next.next.next = ListNode(5)
-    print Solution().reverseKGroup(head, 2)
\ No newline at end of file
+    print(Solution().reverseKGroup(head, 2))
\ No newline at end of file
diff --git a/Python/reverse-words-in-a-string-ii.py b/Python/reverse-words-in-a-string-ii.py
index e87268406..c30b947e3 100644
--- a/Python/reverse-words-in-a-string-ii.py
+++ b/Python/reverse-words-in-a-string-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time: O(n)
 # Space:O(1)
 #
@@ -35,4 +36,4 @@ def reverse(s, begin, end):
 if __name__ == '__main__':
     s = ['h','e','l','l','o', ' ', 'w', 'o', 'r', 'l', 'd']
     Solution().reverseWords(s)
-    print s
+    print(s)
diff --git a/Python/reverse-words-in-a-string.py b/Python/reverse-words-in-a-string.py
index e660e205c..0db120660 100644
--- a/Python/reverse-words-in-a-string.py
+++ b/Python/reverse-words-in-a-string.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(n)
 #
@@ -25,4 +26,4 @@ def reverseWords(self, s):
         return ' '.join(reversed(s.split()))
 
 if __name__ == '__main__':
-    print Solution().reverseWords('hello world')
+    print(Solution().reverseWords('hello world'))
diff --git a/Python/roman-to-integer.py b/Python/roman-to-integer.py
index a5d2d05d9..0a977205d 100644
--- a/Python/roman-to-integer.py
+++ b/Python/roman-to-integer.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -19,5 +20,5 @@ def romanToInt(self, s):
         return decimal
 
 if __name__ == "__main__":
-    print Solution().romanToInt("IIVX")
-    print Solution().romanToInt("MMMCMXCIX")
+    print(Solution().romanToInt("IIVX"))
+    print(Solution().romanToInt("MMMCMXCIX"))
diff --git a/Python/rotate-array.py b/Python/rotate-array.py
index 8e43bff0c..d2822f479 100644
--- a/Python/rotate-array.py
+++ b/Python/rotate-array.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 
@@ -113,4 +114,4 @@ def rotate(self, nums, k):
 if __name__ == '__main__':
     nums = [1, 2, 3, 4, 5, 6, 7]
     Solution().rotate(nums, 3)
-    print nums
+    print(nums)
diff --git a/Python/rotate-image.py b/Python/rotate-image.py
index 648b4c715..25b0f9dba 100644
--- a/Python/rotate-image.py
+++ b/Python/rotate-image.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n^2)
 # Space: O(1)
 #
@@ -39,4 +40,4 @@ def rotate(self, matrix):
 
 if __name__ == "__main__":
     matrix = [[1, 2, 3], [4, 5, 6], [7, 8, 9]]
-    print Solution().rotate(matrix)
+    print(Solution().rotate(matrix))
diff --git a/Python/rotate-list.py b/Python/rotate-list.py
index 59ecb567e..717ab0bdc 100644
--- a/Python/rotate-list.py
+++ b/Python/rotate-list.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -49,4 +50,4 @@ def rotateRight(self, head, k):
     head.next.next = ListNode(3)
     head.next.next.next = ListNode(4)
     head.next.next.next.next = ListNode(5)
-    print Solution().rotateRight(head, 2)
+    print(Solution().rotateRight(head, 2))
diff --git a/Python/same-tree.py b/Python/same-tree.py
index 6418ffc0e..d89114b14 100644
--- a/Python/same-tree.py
+++ b/Python/same-tree.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(h), h is height of binary tree
 #
@@ -29,4 +30,4 @@ def isSameTree(self, p, q):
 if __name__ == "__main__":
     root1, root1.left, root1.right = TreeNode(1), TreeNode(2), TreeNode(3)
     root2, root2.left, root2.right = TreeNode(1), TreeNode(2), TreeNode(3)
-    print Solution().isSameTree(root1, root2)
+    print(Solution().isSameTree(root1, root2))
diff --git a/Python/scramble-string.py b/Python/scramble-string.py
index 2627135af..ad0b9e8e6 100644
--- a/Python/scramble-string.py
+++ b/Python/scramble-string.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n^4)
 # Space: O(n^3)
 #
@@ -67,4 +68,4 @@ def isScramble(self, s1, s2):
         return result[n][0][0]
 
