diff --git a/404.html b/404.html index 86e63442..c60ea810 100644 --- a/404.html +++ b/404.html @@ -12,7 +12,7 @@ - + @@ -20,7 +20,7 @@ - + @@ -362,20 +362,18 @@ - - -
  • + +
  • - -
  • - @@ -636,13 +635,14 @@ + +
  • - @@ -807,13 +807,14 @@ + +
  • - @@ -978,13 +979,14 @@ + +
  • - @@ -1182,7 +1184,7 @@

    404 - Not found

    - + diff --git a/about/index.html b/about/index.html index fb21109f..02d58d56 100644 --- a/about/index.html +++ b/about/index.html @@ -14,7 +14,7 @@ - + @@ -22,7 +22,7 @@ - + @@ -373,20 +373,18 @@ - - -
  • + +
  • - -
  • - @@ -647,13 +646,14 @@ + +
  • - @@ -818,13 +818,14 @@ + +
  • - @@ -989,13 +990,14 @@ + +
  • - @@ -1314,7 +1316,7 @@

    Statistics

    - + diff --git a/assets/javascripts/bundle.1e8ae164.min.js b/assets/javascripts/bundle.1e8ae164.min.js new file mode 100644 index 00000000..21297988 --- /dev/null +++ b/assets/javascripts/bundle.1e8ae164.min.js @@ -0,0 +1,29 @@ +"use strict";(()=>{var _i=Object.create;var br=Object.defineProperty;var Ai=Object.getOwnPropertyDescriptor;var Ci=Object.getOwnPropertyNames,Ft=Object.getOwnPropertySymbols,ki=Object.getPrototypeOf,vr=Object.prototype.hasOwnProperty,eo=Object.prototype.propertyIsEnumerable;var Zr=(e,t,r)=>t in e?br(e,t,{enumerable:!0,configurable:!0,writable:!0,value:r}):e[t]=r,F=(e,t)=>{for(var r in t||(t={}))vr.call(t,r)&&Zr(e,r,t[r]);if(Ft)for(var r of Ft(t))eo.call(t,r)&&Zr(e,r,t[r]);return e};var to=(e,t)=>{var r={};for(var o in e)vr.call(e,o)&&t.indexOf(o)<0&&(r[o]=e[o]);if(e!=null&&Ft)for(var o of Ft(e))t.indexOf(o)<0&&eo.call(e,o)&&(r[o]=e[o]);return r};var gr=(e,t)=>()=>(t||e((t={exports:{}}).exports,t),t.exports);var Hi=(e,t,r,o)=>{if(t&&typeof t=="object"||typeof t=="function")for(let n of Ci(t))!vr.call(e,n)&&n!==r&&br(e,n,{get:()=>t[n],enumerable:!(o=Ai(t,n))||o.enumerable});return e};var jt=(e,t,r)=>(r=e!=null?_i(ki(e)):{},Hi(t||!e||!e.__esModule?br(r,"default",{value:e,enumerable:!0}):r,e));var ro=(e,t,r)=>new Promise((o,n)=>{var i=c=>{try{s(r.next(c))}catch(p){n(p)}},a=c=>{try{s(r.throw(c))}catch(p){n(p)}},s=c=>c.done?o(c.value):Promise.resolve(c.value).then(i,a);s((r=r.apply(e,t)).next())});var no=gr((xr,oo)=>{(function(e,t){typeof xr=="object"&&typeof oo!="undefined"?t():typeof define=="function"&&define.amd?define(t):t()})(xr,function(){"use strict";function e(r){var o=!0,n=!1,i=null,a={text:!0,search:!0,url:!0,tel:!0,email:!0,password:!0,number:!0,date:!0,month:!0,week:!0,time:!0,datetime:!0,"datetime-local":!0};function s(C){return!!(C&&C!==document&&C.nodeName!=="HTML"&&C.nodeName!=="BODY"&&"classList"in C&&"contains"in C.classList)}function c(C){var ct=C.type,Ne=C.tagName;return!!(Ne==="INPUT"&&a[ct]&&!C.readOnly||Ne==="TEXTAREA"&&!C.readOnly||C.isContentEditable)}function p(C){C.classList.contains("focus-visible")||(C.classList.add("focus-visible"),C.setAttribute("data-focus-visible-added",""))}function l(C){C.hasAttribute("data-focus-visible-added")&&(C.classList.remove("focus-visible"),C.removeAttribute("data-focus-visible-added"))}function f(C){C.metaKey||C.altKey||C.ctrlKey||(s(r.activeElement)&&p(r.activeElement),o=!0)}function u(C){o=!1}function h(C){s(C.target)&&(o||c(C.target))&&p(C.target)}function w(C){s(C.target)&&(C.target.classList.contains("focus-visible")||C.target.hasAttribute("data-focus-visible-added"))&&(n=!0,window.clearTimeout(i),i=window.setTimeout(function(){n=!1},100),l(C.target))}function A(C){document.visibilityState==="hidden"&&(n&&(o=!0),Z())}function Z(){document.addEventListener("mousemove",J),document.addEventListener("mousedown",J),document.addEventListener("mouseup",J),document.addEventListener("pointermove",J),document.addEventListener("pointerdown",J),document.addEventListener("pointerup",J),document.addEventListener("touchmove",J),document.addEventListener("touchstart",J),document.addEventListener("touchend",J)}function te(){document.removeEventListener("mousemove",J),document.removeEventListener("mousedown",J),document.removeEventListener("mouseup",J),document.removeEventListener("pointermove",J),document.removeEventListener("pointerdown",J),document.removeEventListener("pointerup",J),document.removeEventListener("touchmove",J),document.removeEventListener("touchstart",J),document.removeEventListener("touchend",J)}function J(C){C.target.nodeName&&C.target.nodeName.toLowerCase()==="html"||(o=!1,te())}document.addEventListener("keydown",f,!0),document.addEventListener("mousedown",u,!0),document.addEventListener("pointerdown",u,!0),document.addEventListener("touchstart",u,!0),document.addEventListener("visibilitychange",A,!0),Z(),r.addEventListener("focus",h,!0),r.addEventListener("blur",w,!0),r.nodeType===Node.DOCUMENT_FRAGMENT_NODE&&r.host?r.host.setAttribute("data-js-focus-visible",""):r.nodeType===Node.DOCUMENT_NODE&&(document.documentElement.classList.add("js-focus-visible"),document.documentElement.setAttribute("data-js-focus-visible",""))}if(typeof window!="undefined"&&typeof document!="undefined"){window.applyFocusVisiblePolyfill=e;var t;try{t=new CustomEvent("focus-visible-polyfill-ready")}catch(r){t=document.createEvent("CustomEvent"),t.initCustomEvent("focus-visible-polyfill-ready",!1,!1,{})}window.dispatchEvent(t)}typeof document!="undefined"&&e(document)})});var zr=gr((kt,Vr)=>{/*! + * clipboard.js v2.0.11 + * https://clipboardjs.com/ + * + * Licensed MIT © Zeno Rocha + */(function(t,r){typeof kt=="object"&&typeof Vr=="object"?Vr.exports=r():typeof define=="function"&&define.amd?define([],r):typeof kt=="object"?kt.ClipboardJS=r():t.ClipboardJS=r()})(kt,function(){return function(){var e={686:function(o,n,i){"use strict";i.d(n,{default:function(){return Li}});var a=i(279),s=i.n(a),c=i(370),p=i.n(c),l=i(817),f=i.n(l);function u(D){try{return document.execCommand(D)}catch(M){return!1}}var h=function(M){var O=f()(M);return u("cut"),O},w=h;function A(D){var M=document.documentElement.getAttribute("dir")==="rtl",O=document.createElement("textarea");O.style.fontSize="12pt",O.style.border="0",O.style.padding="0",O.style.margin="0",O.style.position="absolute",O.style[M?"right":"left"]="-9999px";var I=window.pageYOffset||document.documentElement.scrollTop;return O.style.top="".concat(I,"px"),O.setAttribute("readonly",""),O.value=D,O}var Z=function(M,O){var I=A(M);O.container.appendChild(I);var W=f()(I);return u("copy"),I.remove(),W},te=function(M){var O=arguments.length>1&&arguments[1]!==void 0?arguments[1]:{container:document.body},I="";return typeof M=="string"?I=Z(M,O):M instanceof HTMLInputElement&&!["text","search","url","tel","password"].includes(M==null?void 0:M.type)?I=Z(M.value,O):(I=f()(M),u("copy")),I},J=te;function C(D){"@babel/helpers - typeof";return typeof Symbol=="function"&&typeof Symbol.iterator=="symbol"?C=function(O){return typeof O}:C=function(O){return O&&typeof Symbol=="function"&&O.constructor===Symbol&&O!==Symbol.prototype?"symbol":typeof O},C(D)}var ct=function(){var M=arguments.length>0&&arguments[0]!==void 0?arguments[0]:{},O=M.action,I=O===void 0?"copy":O,W=M.container,K=M.target,Ce=M.text;if(I!=="copy"&&I!=="cut")throw new Error('Invalid "action" value, use either "copy" or "cut"');if(K!==void 0)if(K&&C(K)==="object"&&K.nodeType===1){if(I==="copy"&&K.hasAttribute("disabled"))throw new Error('Invalid "target" attribute. Please use "readonly" instead of "disabled" attribute');if(I==="cut"&&(K.hasAttribute("readonly")||K.hasAttribute("disabled")))throw new Error(`Invalid "target" attribute. You can't cut text from elements with "readonly" or "disabled" attributes`)}else throw new Error('Invalid "target" value, use a valid Element');if(Ce)return J(Ce,{container:W});if(K)return I==="cut"?w(K):J(K,{container:W})},Ne=ct;function Pe(D){"@babel/helpers - typeof";return typeof Symbol=="function"&&typeof Symbol.iterator=="symbol"?Pe=function(O){return typeof O}:Pe=function(O){return O&&typeof Symbol=="function"&&O.constructor===Symbol&&O!==Symbol.prototype?"symbol":typeof O},Pe(D)}function xi(D,M){if(!(D instanceof M))throw new TypeError("Cannot call a class as a function")}function Xr(D,M){for(var O=0;O0&&arguments[0]!==void 0?arguments[0]:{};this.action=typeof W.action=="function"?W.action:this.defaultAction,this.target=typeof W.target=="function"?W.target:this.defaultTarget,this.text=typeof W.text=="function"?W.text:this.defaultText,this.container=Pe(W.container)==="object"?W.container:document.body}},{key:"listenClick",value:function(W){var K=this;this.listener=p()(W,"click",function(Ce){return K.onClick(Ce)})}},{key:"onClick",value:function(W){var K=W.delegateTarget||W.currentTarget,Ce=this.action(K)||"copy",It=Ne({action:Ce,container:this.container,target:this.target(K),text:this.text(K)});this.emit(It?"success":"error",{action:Ce,text:It,trigger:K,clearSelection:function(){K&&K.focus(),window.getSelection().removeAllRanges()}})}},{key:"defaultAction",value:function(W){return hr("action",W)}},{key:"defaultTarget",value:function(W){var K=hr("target",W);if(K)return document.querySelector(K)}},{key:"defaultText",value:function(W){return hr("text",W)}},{key:"destroy",value:function(){this.listener.destroy()}}],[{key:"copy",value:function(W){var K=arguments.length>1&&arguments[1]!==void 0?arguments[1]:{container:document.body};return J(W,K)}},{key:"cut",value:function(W){return w(W)}},{key:"isSupported",value:function(){var W=arguments.length>0&&arguments[0]!==void 0?arguments[0]:["copy","cut"],K=typeof W=="string"?[W]:W,Ce=!!document.queryCommandSupported;return K.forEach(function(It){Ce=Ce&&!!document.queryCommandSupported(It)}),Ce}}]),O}(s()),Li=Mi},828:function(o){var n=9;if(typeof Element!="undefined"&&!Element.prototype.matches){var i=Element.prototype;i.matches=i.matchesSelector||i.mozMatchesSelector||i.msMatchesSelector||i.oMatchesSelector||i.webkitMatchesSelector}function a(s,c){for(;s&&s.nodeType!==n;){if(typeof s.matches=="function"&&s.matches(c))return s;s=s.parentNode}}o.exports=a},438:function(o,n,i){var a=i(828);function s(l,f,u,h,w){var A=p.apply(this,arguments);return l.addEventListener(u,A,w),{destroy:function(){l.removeEventListener(u,A,w)}}}function c(l,f,u,h,w){return typeof l.addEventListener=="function"?s.apply(null,arguments):typeof u=="function"?s.bind(null,document).apply(null,arguments):(typeof l=="string"&&(l=document.querySelectorAll(l)),Array.prototype.map.call(l,function(A){return s(A,f,u,h,w)}))}function p(l,f,u,h){return function(w){w.delegateTarget=a(w.target,f),w.delegateTarget&&h.call(l,w)}}o.exports=c},879:function(o,n){n.node=function(i){return i!==void 0&&i instanceof HTMLElement&&i.nodeType===1},n.nodeList=function(i){var a=Object.prototype.toString.call(i);return i!==void 0&&(a==="[object NodeList]"||a==="[object HTMLCollection]")&&"length"in i&&(i.length===0||n.node(i[0]))},n.string=function(i){return typeof i=="string"||i instanceof String},n.fn=function(i){var a=Object.prototype.toString.call(i);return a==="[object Function]"}},370:function(o,n,i){var a=i(879),s=i(438);function c(u,h,w){if(!u&&!h&&!w)throw new Error("Missing required arguments");if(!a.string(h))throw new TypeError("Second argument must be a String");if(!a.fn(w))throw new TypeError("Third argument must be a Function");if(a.node(u))return p(u,h,w);if(a.nodeList(u))return l(u,h,w);if(a.string(u))return f(u,h,w);throw new TypeError("First argument must be a String, HTMLElement, HTMLCollection, or NodeList")}function p(u,h,w){return u.addEventListener(h,w),{destroy:function(){u.removeEventListener(h,w)}}}function l(u,h,w){return Array.prototype.forEach.call(u,function(A){A.addEventListener(h,w)}),{destroy:function(){Array.prototype.forEach.call(u,function(A){A.removeEventListener(h,w)})}}}function f(u,h,w){return s(document.body,u,h,w)}o.exports=c},817:function(o){function n(i){var a;if(i.nodeName==="SELECT")i.focus(),a=i.value;else if(i.nodeName==="INPUT"||i.nodeName==="TEXTAREA"){var s=i.hasAttribute("readonly");s||i.setAttribute("readonly",""),i.select(),i.setSelectionRange(0,i.value.length),s||i.removeAttribute("readonly"),a=i.value}else{i.hasAttribute("contenteditable")&&i.focus();var c=window.getSelection(),p=document.createRange();p.selectNodeContents(i),c.removeAllRanges(),c.addRange(p),a=c.toString()}return a}o.exports=n},279:function(o){function n(){}n.prototype={on:function(i,a,s){var c=this.e||(this.e={});return(c[i]||(c[i]=[])).push({fn:a,ctx:s}),this},once:function(i,a,s){var c=this;function p(){c.off(i,p),a.apply(s,arguments)}return p._=a,this.on(i,p,s)},emit:function(i){var a=[].slice.call(arguments,1),s=((this.e||(this.e={}))[i]||[]).slice(),c=0,p=s.length;for(c;c{"use strict";/*! + * escape-html + * Copyright(c) 2012-2013 TJ Holowaychuk + * Copyright(c) 2015 Andreas Lubbe + * Copyright(c) 2015 Tiancheng "Timothy" Gu + * MIT Licensed + */var Va=/["'&<>]/;qn.exports=za;function za(e){var t=""+e,r=Va.exec(t);if(!r)return t;var o,n="",i=0,a=0;for(i=r.index;i0&&i[i.length-1])&&(p[0]===6||p[0]===2)){r=0;continue}if(p[0]===3&&(!i||p[1]>i[0]&&p[1]=e.length&&(e=void 0),{value:e&&e[o++],done:!e}}};throw new TypeError(t?"Object is not iterable.":"Symbol.iterator is not defined.")}function V(e,t){var r=typeof Symbol=="function"&&e[Symbol.iterator];if(!r)return e;var o=r.call(e),n,i=[],a;try{for(;(t===void 0||t-- >0)&&!(n=o.next()).done;)i.push(n.value)}catch(s){a={error:s}}finally{try{n&&!n.done&&(r=o.return)&&r.call(o)}finally{if(a)throw a.error}}return i}function z(e,t,r){if(r||arguments.length===2)for(var o=0,n=t.length,i;o1||s(u,h)})})}function s(u,h){try{c(o[u](h))}catch(w){f(i[0][3],w)}}function c(u){u.value instanceof ot?Promise.resolve(u.value.v).then(p,l):f(i[0][2],u)}function p(u){s("next",u)}function l(u){s("throw",u)}function f(u,h){u(h),i.shift(),i.length&&s(i[0][0],i[0][1])}}function so(e){if(!Symbol.asyncIterator)throw new TypeError("Symbol.asyncIterator is not defined.");var t=e[Symbol.asyncIterator],r;return t?t.call(e):(e=typeof ue=="function"?ue(e):e[Symbol.iterator](),r={},o("next"),o("throw"),o("return"),r[Symbol.asyncIterator]=function(){return this},r);function o(i){r[i]=e[i]&&function(a){return new Promise(function(s,c){a=e[i](a),n(s,c,a.done,a.value)})}}function n(i,a,s,c){Promise.resolve(c).then(function(p){i({value:p,done:s})},a)}}function k(e){return typeof e=="function"}function pt(e){var t=function(o){Error.call(o),o.stack=new Error().stack},r=e(t);return r.prototype=Object.create(Error.prototype),r.prototype.constructor=r,r}var Wt=pt(function(e){return function(r){e(this),this.message=r?r.length+` errors occurred during unsubscription: +`+r.map(function(o,n){return n+1+") "+o.toString()}).join(` + `):"",this.name="UnsubscriptionError",this.errors=r}});function Ve(e,t){if(e){var r=e.indexOf(t);0<=r&&e.splice(r,1)}}var Ie=function(){function e(t){this.initialTeardown=t,this.closed=!1,this._parentage=null,this._finalizers=null}return e.prototype.unsubscribe=function(){var t,r,o,n,i;if(!this.closed){this.closed=!0;var a=this._parentage;if(a)if(this._parentage=null,Array.isArray(a))try{for(var s=ue(a),c=s.next();!c.done;c=s.next()){var p=c.value;p.remove(this)}}catch(A){t={error:A}}finally{try{c&&!c.done&&(r=s.return)&&r.call(s)}finally{if(t)throw t.error}}else a.remove(this);var l=this.initialTeardown;if(k(l))try{l()}catch(A){i=A instanceof Wt?A.errors:[A]}var f=this._finalizers;if(f){this._finalizers=null;try{for(var u=ue(f),h=u.next();!h.done;h=u.next()){var w=h.value;try{co(w)}catch(A){i=i!