 if __name__ == "__main__":
-    print Solution().isScramble("rgtae", "great")
+    print(Solution().isScramble("rgtae", "great"))
diff --git a/Python/search-a-2d-matrix.py b/Python/search-a-2d-matrix.py
index 793894f2a..dec6cbbf2 100644
--- a/Python/search-a-2d-matrix.py
+++ b/Python/search-a-2d-matrix.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logm + logn)
 # Space: O(1)
 #
@@ -41,4 +42,4 @@ def searchMatrix(self, matrix, target):
 
 if __name__ == "__main__":
     matrix = [[1, 3, 5, 7], [10, 11, 16, 20], [23, 30, 34, 50]]
-    print Solution().searchMatrix(matrix, 3)
+    print(Solution().searchMatrix(matrix, 3))
diff --git a/Python/search-for-a-range.py b/Python/search-for-a-range.py
index 9d3ad9766..81a53c10f 100644
--- a/Python/search-for-a-range.py
+++ b/Python/search-for-a-range.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logn)
 # Space: O(1)
 #
@@ -59,5 +60,5 @@ def binarySearch3(self, compare, nums, target):
 
 
 if __name__ == "__main__":
-    print Solution().searchRange([2, 2], 3)
-    print Solution().searchRange([5, 7, 7, 8, 8, 10], 8)
+    print(Solution().searchRange([2, 2], 3))
+    print(Solution().searchRange([5, 7, 7, 8, 8, 10], 8))
diff --git a/Python/search-in-rotated-sorted-array-ii.py b/Python/search-in-rotated-sorted-array-ii.py
index 43a607f05..f3215fa5e 100644
--- a/Python/search-in-rotated-sorted-array-ii.py
+++ b/Python/search-in-rotated-sorted-array-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logn)
 # Space: O(1)
 #
@@ -35,6 +36,6 @@ def search(self, nums, target):
 
 
 if __name__ == "__main__":
-    print Solution().search([3, 5, 1], 3)
-    print Solution().search([2, 2, 3, 3, 4, 1], 1)
-    print Solution().search([4, 4, 5, 6, 7, 0, 1, 2], 5)
+    print(Solution().search([3, 5, 1], 3))
+    print(Solution().search([2, 2, 3, 3, 4, 1], 1))
+    print(Solution().search([4, 4, 5, 6, 7, 0, 1, 2], 5))
diff --git a/Python/search-in-rotated-sorted-array.py b/Python/search-in-rotated-sorted-array.py
index 4c93474b0..45b30445c 100644
--- a/Python/search-in-rotated-sorted-array.py
+++ b/Python/search-in-rotated-sorted-array.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logn)
 # Space: O(1)
 #
@@ -34,6 +35,6 @@ def search(self, nums, target):
 
 
 if __name__ == "__main__":
-    print Solution().search([3, 5, 1], 3)
-    print Solution().search([1], 1)
-    print Solution().search([4, 5, 6, 7, 0, 1, 2], 5)
+    print(Solution().search([3, 5, 1], 3))
+    print(Solution().search([1], 1))
+    print(Solution().search([4, 5, 6, 7, 0, 1, 2], 5))
diff --git a/Python/search-insert-position.py b/Python/search-insert-position.py
index 89b3f18de..4c31609c2 100644
--- a/Python/search-insert-position.py
+++ b/Python/search-insert-position.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logn)
 # Space: O(1)
 #
@@ -33,7 +34,7 @@ def searchInsert(self, nums, target):
 
 
 if __name__ == "__main__":
-    print Solution().searchInsert([1, 3, 5, 6], 5)
-    print Solution().searchInsert([1, 3, 5, 6], 2)
-    print Solution().searchInsert([1, 3, 5, 6], 7)
-    print Solution().searchInsert([1, 3, 5, 6], 0)
+    print(Solution().searchInsert([1, 3, 5, 6], 5))
+    print(Solution().searchInsert([1, 3, 5, 6], 2))
+    print(Solution().searchInsert([1, 3, 5, 6], 7))
+    print(Solution().searchInsert([1, 3, 5, 6], 0))
diff --git a/Python/set-intersection-size-at-least-two.py b/Python/set-intersection-size-at-least-two.py
index 571b8ddd5..94cf0517d 100644
--- a/Python/set-intersection-size-at-least-two.py
+++ b/Python/set-intersection-size-at-least-two.py
@@ -33,7 +33,7 @@ def intersectionSizeTwo(self, intervals):
         :type intervals: List[List[int]]
         :rtype: int
         """
-        intervals.sort(key = lambda(s, e): (s, -e))
+        intervals.sort(key = lambda s_e: (s_e[0], -s_e[1]))
         cnts = [2] * len(intervals)
         result = 0
         while intervals:
diff --git a/Python/set-matrix-zeroes.py b/Python/set-matrix-zeroes.py
index 4a08ded96..af8226320 100644
--- a/Python/set-matrix-zeroes.py
+++ b/Python/set-matrix-zeroes.py
@@ -1,3 +1,5 @@
+from __future__ import print_function
+from functools import reduce
 # Time:  O(m * n)
 # Space: O(1)
 #
@@ -41,4 +43,4 @@ def setZeroes(self, matrix):
              , [1, 1, 1, 0]
              , [1, 1, 1, 1]]
     Solution().setZeroes(matrix)
-    print matrix
\ No newline at end of file
+    print(matrix)
\ No newline at end of file
diff --git a/Python/simplify-path.py b/Python/simplify-path.py
index 532b544c1..6d06133fa 100644
--- a/Python/simplify-path.py
+++ b/Python/simplify-path.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(n)
 #
@@ -28,5 +29,5 @@ def simplifyPath(self, path):
         return "/" + "/".join(stack)
 
 if __name__ == "__main__":
-    print Solution().simplifyPath("/../")
-    print Solution().simplifyPath("/home//foo/")
\ No newline at end of file
+    print(Solution().simplifyPath("/../"))
+    print(Solution().simplifyPath("/home//foo/"))
\ No newline at end of file
diff --git a/Python/single-number-ii.py b/Python/single-number-ii.py
index 586b80c30..6e1e91f1f 100644
--- a/Python/single-number-ii.py
+++ b/Python/single-number-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -61,4 +62,4 @@ def singleNumber(self, A):
         return two
 
 if __name__ == "__main__":
-    print Solution().singleNumber([1, 1, 1, 2, 2, 2, 3])
+    print(Solution().singleNumber([1, 1, 1, 2, 2, 2, 3]))
diff --git a/Python/single-number.py b/Python/single-number.py
index 742ea9c09..e48062ebd 100644
--- a/Python/single-number.py
+++ b/Python/single-number.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -8,6 +9,7 @@
 #
 
 import operator
+from functools import reduce
 
 
 class Solution:
@@ -19,4 +21,4 @@ def singleNumber(self, A):
         return reduce(operator.xor, A)
 
 if __name__ == '__main__':
-    print Solution().singleNumber([1, 1, 2, 2, 3])
+    print(Solution().singleNumber([1, 1, 2, 2, 3]))
diff --git a/Python/sort-colors.py b/Python/sort-colors.py
index 9a7b2b8dd..dc3e519af 100644
--- a/Python/sort-colors.py
+++ b/Python/sort-colors.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -44,4 +45,4 @@ def triPartition(nums, target):
 if __name__ == "__main__":
     A = [2, 1, 1, 0, 0, 2]
     Solution().sortColors(A)
-    print A
+    print(A)
diff --git a/Python/sort-list.py b/Python/sort-list.py
index d01ed7f56..7a2749efc 100644
--- a/Python/sort-list.py
+++ b/Python/sort-list.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(nlogn)
 # Space: O(logn) for stack call
 #
@@ -53,4 +54,4 @@ def mergeTwoLists(self, l1, l2):
     head.next = ListNode(4)
     head.next.next = ListNode(1)
     head.next.next.next= ListNode(2)
-    print Solution().sortList(head)
+    print(Solution().sortList(head))
diff --git a/Python/spiral-matrix-ii.py b/Python/spiral-matrix-ii.py
index d23da6b19..5244cb820 100644
--- a/Python/spiral-matrix-ii.py
+++ b/Python/spiral-matrix-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n^2)
 # Space: O(1)
 #
@@ -42,5 +43,5 @@ def generateMatrix(self, n):
 