=null?i:[],A instanceof Wt?i=z(z([],V(i)),V(A.errors)):i.push(A)}}}catch(A){o={error:A}}finally{try{h&&!h.done&&(n=u.return)&&n.call(u)}finally{if(o)throw o.error}}}if(i)throw new Wt(i)}},e.prototype.add=function(t){var r;if(t&&t!==this)if(this.closed)co(t);else{if(t instanceof e){if(t.closed||t._hasParent(this))return;t._addParent(this)}(this._finalizers=(r=this._finalizers)!==null&&r!==void 0?r:[]).push(t)}},e.prototype._hasParent=function(t){var r=this._parentage;return r===t||Array.isArray(r)&&r.includes(t)},e.prototype._addParent=function(t){var r=this._parentage;this._parentage=Array.isArray(r)?(r.push(t),r):r?[r,t]:t},e.prototype._removeParent=function(t){var r=this._parentage;r===t?this._parentage=null:Array.isArray(r)&&Ve(r,t)},e.prototype.remove=function(t){var r=this._finalizers;r&&Ve(r,t),t instanceof e&&t._removeParent(this)},e.EMPTY=function(){var t=new e;return t.closed=!0,t}(),e}();var Er=Ie.EMPTY;function Dt(e){return e instanceof Ie||e&&"closed"in e&&k(e.remove)&&k(e.add)&&k(e.unsubscribe)}function co(e){k(e)?e():e.unsubscribe()}var ke={onUnhandledError:null,onStoppedNotification:null,Promise:void 0,useDeprecatedSynchronousErrorHandling:!1,useDeprecatedNextContext:!1};var lt={setTimeout:function(e,t){for(var r=[],o=2;o0},enumerable:!1,configurable:!0}),t.prototype._trySubscribe=function(r){return this._throwIfClosed(),e.prototype._trySubscribe.call(this,r)},t.prototype._subscribe=function(r){return this._throwIfClosed(),this._checkFinalizedStatuses(r),this._innerSubscribe(r)},t.prototype._innerSubscribe=function(r){var o=this,n=this,i=n.hasError,a=n.isStopped,s=n.observers;return i||a?Er:(this.currentObservers=null,s.push(r),new Ie(function(){o.currentObservers=null,Ve(s,r)}))},t.prototype._checkFinalizedStatuses=function(r){var o=this,n=o.hasError,i=o.thrownError,a=o.isStopped;n?r.error(i):a&&r.complete()},t.prototype.asObservable=function(){var r=new j;return r.source=this,r},t.create=function(r,o){return new vo(r,o)},t}(j);var vo=function(e){se(t,e);function t(r,o){var n=e.call(this)||this;return n.destination=r,n.source=o,n}return t.prototype.next=function(r){var o,n;(n=(o=this.destination)===null||o===void 0?void 0:o.next)===null||n===void 0||n.call(o,r)},t.prototype.error=function(r){var o,n;(n=(o=this.destination)===null||o===void 0?void 0:o.error)===null||n===void 0||n.call(o,r)},t.prototype.complete=function(){var r,o;(o=(r=this.destination)===null||r===void 0?void 0:r.complete)===null||o===void 0||o.call(r)},t.prototype._subscribe=function(r){var o,n;return(n=(o=this.source)===null||o===void 0?void 0:o.subscribe(r))!==null&&n!==void 0?n:Er},t}(g);var St={now:function(){return(St.delegate||Date).now()},delegate:void 0};var Ot=function(e){se(t,e);function t(r,o,n){r===void 0&&(r=1/0),o===void 0&&(o=1/0),n===void 0&&(n=St);var i=e.call(this)||this;return i._bufferSize=r,i._windowTime=o,i._timestampProvider=n,i._buffer=[],i._infiniteTimeWindow=!0,i._infiniteTimeWindow=o===1/0,i._bufferSize=Math.max(1,r),i._windowTime=Math.max(1,o),i}return t.prototype.next=function(r){var o=this,n=o.isStopped,i=o._buffer,a=o._infiniteTimeWindow,s=o._timestampProvider,c=o._windowTime;n||(i.push(r),!a&&i.push(s.now()+c)),this._trimBuffer(),e.prototype.next.call(this,r)},t.prototype._subscribe=function(r){this._throwIfClosed(),this._trimBuffer();for(var o=this._innerSubscribe(r),n=this,i=n._infiniteTimeWindow,a=n._buffer,s=a.slice(),c=0;c0?e.prototype.requestAsyncId.call(this,r,o,n):(r.actions.push(this),r._scheduled||(r._scheduled=ut.requestAnimationFrame(function(){return r.flush(void 0)})))},t.prototype.recycleAsyncId=function(r,o,n){var i;if(n===void 0&&(n=0),n!=null?n>0:this.delay>0)return e.prototype.recycleAsyncId.call(this,r,o,n);var a=r.actions;o!=null&&((i=a[a.length-1])===null||i===void 0?void 0:i.id)!==o&&(ut.cancelAnimationFrame(o),r._scheduled=void 0)},t}(zt);var yo=function(e){se(t,e);function t(){return e!==null&&e.apply(this,arguments)||this}return t.prototype.flush=function(r){this._active=!0;var o=this._scheduled;this._scheduled=void 0;var n=this.actions,i;r=r||n.shift();do if(i=r.execute(r.state,r.delay))break;while((r=n[0])&&r.id===o&&n.shift());if(this._active=!1,i){for(;(r=n[0])&&r.id===o&&n.shift();)r.unsubscribe();throw i}},t}(qt);var de=new yo(xo);var L=new j(function(e){return e.complete()});function Kt(e){return e&&k(e.schedule)}function _r(e){return e[e.length-1]}function Je(e){return k(_r(e))?e.pop():void 0}function Ae(e){return Kt(_r(e))?e.pop():void 0}function Qt(e,t){return typeof _r(e)=="number"?e.pop():t}var dt=function(e){return e&&typeof e.length=="number"&&typeof e!="function"};function Yt(e){return k(e==null?void 0:e.then)}function Bt(e){return k(e[ft])}function Gt(e){return Symbol.asyncIterator&&k(e==null?void 0:e[Symbol.asyncIterator])}function Jt(e){return new TypeError("You provided "+(e!==null&&typeof e=="object"?"an invalid object":"'"+e+"'")+" where a stream was expected. You can provide an Observable, Promise, ReadableStream, Array, AsyncIterable, or Iterable.")}function Di(){return typeof Symbol!="function"||!Symbol.iterator?"@@iterator":Symbol.iterator}var Xt=Di();function Zt(e){return k(e==null?void 0:e[Xt])}function er(e){return ao(this,arguments,function(){var r,o,n,i;return Ut(this,function(a){switch(a.label){case 0:r=e.getReader(),a.label=1;case 1:a.trys.push([1,,9,10]),a.label=2;case 2:return[4,ot(r.read())];case 3:return o=a.sent(),n=o.value,i=o.done,i?[4,ot(void 0)]:[3,5];case 4:return[2,a.sent()];case 5:return[4,ot(n)];case 6:return[4,a.sent()];case 7:return a.sent(),[3,2];case 8:return[3,10];case 9:return r.releaseLock(),[7];case 10:return[2]}})})}function tr(e){return k(e==null?void 0:e.getReader)}function N(e){if(e instanceof j)return e;if(e!=null){if(Bt(e))return Ni(e);if(dt(e))return Vi(e);if(Yt(e))return zi(e);if(Gt(e))return Eo(e);if(Zt(e))return qi(e);if(tr(e))return Ki(e)}throw Jt(e)}function Ni(e){return new j(function(t){var r=e[ft]();if(k(r.subscribe))return r.subscribe(t);throw new TypeError("Provided object does not correctly implement Symbol.observable")})}function Vi(e){return new j(function(t){for(var r=0;r=2;return function(o){return o.pipe(e?b(function(n,i){return e(n,i,o)}):ce,ye(1),r?Qe(t):jo(function(){return new or}))}}function $r(e){return e<=0?function(){return L}:x(function(t,r){var o=[];t.subscribe(S(r,function(n){o.push(n),e=2,!0))}function le(e){e===void 0&&(e={});var t=e.connector,r=t===void 0?function(){return new g}:t,o=e.resetOnError,n=o===void 0?!0:o,i=e.resetOnComplete,a=i===void 0?!0:i,s=e.resetOnRefCountZero,c=s===void 0?!0:s;return function(p){var l,f,u,h=0,w=!1,A=!1,Z=function(){f==null||f.unsubscribe(),f=void 0},te=function(){Z(),l=u=void 0,w=A=!1},J=function(){var C=l;te(),C==null||C.unsubscribe()};return x(function(C,ct){h++,!A&&!w&&Z();var Ne=u=u!=null?u:r();ct.add(function(){h--,h===0&&!A&&!w&&(f=Pr(J,c))}),Ne.subscribe(ct),!l&&h>0&&(l=new it({next:function(Pe){return Ne.next(Pe)},error:function(Pe){A=!0,Z(),f=Pr(te,n,Pe),Ne.error(Pe)},complete:function(){w=!0,Z(),f=Pr(te,a),Ne.complete()}}),N(C).subscribe(l))})(p)}}function Pr(e,t){for(var r=[],o=2;oe.next(document)),e}function R(e,t=document){return Array.from(t.querySelectorAll(e))}function P(e,t=document){let r=me(e,t);if(typeof r=="undefined")throw new ReferenceError(`Missing element: expected "${e}" to be present`);return r}function me(e,t=document){return t.querySelector(e)||void 0}function Re(){var e,t,r,o;return(o=(r=(t=(e=document.activeElement)==null?void 0:e.shadowRoot)==null?void 0:t.activeElement)!=null?r:document.activeElement)!=null?o:void 0}var la=T(d(document.body,"focusin"),d(document.body,"focusout")).pipe(be(1),q(void 0),m(()=>Re()||document.body),B(1));function vt(e){return la.pipe(m(t=>e.contains(t)),Y())}function Vo(e,t){return T(d(e,"mouseenter").pipe(m(()=>!0)),d(e,"mouseleave").pipe(m(()=>!1))).pipe(t?be(t):ce,q(!1))}function Ue(e){return{x:e.offsetLeft,y:e.offsetTop}}function zo(e){return T(d(window,"load"),d(window,"resize")).pipe(Me(0,de),m(()=>Ue(e)),q(Ue(e)))}function ir(e){return{x:e.scrollLeft,y:e.scrollTop}}function et(e){return T(d(e,"scroll"),d(window,"resize")).pipe(Me(0,de),m(()=>ir(e)),q(ir(e)))}function qo(e,t){if(typeof t=="string"||typeof t=="number")e.innerHTML+=t.toString();else if(t instanceof Node)e.appendChild(t);else if(Array.isArray(t))for(let r of t)qo(e,r)}function E(e,t,...r){let o=document.createElement(e);if(t)for(let n of Object.keys(t))typeof t[n]!="undefined"&&(typeof t[n]!="boolean"?o.setAttribute(n,t[n]):o.setAttribute(n,""));for(let n of r)qo(o,n);return o}function ar(e){if(e>999){let t=+((e-950)%1e3>99);return`${((e+1e-6)/1e3).toFixed(t)}k`}else return e.toString()}function gt(e){let t=E("script",{src:e});return H(()=>(document.head.appendChild(t),T(d(t,"load"),d(t,"error").pipe(v(()=>Ar(()=>new ReferenceError(`Invalid script: ${e}`))))).pipe(m(()=>{}),_(()=>document.head.removeChild(t)),ye(1))))}var Ko=new g,ma=H(()=>typeof ResizeObserver=="undefined"?gt("https://unpkg.com/resize-observer-polyfill"):$(void 0)).pipe(m(()=>new ResizeObserver(e=>{for(let t of e)Ko.next(t)})),v(e=>T(qe,$(e)).pipe(_(()=>e.disconnect()))),B(1));function pe(e){return{width:e.offsetWidth,height:e.offsetHeight}}function Ee(e){return ma.pipe(y(t=>t.observe(e)),v(t=>Ko.pipe(b(({target:r})=>r===e),_(()=>t.unobserve(e)),m(()=>pe(e)))),q(pe(e)))}function xt(e){return{width:e.scrollWidth,height:e.scrollHeight}}function sr(e){let t=e.parentElement;for(;t&&(e.scrollWidth<=t.scrollWidth&&e.scrollHeight<=t.scrollHeight);)t=(e=t).parentElement;return t?e:void 0}var Qo=new g,fa=H(()=>$(new IntersectionObserver(e=>{for(let t of e)Qo.next(t)},{threshold:0}))).pipe(v(e=>T(qe,$(e)).pipe(_(()=>e.disconnect()))),B(1));function yt(e){return fa.pipe(y(t=>t.observe(e)),v(t=>Qo.pipe(b(({target:r})=>r===e),_(()=>t.unobserve(e)),m(({isIntersecting:r})=>r))))}function Yo(e,t=16){return et(e).pipe(m(({y:r})=>{let o=pe(e),n=xt(e);return r>=n.height-o.height-t}),Y())}var cr={drawer:P("[data-md-toggle=drawer]"),search:P("[data-md-toggle=search]")};function Bo(e){return cr[e].checked}function Be(e,t){cr[e].checked!==t&&cr[e].click()}function We(e){let t=cr[e];return d(t,"change").pipe(m(()=>t.checked),q(t.checked))}function ua(e,t){switch(e.constructor){case HTMLInputElement:return e.type==="radio"?/^Arrow/.test(t):!0;case HTMLSelectElement:case HTMLTextAreaElement:return!0;default:return e.isContentEditable}}function da(){return T(d(window,"compositionstart").pipe(m(()=>!0)),d(window,"compositionend").pipe(m(()=>!1))).pipe(q(!1))}function Go(){let e=d(window,"keydown").pipe(b(t=>!(t.metaKey||t.ctrlKey)),m(t=>({mode:Bo("search")?"search":"global",type:t.key,claim(){t.preventDefault(),t.stopPropagation()}})),b(({mode:t,type:r})=>{if(t==="global"){let o=Re();if(typeof o!="undefined")return!ua(o,r)}return!0}),le());return da().pipe(v(t=>t?L:e))}function ve(){return new URL(location.href)}function st(e,t=!1){if(G("navigation.instant")&&!t){let r=E("a",{href:e.href});document.body.appendChild(r),r.click(),r.remove()}else location.href=e.href}function Jo(){return new g}function Xo(){return location.hash.slice(1)}function Zo(e){let t=E("a",{href:e});t.addEventListener("click",r=>r.stopPropagation()),t.click()}function ha(e){return T(d(window,"hashchange"),e).pipe(m(Xo),q(Xo()),b(t=>t.length>0),B(1))}function en(e){return ha(e).pipe(m(t=>me(`[id="${t}"]`)),b(t=>typeof t!="undefined"))}function At(e){let t=matchMedia(e);return nr(r=>t.addListener(()=>r(t.matches))).pipe(q(t.matches))}function tn(){let e=matchMedia("print");return T(d(window,"beforeprint").pipe(m(()=>!0)),d(window,"afterprint").pipe(m(()=>!1))).pipe(q(e.matches))}function Ur(e,t){return e.pipe(v(r=>r?t():L))}function Wr(e,t){return new j(r=>{let o=new XMLHttpRequest;return o.open("GET",`${e}`),o.responseType="blob",o.addEventListener("load",()=>{o.status>=200&&o.status<300?(r.next(o.response),r.complete()):r.error(new Error(o.statusText))}),o.addEventListener("error",()=>{r.error(new Error("Network error"))}),o.addEventListener("abort",()=>{r.complete()}),typeof(t==null?void 0:t.progress$)!="undefined"&&(o.addEventListener("progress",n=>{var i;if(n.lengthComputable)t.progress$.next(n.loaded/n.total*100);else{let a=(i=o.getResponseHeader("Content-Length"))!=null?i:0;t.progress$.next(n.loaded/+a*100)}}),t.progress$.next(5)),o.send(),()=>o.abort()})}function De(e,t){return Wr(e,t).pipe(v(r=>r.text()),m(r=>JSON.parse(r)),B(1))}function rn(e,t){let r=new DOMParser;return Wr(e,t).pipe(v(o=>o.text()),m(o=>r.parseFromString(o,"text/html")),B(1))}function on(e,t){let r=new DOMParser;return Wr(e,t).pipe(v(o=>o.text()),m(o=>r.parseFromString(o,"text/xml")),B(1))}function nn(){return{x:Math.max(0,scrollX),y:Math.max(0,scrollY)}}function an(){return T(d(window,"scroll",{passive:!0}),d(window,"resize",{passive:!0})).pipe(m(nn),q(nn()))}function sn(){return{width:innerWidth,height:innerHeight}}function cn(){return d(window,"resize",{passive:!0}).pipe(m(sn),q(sn()))}function pn(){return Q([an(),cn()]).pipe(m(([e,t])=>({offset:e,size:t})),B(1))}function pr(e,{viewport$:t,header$:r}){let o=t.pipe(X("size")),n=Q([o,r]).pipe(m(()=>Ue(e)));return Q([r,t,n]).pipe(m(([{height:i},{offset:a,size:s},{x:c,y:p}])=>({offset:{x:a.x-c,y:a.y-p+i},size:s})))}function ba(e){return d(e,"message",t=>t.data)}function va(e){let t=new g;return t.subscribe(r=>e.postMessage(r)),t}function ln(e,t=new Worker(e)){let r=ba(t),o=va(t),n=new g;n.subscribe(o);let i=o.pipe(ee(),oe(!0));return n.pipe(ee(),$e(r.pipe(U(i))),le())}var ga=P("#__config"),Et=JSON.parse(ga.textContent);Et.base=`${new URL(Et.base,ve())}`;function we(){return Et}function G(e){return Et.features.includes(e)}function ge(e,t){return typeof t!