 
 if __name__ == "__main__":
-    print Solution().generateMatrix(3)
-    print Solution().generateMatrix(8)
+    print(Solution().generateMatrix(3))
+    print(Solution().generateMatrix(8))
diff --git a/Python/spiral-matrix.py b/Python/spiral-matrix.py
index 1e0734fe1..78e4df195 100644
--- a/Python/spiral-matrix.py
+++ b/Python/spiral-matrix.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(m * n)
 # Space: O(1)
 #
@@ -41,7 +42,7 @@ def spiralOrder(self, matrix):
 
 
 if __name__ == "__main__":
-    print Solution().spiralOrder([[ 1, 2, 3 ],
+    print(Solution().spiralOrder([[ 1, 2, 3 ],
                                   [ 4, 5, 6 ],
-                                  [ 7, 8, 9 ]])
-    print Solution().spiralOrder([[2,3]])
\ No newline at end of file
+                                  [ 7, 8, 9 ]]))
+    print(Solution().spiralOrder([[2,3]]))
\ No newline at end of file
diff --git a/Python/sqrtx.py b/Python/sqrtx.py
index 05296b789..fce6acc1b 100644
--- a/Python/sqrtx.py
+++ b/Python/sqrtx.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(logn)
 # Space: O(1)
 
@@ -26,5 +27,5 @@ def mySqrt(self, x):
 
 
 if __name__ == "__main__":
-    print Solution().mySqrt(10)
+    print(Solution().mySqrt(10))
 
diff --git a/Python/subsets-ii.py b/Python/subsets-ii.py
index ebd20f0bb..3c7199d83 100644
--- a/Python/subsets-ii.py
+++ b/Python/subsets-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n * 2^n)
 # Space: O(1)
 
@@ -84,4 +85,4 @@ def subsetsWithDupRecu(self, result, cur, nums):
 
 
 if __name__ == "__main__":
-    print Solution().subsetsWithDup([1, 2, 2])
+    print(Solution().subsetsWithDup([1, 2, 2]))
diff --git a/Python/subsets.py b/Python/subsets.py
index 83ba120db..952f4ad48 100644
--- a/Python/subsets.py
+++ b/Python/subsets.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n * 2^n)
 # Space: O(1)
 
@@ -77,4 +78,4 @@ def subsetsRecu(self, cur, nums):
 
 
 if __name__ == "__main__":
-    print Solution().subsets([1, 2, 3])
+    print(Solution().subsets([1, 2, 3]))
diff --git a/Python/substring-with-concatenation-of-all-words.py b/Python/substring-with-concatenation-of-all-words.py
index f56813378..4d12bdbf9 100644
--- a/Python/substring-with-concatenation-of-all-words.py
+++ b/Python/substring-with-concatenation-of-all-words.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O((m + n) * k), where m is string length, n is dictionary size, k is word length
 # Space: O(n * k)
 
@@ -95,4 +96,4 @@ def findSubstring(self, s, words):
 