="undefined"?Et.translations[e].replace("#",t.toString()):Et.translations[e]}function Te(e,t=document){return P(`[data-md-component=${e}]`,t)}function ie(e,t=document){return R(`[data-md-component=${e}]`,t)}function xa(e){let t=P(".md-typeset > :first-child",e);return d(t,"click",{once:!0}).pipe(m(()=>P(".md-typeset",e)),m(r=>({hash:__md_hash(r.innerHTML)})))}function mn(e){if(!G("announce.dismiss")||!e.childElementCount)return L;if(!e.hidden){let t=P(".md-typeset",e);__md_hash(t.innerHTML)===__md_get("__announce")&&(e.hidden=!0)}return H(()=>{let t=new g;return t.subscribe(({hash:r})=>{e.hidden=!0,__md_set("__announce",r)}),xa(e).pipe(y(r=>t.next(r)),_(()=>t.complete()),m(r=>F({ref:e},r)))})}function ya(e,{target$:t}){return t.pipe(m(r=>({hidden:r!==e})))}function fn(e,t){let r=new g;return r.subscribe(({hidden:o})=>{e.hidden=o}),ya(e,t).pipe(y(o=>r.next(o)),_(()=>r.complete()),m(o=>F({ref:e},o)))}function Ct(e,t){return t==="inline"?E("div",{class:"md-tooltip md-tooltip--inline",id:e,role:"tooltip"},E("div",{class:"md-tooltip__inner md-typeset"})):E("div",{class:"md-tooltip",id:e,role:"tooltip"},E("div",{class:"md-tooltip__inner md-typeset"}))}function un(e,t){if(t=t?`${t}_annotation_${e}`:void 0,t){let r=t?`#${t}`:void 0;return E("aside",{class:"md-annotation",tabIndex:0},Ct(t),E("a",{href:r,class:"md-annotation__index",tabIndex:-1},E("span",{"data-md-annotation-id":e})))}else return E("aside",{class:"md-annotation",tabIndex:0},Ct(t),E("span",{class:"md-annotation__index",tabIndex:-1},E("span",{"data-md-annotation-id":e})))}function dn(e){return E("button",{class:"md-clipboard md-icon",title:ge("clipboard.copy"),"data-clipboard-target":`#${e} > code`})}function Dr(e,t){let r=t&2,o=t&1,n=Object.keys(e.terms).filter(c=>!e.terms[c]).reduce((c,p)=>[...c,E("del",null,p)," "],[]).slice(0,-1),i=we(),a=new URL(e.location,i.base);G("search.highlight")&&a.searchParams.set("h",Object.entries(e.terms).filter(([,c])=>c).reduce((c,[p])=>`${c} ${p}`.trim(),""));let{tags:s}=we();return E("a",{href:`${a}`,class:"md-search-result__link",tabIndex:-1},E("article",{class:"md-search-result__article md-typeset","data-md-score":e.score.toFixed(2)},r>0&&E("div",{class:"md-search-result__icon md-icon"}),r>0&&E("h1",null,e.title),r<=0&&E("h2",null,e.title),o>0&&e.text.length>0&&e.text,e.tags&&e.tags.map(c=>{let p=s?c in s?`md-tag-icon md-tag--${s[c]}`:"md-tag-icon":"";return E("span",{class:`md-tag ${p}`},c)}),o>0&&n.length>0&&E("p",{class:"md-search-result__terms"},ge("search.result.term.missing"),": ",...n)))}function hn(e){let t=e[0].score,r=[...e],o=we(),n=r.findIndex(l=>!`${new URL(l.location,o.base)}`.includes("#")),[i]=r.splice(n,1),a=r.findIndex(l=>l.scoreDr(l,1)),...c.length?[E("details",{class:"md-search-result__more"},E("summary",{tabIndex:-1},E("div",null,c.length>0&&c.length===1?ge("search.result.more.one"):ge("search.result.more.other",c.length))),...c.map(l=>Dr(l,1)))]:[]];return E("li",{class:"md-search-result__item"},p)}function bn(e){return E("ul",{class:"md-source__facts"},Object.entries(e).map(([t,r])=>E("li",{class:`md-source__fact md-source__fact--${t}`},typeof r=="number"?ar(r):r)))}function Nr(e){let t=`tabbed-control tabbed-control--${e}`;return E("div",{class:t,hidden:!0},E("button",{class:"tabbed-button",tabIndex:-1,"aria-hidden":"true"}))}function vn(e){return E("div",{class:"md-typeset__scrollwrap"},E("div",{class:"md-typeset__table"},e))}function Ea(e){let t=we(),r=new URL(`../${e.version}/`,t.base);return E("li",{class:"md-version__item"},E("a",{href:`${r}`,class:"md-version__link"},e.title))}function gn(e,t){return e=e.filter(r=>{var o;return!((o=r.properties)!=null&&o.hidden)}),E("div",{class:"md-version"},E("button",{class:"md-version__current","aria-label":ge("select.version")},t.title),E("ul",{class:"md-version__list"},e.map(Ea)))}var wa=0;function Ta(e,t){document.body.append(e);let{width:r}=pe(e);e.style.setProperty("--md-tooltip-width",`${r}px`),e.remove();let o=sr(t),n=typeof o!="undefined"?et(o):$({x:0,y:0}),i=T(vt(t),Vo(t)).pipe(Y());return Q([i,n]).pipe(m(([a,s])=>{let{x:c,y:p}=Ue(t),l=pe(t),f=t.closest("table");return f&&t.parentElement&&(c+=f.offsetLeft+t.parentElement.offsetLeft,p+=f.offsetTop+t.parentElement.offsetTop),{active:a,offset:{x:c-s.x+l.width/2-r/2,y:p-s.y+l.height+8}}}))}function Ge(e){let t=e.title;if(!t.length)return L;let r=`__tooltip_${wa++}`,o=Ct(r,"inline"),n=P(".md-typeset",o);return n.innerHTML=t,H(()=>{let i=new g;return i.subscribe({next({offset:a}){o.style.setProperty("--md-tooltip-x",`${a.x}px`),o.style.setProperty("--md-tooltip-y",`${a.y}px`)},complete(){o.style.removeProperty("--md-tooltip-x"),o.style.removeProperty("--md-tooltip-y")}}),T(i.pipe(b(({active:a})=>a)),i.pipe(be(250),b(({active:a})=>!a))).subscribe({next({active:a}){a?(e.insertAdjacentElement("afterend",o),e.setAttribute("aria-describedby",r),e.removeAttribute("title")):(o.remove(),e.removeAttribute("aria-describedby"),e.setAttribute("title",t))},complete(){o.remove(),e.removeAttribute("aria-describedby"),e.setAttribute("title",t)}}),i.pipe(Me(16,de)).subscribe(({active:a})=>{o.classList.toggle("md-tooltip--active",a)}),i.pipe(_t(125,de),b(()=>!!e.offsetParent),m(()=>e.offsetParent.getBoundingClientRect()),m(({x:a})=>a)).subscribe({next(a){a?o.style.setProperty("--md-tooltip-0",`${-a}px`):o.style.removeProperty("--md-tooltip-0")},complete(){o.style.removeProperty("--md-tooltip-0")}}),Ta(o,e).pipe(y(a=>i.next(a)),_(()=>i.complete()),m(a=>F({ref:e},a)))}).pipe(ze(ae))}function Sa(e,t){let r=H(()=>Q([zo(e),et(t)])).pipe(m(([{x:o,y:n},i])=>{let{width:a,height:s}=pe(e);return{x:o-i.x+a/2,y:n-i.y+s/2}}));return vt(e).pipe(v(o=>r.pipe(m(n=>({active:o,offset:n})),ye(+!o||1/0))))}function xn(e,t,{target$:r}){let[o,n]=Array.from(e.children);return H(()=>{let i=new g,a=i.pipe(ee(),oe(!0));return i.subscribe({next({offset:s}){e.style.setProperty("--md-tooltip-x",`${s.x}px`),e.style.setProperty("--md-tooltip-y",`${s.y}px`)},complete(){e.style.removeProperty("--md-tooltip-x"),e.style.removeProperty("--md-tooltip-y")}}),yt(e).pipe(U(a)).subscribe(s=>{e.toggleAttribute("data-md-visible",s)}),T(i.pipe(b(({active:s})=>s)),i.pipe(be(250),b(({active:s})=>!s))).subscribe({next({active:s}){s?e.prepend(o):o.remove()},complete(){e.prepend(o)}}),i.pipe(Me(16,de)).subscribe(({active:s})=>{o.classList.toggle("md-tooltip--active",s)}),i.pipe(_t(125,de),b(()=>!!e.offsetParent),m(()=>e.offsetParent.getBoundingClientRect()),m(({x:s})=>s)).subscribe({next(s){s?e.style.setProperty("--md-tooltip-0",`${-s}px`):e.style.removeProperty("--md-tooltip-0")},complete(){e.style.removeProperty("--md-tooltip-0")}}),d(n,"click").pipe(U(a),b(s=>!(s.metaKey||s.ctrlKey))).subscribe(s=>{s.stopPropagation(),s.preventDefault()}),d(n,"mousedown").pipe(U(a),ne(i)).subscribe(([s,{active:c}])=>{var p;if(s.button!==0||s.metaKey||s.ctrlKey)s.preventDefault();else if(c){s.preventDefault();let l=e.parentElement.closest(".md-annotation");l instanceof HTMLElement?l.focus():(p=Re())==null||p.blur()}}),r.pipe(U(a),b(s=>s===o),Ye(125)).subscribe(()=>e.focus()),Sa(e,t).pipe(y(s=>i.next(s)),_(()=>i.complete()),m(s=>F({ref:e},s)))})}function Oa(e){return e.tagName==="CODE"?R(".c, .c1, .cm",e):[e]}function Ma(e){let t=[];for(let r of Oa(e)){let o=[],n=document.createNodeIterator(r,NodeFilter.SHOW_TEXT);for(let i=n.nextNode();i;i=n.nextNode())o.push(i);for(let i of o){let a;for(;a=/(\(\d+\))(!)?/.exec(i.textContent);){let[,s,c]=a;if(typeof c=="undefined"){let p=i.splitText(a.index);i=p.splitText(s.length),t.push(p)}else{i.textContent=s,t.push(i);break}}}}return t}function yn(e,t){t.append(...Array.from(e.childNodes))}function lr(e,t,{target$:r,print$:o}){let n=t.closest("[id]"),i=n==null?void 0:n.id,a=new Map;for(let s of Ma(t)){let[,c]=s.textContent.match(/\((\d+)\)/);me(`:scope > li:nth-child(${c})`,e)&&(a.set(c,un(c,i)),s.replaceWith(a.get(c)))}return a.size===0?L:H(()=>{let s=new g,c=s.pipe(ee(),oe(!0)),p=[];for(let[l,f]of a)p.push([P(".md-typeset",f),P(`:scope > li:nth-child(${l})`,e)]);return o.pipe(U(c)).subscribe(l=>{e.hidden=!l,e.classList.toggle("md-annotation-list",l);for(let[f,u]of p)l?yn(f,u):yn(u,f)}),T(...[...a].map(([,l])=>xn(l,t,{target$:r}))).pipe(_(()=>s.complete()),le())})}function En(e){if(e.nextElementSibling){let t=e.nextElementSibling;if(t.tagName==="OL")return t;if(t.tagName==="P"&&!t.children.length)return En(t)}}function wn(e,t){return H(()=>{let r=En(e);return typeof r!="undefined"?lr(r,e,t):L})}var Tn=jt(zr());var La=0;function Sn(e){if(e.nextElementSibling){let t=e.nextElementSibling;if(t.tagName==="OL")return t;if(t.tagName==="P"&&!t.children.length)return Sn(t)}}function _a(e){return Ee(e).pipe(m(({width:t})=>({scrollable:xt(e).width>t})),X("scrollable"))}function On(e,t){let{matches:r}=matchMedia("(hover)"),o=H(()=>{let n=new g,i=n.pipe($r(1));n.subscribe(({scrollable:c})=>{c&&r?e.setAttribute("tabindex","0"):e.removeAttribute("tabindex")});let a=[];if(Tn.default.isSupported()&&(e.closest(".copy")||G("content.code.copy")&&!e.closest(".no-copy"))){let c=e.closest("pre");c.id=`__code_${La++}`;let p=dn(c.id);c.insertBefore(p,e),G("content.tooltips")&&a.push(Ge(p))}let s=e.closest(".highlight");if(s instanceof HTMLElement){let c=Sn(s);if(typeof c!="undefined"&&(s.classList.contains("annotate")||G("content.code.annotate"))){let p=lr(c,e,t);a.push(Ee(s).pipe(U(i),m(({width:l,height:f})=>l&&f),Y(),v(l=>l?p:L)))}}return _a(e).pipe(y(c=>n.next(c)),_(()=>n.complete()),m(c=>F({ref:e},c)),$e(...a))});return G("content.lazy")?yt(e).pipe(b(n=>n),ye(1),v(()=>o)):o}function Aa(e,{target$:t,print$:r}){let o=!0;return T(t.pipe(m(n=>n.closest("details:not([open])")),b(n=>e===n),m(()=>({action:"open",reveal:!0}))),r.pipe(b(n=>n||!o),y(()=>o=e.open),m(n=>({action:n?"open":"close"}))))}function Mn(e,t){return H(()=>{let r=new g;return r.subscribe(({action:o,reveal:n})=>{e.toggleAttribute("open",o==="open"),n&&e.scrollIntoView()}),Aa(e,t).pipe(y(o=>r.next(o)),_(()=>r.complete()),m(o=>F({ref:e},o)))})}var Ln=".node circle,.node ellipse,.node path,.node polygon,.node rect{fill:var(--md-mermaid-node-bg-color);stroke:var(--md-mermaid-node-fg-color)}marker{fill:var(--md-mermaid-edge-color)!important}.edgeLabel .label rect{fill:#0000}.label{color:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.label foreignObject{line-height:normal;overflow:visible}.label div .edgeLabel{color:var(--md-mermaid-label-fg-color)}.edgeLabel,.edgeLabel rect,.label div .edgeLabel{background-color:var(--md-mermaid-label-bg-color)}.edgeLabel,.edgeLabel rect{fill:var(--md-mermaid-label-bg-color);color:var(--md-mermaid-edge-color)}.edgePath .path,.flowchart-link{stroke:var(--md-mermaid-edge-color);stroke-width:.05rem}.edgePath .arrowheadPath{fill:var(--md-mermaid-edge-color);stroke:none}.cluster rect{fill:var(--md-default-fg-color--lightest);stroke:var(--md-default-fg-color--lighter)}.cluster span{color:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}g #flowchart-circleEnd,g #flowchart-circleStart,g #flowchart-crossEnd,g #flowchart-crossStart,g #flowchart-pointEnd,g #flowchart-pointStart{stroke:none}g.classGroup line,g.classGroup rect{fill:var(--md-mermaid-node-bg-color);stroke:var(--md-mermaid-node-fg-color)}g.classGroup text{fill:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.classLabel .box{fill:var(--md-mermaid-label-bg-color);background-color:var(--md-mermaid-label-bg-color);opacity:1}.classLabel .label{fill:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.node .divider{stroke:var(--md-mermaid-node-fg-color)}.relation{stroke:var(--md-mermaid-edge-color)}.cardinality{fill:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.cardinality text{fill:inherit!important}defs #classDiagram-compositionEnd,defs #classDiagram-compositionStart,defs #classDiagram-dependencyEnd,defs #classDiagram-dependencyStart,defs #classDiagram-extensionEnd,defs #classDiagram-extensionStart{fill:var(--md-mermaid-edge-color)!important;stroke:var(--md-mermaid-edge-color)!important}defs #classDiagram-aggregationEnd,defs #classDiagram-aggregationStart{fill:var(--md-mermaid-label-bg-color)!important;stroke:var(--md-mermaid-edge-color)!important}g.stateGroup rect{fill:var(--md-mermaid-node-bg-color);stroke:var(--md-mermaid-node-fg-color)}g.stateGroup .state-title{fill:var(--md-mermaid-label-fg-color)!important;font-family:var(--md-mermaid-font-family)}g.stateGroup .composit{fill:var(--md-mermaid-label-bg-color)}.nodeLabel,.nodeLabel p{color:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.node circle.state-end,.node circle.state-start,.start-state{fill:var(--md-mermaid-edge-color);stroke:none}.end-state-inner,.end-state-outer{fill:var(--md-mermaid-edge-color)}.end-state-inner,.node circle.state-end{stroke:var(--md-mermaid-label-bg-color)}.transition{stroke:var(--md-mermaid-edge-color)}[id^=state-fork] rect,[id^=state-join] rect{fill:var(--md-mermaid-edge-color)!important;stroke:none!important}.statediagram-cluster.statediagram-cluster .inner{fill:var(--md-default-bg-color)}.statediagram-cluster rect{fill:var(--md-mermaid-node-bg-color);stroke:var(--md-mermaid-node-fg-color)}.statediagram-state rect.divider{fill:var(--md-default-fg-color--lightest);stroke:var(--md-default-fg-color--lighter)}defs #statediagram-barbEnd{stroke:var(--md-mermaid-edge-color)}.attributeBoxEven,.attributeBoxOdd{fill:var(--md-mermaid-node-bg-color);stroke:var(--md-mermaid-node-fg-color)}.entityBox{fill:var(--md-mermaid-label-bg-color);stroke:var(--md-mermaid-node-fg-color)}.entityLabel{fill:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.relationshipLabelBox{fill:var(--md-mermaid-label-bg-color);fill-opacity:1;background-color:var(--md-mermaid-label-bg-color);opacity:1}.relationshipLabel{fill:var(--md-mermaid-label-fg-color)}.relationshipLine{stroke:var(--md-mermaid-edge-color)}defs #ONE_OR_MORE_END *,defs #ONE_OR_MORE_START *,defs #ONLY_ONE_END *,defs #ONLY_ONE_START *,defs #ZERO_OR_MORE_END *,defs #ZERO_OR_MORE_START *,defs #ZERO_OR_ONE_END *,defs #ZERO_OR_ONE_START *{stroke:var(--md-mermaid-edge-color)!important}defs #ZERO_OR_MORE_END circle,defs #ZERO_OR_MORE_START