 
 if __name__ == "__main__":
-    print Solution().findSubstring("barfoothefoobarman", ["foo", "bar"])
+    print(Solution().findSubstring("barfoothefoobarman", ["foo", "bar"]))
diff --git a/Python/sum-root-to-leaf-numbers.py b/Python/sum-root-to-leaf-numbers.py
index faad48bff..2c1a71365 100644
--- a/Python/sum-root-to-leaf-numbers.py
+++ b/Python/sum-root-to-leaf-numbers.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(h), h is height of binary tree
 #
@@ -44,4 +45,4 @@ def sumNumbersRecu(self, root, num):
     root = TreeNode(1)
     root.left = TreeNode(2)
     root.right = TreeNode(3)
-    print Solution().sumNumbers(root)
+    print(Solution().sumNumbers(root))
diff --git a/Python/summary-ranges.py b/Python/summary-ranges.py
index 6bdddb9f2..b8bded7ee 100644
--- a/Python/summary-ranges.py
+++ b/Python/summary-ranges.py
@@ -42,5 +42,5 @@ class Solution2:
     # @param {integer[]} nums
     # @return {string[]}
     def summaryRanges(self, nums):
-        return [re.sub('->.*>', '->', '->'.join(`n` for _, n in g))
-            for _, g in itertools.groupby(enumerate(nums), lambda (i, n): n-i)]
+        return [re.sub('->.*>', '->', '->'.join(repr(n) for _, n in g))
+            for _, g in itertools.groupby(enumerate(nums), lambda i_n: i_n[1]-i_n[0])]
diff --git a/Python/surrounded-regions.py b/Python/surrounded-regions.py
index e586a1acc..6178ac2d5 100644
--- a/Python/surrounded-regions.py
+++ b/Python/surrounded-regions.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(m * n)
 # Space: O(m + n)
 #
@@ -61,4 +62,4 @@ def solve(self, board):
              ['X', 'X', 'O', 'X'],
              ['X', 'O', 'X', 'X']]
     Solution().solve(board)
-    print board
+    print(board)
diff --git a/Python/swap-nodes-in-pairs.py b/Python/swap-nodes-in-pairs.py
index 91c039f8f..73ca8fc63 100644
--- a/Python/swap-nodes-in-pairs.py
+++ b/Python/swap-nodes-in-pairs.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -38,4 +39,4 @@ def swapPairs(self, head):
 if __name__ == "__main__":
     head = ListNode(1)
     head.next, head.next.next, head.next.next.next = ListNode(2), ListNode(3), ListNode(4)
-    print Solution().swapPairs(head)
+    print(Solution().swapPairs(head))
diff --git a/Python/symmetric-tree.py b/Python/symmetric-tree.py
index 3bc99e50b..1b361f336 100644
--- a/Python/symmetric-tree.py
+++ b/Python/symmetric-tree.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(h), h is height of binary tree
 # Given a binary tree, check whether it is a mirror of itself (ie, symmetric around its center).
@@ -76,5 +77,5 @@ def isSymmetricRecu(self, left, right):
     root.left, root.right = TreeNode(2), TreeNode(2)
     root.left.left, root.right.right = TreeNode(3), TreeNode(3)
     root.left.right, root.right.left = TreeNode(4), TreeNode(4)
-    print Solution().isSymmetric(root)
+    print(Solution().isSymmetric(root))
 
diff --git a/Python/text-justification.py b/Python/text-justification.py
index ccc5ab439..bc9c9b4da 100644
--- a/Python/text-justification.py
+++ b/Python/text-justification.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(k), k is maxWidth.
 #
@@ -67,4 +68,4 @@ def connect(words, maxWidth, begin, end, length, is_last):
 
 
 if __name__ == "__main__":
-    print Solution().fullJustify(["This", "is", "an", "example", "of", "text", "justification."], 16)
+    print(Solution().fullJustify(["This", "is", "an", "example", "of", "text", "justification."], 16))
diff --git a/Python/trapping-rain-water.py b/Python/trapping-rain-water.py
index 28a0a7e41..09b40444e 100644
--- a/Python/trapping-rain-water.py
+++ b/Python/trapping-rain-water.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -59,4 +60,4 @@ def trap(self, A):
         return result
 
 if __name__ == "__main__":
-    print Solution().trap([0, 1, 0, 2, 1, 0, 1, 3, 2, 1, 2, 1])
+    print(Solution().trap([0, 1, 0, 2, 1, 0, 1, 3, 2, 1, 2, 1]))
diff --git a/Python/triangle.py b/Python/triangle.py
index 7d2b541f6..836c42f4d 100644
--- a/Python/triangle.py
+++ b/Python/triangle.py
@@ -1,3 +1,5 @@
+from __future__ import print_function
+from functools import reduce
 # Time:  O(m * n)
 # Space: O(n)
 #
@@ -34,5 +36,5 @@ def minimumTotal(self, triangle):
         return reduce(min, cur)
 