circle{fill:var(--md-mermaid-label-bg-color)}.actor{fill:var(--md-mermaid-sequence-actor-bg-color);stroke:var(--md-mermaid-sequence-actor-border-color)}text.actor>tspan{fill:var(--md-mermaid-sequence-actor-fg-color);font-family:var(--md-mermaid-font-family)}line{stroke:var(--md-mermaid-sequence-actor-line-color)}.actor-man circle,.actor-man line{fill:var(--md-mermaid-sequence-actorman-bg-color);stroke:var(--md-mermaid-sequence-actorman-line-color)}.messageLine0,.messageLine1{stroke:var(--md-mermaid-sequence-message-line-color)}.note{fill:var(--md-mermaid-sequence-note-bg-color);stroke:var(--md-mermaid-sequence-note-border-color)}.loopText,.loopText>tspan,.messageText,.noteText>tspan{stroke:none;font-family:var(--md-mermaid-font-family)!important}.messageText{fill:var(--md-mermaid-sequence-message-fg-color)}.loopText,.loopText>tspan{fill:var(--md-mermaid-sequence-loop-fg-color)}.noteText>tspan{fill:var(--md-mermaid-sequence-note-fg-color)}#arrowhead path{fill:var(--md-mermaid-sequence-message-line-color);stroke:none}.loopLine{fill:var(--md-mermaid-sequence-loop-bg-color);stroke:var(--md-mermaid-sequence-loop-border-color)}.labelBox{fill:var(--md-mermaid-sequence-label-bg-color);stroke:none}.labelText,.labelText>span{fill:var(--md-mermaid-sequence-label-fg-color);font-family:var(--md-mermaid-font-family)}.sequenceNumber{fill:var(--md-mermaid-sequence-number-fg-color)}rect.rect{fill:var(--md-mermaid-sequence-box-bg-color);stroke:none}rect.rect+text.text{fill:var(--md-mermaid-sequence-box-fg-color)}defs #sequencenumber{fill:var(--md-mermaid-sequence-number-bg-color)!important}";var qr,ka=0;function Ha(){return typeof mermaid=="undefined"||mermaid instanceof Element?gt("https://unpkg.com/mermaid@10.7.0/dist/mermaid.min.js"):$(void 0)}function _n(e){return e.classList.remove("mermaid"),qr||(qr=Ha().pipe(y(()=>mermaid.initialize({startOnLoad:!1,themeCSS:Ln,sequence:{actorFontSize:"16px",messageFontSize:"16px",noteFontSize:"16px"}})),m(()=>{}),B(1))),qr.subscribe(()=>ro(this,null,function*(){e.classList.add("mermaid");let t=`__mermaid_${ka++}`,r=E("div",{class:"mermaid"}),o=e.textContent,{svg:n,fn:i}=yield mermaid.render(t,o),a=r.attachShadow({mode:"closed"});a.innerHTML=n,e.replaceWith(r),i==null||i(a)})),qr.pipe(m(()=>({ref:e})))}var An=E("table");function Cn(e){return e.replaceWith(An),An.replaceWith(vn(e)),$({ref:e})}function $a(e){let t=e.find(r=>r.checked)||e[0];return T(...e.map(r=>d(r,"change").pipe(m(()=>P(`label[for="${r.id}"]`))))).pipe(q(P(`label[for="${t.id}"]`)),m(r=>({active:r})))}function kn(e,{viewport$:t,target$:r}){let o=P(".tabbed-labels",e),n=R(":scope > input",e),i=Nr("prev");e.append(i);let a=Nr("next");return e.append(a),H(()=>{let s=new g,c=s.pipe(ee(),oe(!0));Q([s,Ee(e)]).pipe(U(c),Me(1,de)).subscribe({next([{active:p},l]){let f=Ue(p),{width:u}=pe(p);e.style.setProperty("--md-indicator-x",`${f.x}px`),e.style.setProperty("--md-indicator-width",`${u}px`);let h=ir(o);(f.xh.x+l.width)&&o.scrollTo({left:Math.max(0,f.x-16),behavior:"smooth"})},complete(){e.style.removeProperty("--md-indicator-x"),e.style.removeProperty("--md-indicator-width")}}),Q([et(o),Ee(o)]).pipe(U(c)).subscribe(([p,l])=>{let f=xt(o);i.hidden=p.x<16,a.hidden=p.x>f.width-l.width-16}),T(d(i,"click").pipe(m(()=>-1)),d(a,"click").pipe(m(()=>1))).pipe(U(c)).subscribe(p=>{let{width:l}=pe(o);o.scrollBy({left:l*p,behavior:"smooth"})}),r.pipe(U(c),b(p=>n.includes(p))).subscribe(p=>p.click()),o.classList.add("tabbed-labels--linked");for(let p of n){let l=P(`label[for="${p.id}"]`);l.replaceChildren(E("a",{href:`#${l.htmlFor}`,tabIndex:-1},...Array.from(l.childNodes))),d(l.firstElementChild,"click").pipe(U(c),b(f=>!(f.metaKey||f.ctrlKey)),y(f=>{f.preventDefault(),f.stopPropagation()})).subscribe(()=>{history.replaceState({},"",`#${l.htmlFor}`),l.click()})}return G("content.tabs.link")&&s.pipe(Le(1),ne(t)).subscribe(([{active:p},{offset:l}])=>{let f=p.innerText.trim();if(p.hasAttribute("data-md-switching"))p.removeAttribute("data-md-switching");else{let u=e.offsetTop-l.y;for(let w of R("[data-tabs]"))for(let A of R(":scope > input",w)){let Z=P(`label[for="${A.id}"]`);if(Z!==p&&Z.innerText.trim()===f){Z.setAttribute("data-md-switching",""),A.click();break}}window.scrollTo({top:e.offsetTop-u});let h=__md_get("__tabs")||[];__md_set("__tabs",[...new Set([f,...h])])}}),s.pipe(U(c)).subscribe(()=>{for(let p of R("audio, video",e))p.pause()}),$a(n).pipe(y(p=>s.next(p)),_(()=>s.complete()),m(p=>F({ref:e},p)))}).pipe(ze(ae))}function Hn(e,{viewport$:t,target$:r,print$:o}){return T(...R(".annotate:not(.highlight)",e).map(n=>wn(n,{target$:r,print$:o})),...R("pre:not(.mermaid) > code",e).map(n=>On(n,{target$:r,print$:o})),...R("pre.mermaid",e).map(n=>_n(n)),...R("table:not([class])",e).map(n=>Cn(n)),...R("details",e).map(n=>Mn(n,{target$:r,print$:o})),...R("[data-tabs]",e).map(n=>kn(n,{viewport$:t,target$:r})),...R("[title]",e).filter(()=>G("content.tooltips")).map(n=>Ge(n)))}function Ra(e,{alert$:t}){return t.pipe(v(r=>T($(!0),$(!1).pipe(Ye(2e3))).pipe(m(o=>({message:r,active:o})))))}function $n(e,t){let r=P(".md-typeset",e);return H(()=>{let o=new g;return o.subscribe(({message:n,active:i})=>{e.classList.toggle("md-dialog--active",i),r.textContent=n}),Ra(e,t).pipe(y(n=>o.next(n)),_(()=>o.complete()),m(n=>F({ref:e},n)))})}function Pa({viewport$:e}){if(!G("header.autohide"))return $(!1);let t=e.pipe(m(({offset:{y:n}})=>n),Ke(2,1),m(([n,i])=>[nMath.abs(i-n.y)>100),m(([,[n]])=>n),Y()),o=We("search");return Q([e,o]).pipe(m(([{offset:n},i])=>n.y>400&&!i),Y(),v(n=>n?r:$(!1)),q(!1))}function Rn(e,t){return H(()=>Q([Ee(e),Pa(t)])).pipe(m(([{height:r},o])=>({height:r,hidden:o})),Y((r,o)=>r.height===o.height&&r.hidden===o.hidden),B(1))}function Pn(e,{header$:t,main$:r}){return H(()=>{let o=new g,n=o.pipe(ee(),oe(!0));o.pipe(X("active"),je(t)).subscribe(([{active:a},{hidden:s}])=>{e.classList.toggle("md-header--shadow",a&&!s),e.hidden=s});let i=fe(R("[title]",e)).pipe(b(()=>G("content.tooltips")),re(a=>Ge(a)));return r.subscribe(o),t.pipe(U(n),m(a=>F({ref:e},a)),$e(i.pipe(U(n))))})}function Ia(e,{viewport$:t,header$:r}){return pr(e,{viewport$:t,header$:r}).pipe(m(({offset:{y:o}})=>{let{height:n}=pe(e);return{active:o>=n}}),X("active"))}function In(e,t){return H(()=>{let r=new g;r.subscribe({next({active:n}){e.classList.toggle("md-header__title--active",n)},complete(){e.classList.remove("md-header__title--active")}});let o=me(".md-content h1");return typeof o=="undefined"?L:Ia(o,t).pipe(y(n=>r.next(n)),_(()=>r.complete()),m(n=>F({ref:e},n)))})}function Fn(e,{viewport$:t,header$:r}){let o=r.pipe(m(({height:i})=>i),Y()),n=o.pipe(v(()=>Ee(e).pipe(m(({height:i})=>({top:e.offsetTop,bottom:e.offsetTop+i})),X("bottom"))));return Q([o,n,t]).pipe(m(([i,{top:a,bottom:s},{offset:{y:c},size:{height:p}}])=>(p=Math.max(0,p-Math.max(0,a-c,i)-Math.max(0,p+c-s)),{offset:a-i,height:p,active:a-i<=c})),Y((i,a)=>i.offset===a.offset&&i.height===a.height&&i.active===a.active))}function Fa(e){let t=__md_get("__palette")||{index:e.findIndex(o=>matchMedia(o.getAttribute("data-md-color-media")).matches)},r=Math.max(0,Math.min(t.index,e.length-1));return $(...e).pipe(re(o=>d(o,"change").pipe(m(()=>o))),q(e[r]),m(o=>({index:e.indexOf(o),color:{media:o.getAttribute("data-md-color-media"),scheme:o.getAttribute("data-md-color-scheme"),primary:o.getAttribute("data-md-color-primary"),accent:o.getAttribute("data-md-color-accent")}})),B(1))}function jn(e){let t=R("input",e),r=E("meta",{name:"theme-color"});document.head.appendChild(r);let o=E("meta",{name:"color-scheme"});document.head.appendChild(o);let n=At("(prefers-color-scheme: light)");return H(()=>{let i=new g;return i.subscribe(a=>{if(document.body.setAttribute("data-md-color-switching",""),a.color.media==="(prefers-color-scheme)"){let s=matchMedia("(prefers-color-scheme: light)"),c=document.querySelector(s.matches?"