 if __name__ == "__main__":
-    print Solution().minimumTotal([[-1], [2, 3], [1, -1, -3]])
+    print(Solution().minimumTotal([[-1], [2, 3], [1, -1, -3]]))
 
diff --git a/Python/two-sum-ii-input-array-is-sorted.py b/Python/two-sum-ii-input-array-is-sorted.py
index 8ac26f965..356476b00 100644
--- a/Python/two-sum-ii-input-array-is-sorted.py
+++ b/Python/two-sum-ii-input-array-is-sorted.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -28,4 +29,4 @@ def twoSum(self, nums, target):
                 return [start + 1, end + 1]
 
 if __name__ == "__main__":
-    print Solution().twoSum([2, 7, 11, 15], 9)
+    print(Solution().twoSum([2, 7, 11, 15], 9))
diff --git a/Python/two-sum-iii-data-structure-design.py b/Python/two-sum-iii-data-structure-design.py
index 05bf1c555..55d1ae7aa 100644
--- a/Python/two-sum-iii-data-structure-design.py
+++ b/Python/two-sum-iii-data-structure-design.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(n)
 
@@ -51,5 +52,5 @@ def find(self, value):
         Sol.add(i)
 
     for i in (4, 7):
-        print Sol.find(i)
+        print(Sol.find(i))
 
diff --git a/Python/unique-binary-search-trees-ii.py b/Python/unique-binary-search-trees-ii.py
index 1b031830e..ddda4ba7f 100644
--- a/Python/unique-binary-search-trees-ii.py
+++ b/Python/unique-binary-search-trees-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(4^n / n^(3/2)) ~= Catalan numbers
 # Space: O(4^n / n^(3/2)) ~= Catalan numbers
 #
@@ -66,4 +67,4 @@ def generateTreesRecu(self, low, high):
         return result
 
 if __name__ == "__main__":
-    print Solution().generateTrees(3)
\ No newline at end of file
+    print(Solution().generateTrees(3))
\ No newline at end of file
diff --git a/Python/unique-binary-search-trees.py b/Python/unique-binary-search-trees.py
index 61d446f51..bad28ae88 100644
--- a/Python/unique-binary-search-trees.py
+++ b/Python/unique-binary-search-trees.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -47,4 +48,4 @@ def numTrees(self, n):
         return counts[-1]
 
 if __name__ == "__main__":
-    print Solution().numTrees(3)
+    print(Solution().numTrees(3))
diff --git a/Python/unique-paths-ii.py b/Python/unique-paths-ii.py
index bbe3507b1..4ed5a8108 100644
--- a/Python/unique-paths-ii.py
+++ b/Python/unique-paths-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(m * n)
 # Space: O(m + n)
 #
@@ -48,4 +49,4 @@ def uniquePathsWithObstacles(self, obstacleGrid):
                       [0,1,0],
                       [0,0,0]
                    ]
-    print Solution().uniquePathsWithObstacles(obstacleGrid)
+    print(Solution().uniquePathsWithObstacles(obstacleGrid))
diff --git a/Python/unique-paths.py b/Python/unique-paths.py
index 5bfaefa32..efe228e3c 100644
--- a/Python/unique-paths.py
+++ b/Python/unique-paths.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(m * n)
 # Space: O(m + n)
 #
@@ -25,4 +26,4 @@ def uniquePaths(self, m, n):
         return ways[n - 1]
 
 if __name__ == "__main__":
-    print Solution().uniquePaths(1, 2)
+    print(Solution().uniquePaths(1, 2))
diff --git a/Python/valid-number.py b/Python/valid-number.py
index 047584ba4..1630ec0c6 100644
--- a/Python/valid-number.py
+++ b/Python/valid-number.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -73,8 +74,8 @@ def isNumber(self, s):
 
 
 if __name__ == "__main__":
-    print Solution().isNumber(" 0.1 ")
-    print Solution().isNumber("abc")
-    print Solution().isNumber("1 a")
-    print Solution().isNumber("2e10")
+    print(Solution().isNumber(" 0.1 "))
+    print(Solution().isNumber("abc"))
+    print(Solution().isNumber("1 a"))
+    print(Solution().isNumber("2e10"))
 
diff --git a/Python/valid-palindrome.py b/Python/valid-palindrome.py
index fbbcf7f0f..d3db6552e 100644
--- a/Python/valid-palindrome.py
+++ b/Python/valid-palindrome.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -29,4 +30,4 @@ def isPalindrome(self, s):
         return True
 
 if __name__ == "__main__":
-    print Solution().isPalindrome("A man, a plan, a canal: Panama")
+    print(Solution().isPalindrome("A man, a plan, a canal: Panama"))
diff --git a/Python/valid-parentheses.py b/Python/valid-parentheses.py
index 3d9d03781..0569e43e9 100644
--- a/Python/valid-parentheses.py
+++ b/Python/valid-parentheses.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(n)
 #
@@ -20,5 +21,5 @@ def isValid(self, s):
         return len(stack) == 0
 
 if __name__ == "__main__":
-    print Solution().isValid("()[]{}")
-    print Solution().isValid("()[{]}")
\ No newline at end of file
+    print(Solution().isValid("()[]{}"))
+    print(Solution().isValid("()[{]}"))
\ No newline at end of file
diff --git a/Python/valid-sudoku.py b/Python/valid-sudoku.py
index 24f9feb39..243aa4683 100644
--- a/Python/valid-sudoku.py
+++ b/Python/valid-sudoku.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(9^2)
 # Space: O(9)
 
@@ -45,4 +46,4 @@ def isValidList(self, xs):
              ['.', '.', '.', '.', '.', '.', 7, '.', '.'],
              ['.', '.', '.', '.', '.', '.', '.', 8, '.'],
              ['.', '.', '.', '.', '.', '.', '.', '.', 9]]
-    print Solution().isValidSudoku(board)
+    print(Solution().isValidSudoku(board))
diff --git a/Python/validate-binary-search-tree.py b/Python/validate-binary-search-tree.py
index d37799d21..2ef06fb87 100644
--- a/Python/validate-binary-search-tree.py
+++ b/Python/validate-binary-search-tree.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -68,4 +69,4 @@ def isValidBSTRecu(self, root, low, high):
     root = TreeNode(2)
     root.left = TreeNode(1)
     root.right = TreeNode(3)
-    print Solution().isValidBST(root)
+    print(Solution().isValidBST(root))
diff --git a/Python/wildcard-matching.py b/Python/wildcard-matching.py
index f98db3e20..9d62f3271 100644
--- a/Python/wildcard-matching.py
+++ b/Python/wildcard-matching.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(m + n)
 # Space: O(1)
 #
@@ -114,12 +115,12 @@ def isMatch(self, s, p):
             return self.isMatch(s, p[1:])
 
 if __name__ == "__main__":
-    print Solution().isMatch("aaaabaaaab","a*b*b")
-    print Solution().isMatch("aaaaaaaaaaaaab", "a*a*a*a*a*a*a*a*a*a*c")
-    print Solution().isMatch("aa","a")
-    print Solution().isMatch("aa","aa")
-    print Solution().isMatch("aaa","aa")
-    print Solution().isMatch("aa", "a*")
-    print Solution().isMatch("aa", "?*")
-    print Solution().isMatch("ab", "?*")
-    print Solution().isMatch("aab", "c*a*b")
+    print(Solution().isMatch("aaaabaaaab","a*b*b"))
+    print(Solution().isMatch("aaaaaaaaaaaaab", "a*a*a*a*a*a*a*a*a*a*c"))
+    print(Solution().isMatch("aa","a"))
+    print(Solution().isMatch("aa","aa"))
+    print(Solution().isMatch("aaa","aa"))
+    print(Solution().isMatch("aa", "a*"))
+    print(Solution().isMatch("aa", "?*"))
+    print(Solution().isMatch("ab", "?*"))
+    print(Solution().isMatch("aab", "c*a*b"))
diff --git a/Python/word-break-ii.py b/Python/word-break-ii.py
index e23c7ec25..804778b3e 100644
--- a/Python/word-break-ii.py
+++ b/Python/word-break-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n * l^2 + n * r), l is the max length of the words,
 #                            r is the number of the results.
 # Space: O(n^2)
@@ -53,4 +54,4 @@ def wordBreakHelper(self, s, valid, start, path, result):
 
 
 if __name__ == "__main__":
-    print Solution().wordBreak("catsanddog", ["cat", "cats", "and", "sand", "dog"])
+    print(Solution().wordBreak("catsanddog", ["cat", "cats", "and", "sand", "dog"]))
diff --git a/Python/word-break.py b/Python/word-break.py
index 5955525de..0bbc5c266 100644
--- a/Python/word-break.py
+++ b/Python/word-break.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n * l^2)
 # Space: O(n)
 
@@ -35,4 +36,4 @@ def wordBreak(self, s, wordDict):
 
 
 if __name__ == "__main__":
-    print Solution().wordBreak("leetcode", ["leet", "code"])
+    print(Solution().wordBreak("leetcode", ["leet", "code"]))
diff --git a/Python/word-ladder-ii.py b/Python/word-ladder-ii.py
index 7edc61b1c..e6475bfe6 100644
--- a/Python/word-ladder-ii.py
+++ b/Python/word-ladder-ii.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n * d), n is length of string, d is size of dictionary
 # Space: O(d)
 #
@@ -62,4 +63,4 @@ def backtrack(self, result, trace, path, word):
                 self.backtrack(result, trace, [word] + path, prev)
 
 if __name__ == "__main__":
-    print Solution().findLadders("hit", "cog", set(["hot","dot","dog","lot","log"]))
+    print(Solution().findLadders("hit", "cog", set(["hot","dot","dog","lot","log"])))
diff --git a/Python/word-ladder.py b/Python/word-ladder.py
index ff2b0cb70..db057c541 100644
--- a/Python/word-ladder.py
+++ b/Python/word-ladder.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n * d), n is length of string, d is size of dictionary
 # Space: O(d)
 #
@@ -50,5 +51,5 @@ def ladderLength(self, beginWord, endWord, wordList):
 
 
 if __name__ == "__main__":
-    print Solution().ladderLength("hit", "cog", set(["hot", "dot", "dog", "lot", "log"]))
-    print Solution().ladderLength("hit", "cog", set(["hot", "dot", "dog", "lot", "log", "cog"]))
+    print(Solution().ladderLength("hit", "cog", set(["hot", "dot", "dog", "lot", "log"])))
+    print(Solution().ladderLength("hit", "cog", set(["hot", "dot", "dog", "lot", "log", "cog"])))
diff --git a/Python/word-search.py b/Python/word-search.py
index 719540086..4dfe9763a 100644
--- a/Python/word-search.py
+++ b/Python/word-search.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(m * n * l)
 # Space: O(l)
 #
@@ -56,6 +57,6 @@ def existRecu(self, board, word, cur, i, j, visited):
               "SFCS",
               "ADEE"
             ]
-    print Solution().exist(board, "ABCCED")
-    print Solution().exist(board, "SFCS")
-    print Solution().exist(board, "ABCB")
+    print(Solution().exist(board, "ABCCED"))
+    print(Solution().exist(board, "SFCS"))
+    print(Solution().exist(board, "ABCB"))
diff --git a/Python/zigzag-conversion.py b/Python/zigzag-conversion.py
index 5a1d04cee..aec60f9b0 100644
--- a/Python/zigzag-conversion.py
+++ b/Python/zigzag-conversion.py
@@ -1,3 +1,4 @@
+from __future__ import print_function
 # Time:  O(n)
 # Space: O(1)
 #
@@ -32,4 +33,4 @@ def convert(self, s, numRows):
         return zigzag
 
 if __name__ == "__main__":
-    print Solution().convert("PAYPALISHIRING", 3)
+    print(Solution().convert("PAYPALISHIRING", 3))