[data-md-color-media='(prefers-color-scheme: light)']":"[data-md-color-media='(prefers-color-scheme: dark)']");a.color.scheme=c.getAttribute("data-md-color-scheme"),a.color.primary=c.getAttribute("data-md-color-primary"),a.color.accent=c.getAttribute("data-md-color-accent")}for(let[s,c]of Object.entries(a.color))document.body.setAttribute(`data-md-color-${s}`,c);for(let s=0;sa.key==="Enter"),ne(i,(a,s)=>s)).subscribe(({index:a})=>{a=(a+1)%t.length,t[a].click(),t[a].focus()}),i.pipe(m(()=>{let a=Te("header"),s=window.getComputedStyle(a);return o.content=s.colorScheme,s.backgroundColor.match(/\d+/g).map(c=>(+c).toString(16).padStart(2,"0")).join("")})).subscribe(a=>r.content=`#${a}`),i.pipe(Oe(ae)).subscribe(()=>{document.body.removeAttribute("data-md-color-switching")}),Fa(t).pipe(U(n.pipe(Le(1))),at(),y(a=>i.next(a)),_(()=>i.complete()),m(a=>F({ref:e},a)))})}function Un(e,{progress$:t}){return H(()=>{let r=new g;return r.subscribe(({value:o})=>{e.style.setProperty("--md-progress-value",`${o}`)}),t.pipe(y(o=>r.next({value:o})),_(()=>r.complete()),m(o=>({ref:e,value:o})))})}var Kr=jt(zr());function ja(e){e.setAttribute("data-md-copying","");let t=e.closest("[data-copy]"),r=t?t.getAttribute("data-copy"):e.innerText;return e.removeAttribute("data-md-copying"),r.trimEnd()}function Wn({alert$:e}){Kr.default.isSupported()&&new j(t=>{new Kr.default("[data-clipboard-target], [data-clipboard-text]",{text:r=>r.getAttribute("data-clipboard-text")||ja(P(r.getAttribute("data-clipboard-target")))}).on("success",r=>t.next(r))}).pipe(y(t=>{t.trigger.focus()}),m(()=>ge("clipboard.copied"))).subscribe(e)}function Dn(e,t){return e.protocol=t.protocol,e.hostname=t.hostname,e}function Ua(e,t){let r=new Map;for(let o of R("url",e)){let n=P("loc",o),i=[Dn(new URL(n.textContent),t)];r.set(`${i[0]}`,i);for(let a of R("[rel=alternate]",o)){let s=a.getAttribute("href");s!=null&&i.push(Dn(new URL(s),t))}}return r}function mr(e){return on(new URL("sitemap.xml",e)).pipe(m(t=>Ua(t,new URL(e))),he(()=>$(new Map)))}function Wa(e,t){if(!(e.target instanceof Element))return L;let r=e.target.closest("a");if(r===null)return L;if(r.target||e.metaKey||e.ctrlKey)return L;let o=new URL(r.href);return o.search=o.hash="",t.has(`${o}`)?(e.preventDefault(),$(new URL(r.href))):L}function Nn(e){let t=new Map;for(let r of R(":scope > *",e.head))t.set(r.outerHTML,r);return t}function Vn(e){for(let t of R("[href], [src]",e))for(let r of["href","src"]){let o=t.getAttribute(r);if(o&&!/^(?:[a-z]+:)?\/\//i.test(o)){t[r]=t[r];break}}return $(e)}function Da(e){for(let o of["[data-md-component=announce]","[data-md-component=container]","[data-md-component=header-topic]","[data-md-component=outdated]","[data-md-component=logo]","[data-md-component=skip]",...G("navigation.tabs.sticky")?["[data-md-component=tabs]"]:[]]){let n=me(o),i=me(o,e);typeof n!="undefined"&&typeof i!="undefined"&&n.replaceWith(i)}let t=Nn(document);for(let[o,n]of Nn(e))t.has(o)?t.delete(o):document.head.appendChild(n);for(let o of t.values()){let n=o.getAttribute("name");n!=="theme-color"&&n!=="color-scheme"&&o.remove()}let r=Te("container");return Fe(R("script",r)).pipe(v(o=>{let n=e.createElement("script");if(o.src){for(let i of o.getAttributeNames())n.setAttribute(i,o.getAttribute(i));return o.replaceWith(n),new j(i=>{n.onload=()=>i.complete()})}else return n.textContent=o.textContent,o.replaceWith(n),L}),ee(),oe(document))}function zn({location$:e,viewport$:t,progress$:r}){let o=we();if(location.protocol==="file:")return L;let n=mr(o.base);$(document).subscribe(Vn);let i=d(document.body,"click").pipe(je(n),v(([c,p])=>Wa(c,p)),le()),a=d(window,"popstate").pipe(m(ve),le());i.pipe(ne(t)).subscribe(([c,{offset:p}])=>{history.replaceState(p,""),history.pushState(null,"",c)}),T(i,a).subscribe(e);let s=e.pipe(X("pathname"),v(c=>rn(c,{progress$:r}).pipe(he(()=>(st(c,!0),L)))),v(Vn),v(Da),le());return T(s.pipe(ne(e,(c,p)=>p)),e.pipe(X("pathname"),v(()=>e),X("hash")),e.pipe(Y((c,p)=>c.pathname===p.pathname&&c.hash===p.hash),v(()=>i),y(()=>history.back()))).subscribe(c=>{var p,l;history.state!==null||!c.hash?window.scrollTo(0,(l=(p=history.state)==null?void 0:p.y)!=null?l:0):(history.scrollRestoration="auto",Zo(c.hash),history.scrollRestoration="manual")}),e.subscribe(()=>{history.scrollRestoration="manual"}),d(window,"beforeunload").subscribe(()=>{history.scrollRestoration="auto"}),t.pipe(X("offset"),be(100)).subscribe(({offset:c})=>{history.replaceState(c,"")}),s}var Qn=jt(Kn());function Yn(e){let t=e.separator.split("|").map(n=>n.replace(/(\(\?[!=<][^)]+\))/g,"").length===0?"\uFFFD":n).join("|"),r=new RegExp(t,"img"),o=(n,i,a)=>`${i}${a}`;return n=>{n=n.replace(/[\s*+\-:~^]+/g," ").trim();let i=new RegExp(`(^|${e.separator}|)(${n.replace(/[|\\{}()[\]^$+*?.-]/g,"\\$&").replace(r,"|")})`,"img");return a=>(0,Qn.default)(a).replace(i,o).replace(/<\/mark>(\s+)]*>/img,"$1")}}function Ht(e){return e.type===1}function fr(e){return e.type===3}function Bn(e,t){let r=ln(e);return T($(location.protocol!=="file:"),We("search")).pipe(He(o=>o),v(()=>t)).subscribe(({config:o,docs:n})=>r.next({type:0,data:{config:o,docs:n,options:{suggest:G("search.suggest")}}})),r}function Gn({document$:e}){let t=we(),r=De(new URL("../versions.json",t.base)).pipe(he(()=>L)),o=r.pipe(m(n=>{let[,i]=t.base.match(/([^/]+)\/?$/);return n.find(({version:a,aliases:s})=>a===i||s.includes(i))||n[0]}));r.pipe(m(n=>new Map(n.map(i=>[`${new URL(`../${i.version}/`,t.base)}`,i]))),v(n=>d(document.body,"click").pipe(b(i=>!i.metaKey&&!i.ctrlKey),ne(o),v(([i,a])=>{if(i.target instanceof Element){let s=i.target.closest("a");if(s&&!s.target&&n.has(s.href)){let c=s.href;return!i.target.closest(".md-version")&&n.get(c)===a?L:(i.preventDefault(),$(c))}}return L}),v(i=>{let{version:a}=n.get(i);return mr(new URL(i)).pipe(m(s=>{let p=ve().href.replace(t.base,"");return s.has(p.split("#")[0])?new URL(`../${a}/${p}`,t.base):new URL(i)}))})))).subscribe(n=>st(n,!0)),Q([r,o]).subscribe(([n,i])=>{P(".md-header__topic").appendChild(gn(n,i))}),e.pipe(v(()=>o)).subscribe(n=>{var a;let i=__md_get("__outdated",sessionStorage);if(i===null){i=!0;let s=((a=t.version)==null?void 0:a.default)||"latest";Array.isArray(s)||(s=[s]);e:for(let c of s)for(let p of n.aliases.concat(n.version))if(new RegExp(c,"i").test(p)){i=!1;break e}__md_set("__outdated",i,sessionStorage)}if(i)for(let s of ie("outdated"))s.hidden=!1})}function Ka(e,{worker$:t}){let{searchParams:r}=ve();r.has("q")&&(Be("search",!0),e.value=r.get("q"),e.focus(),We("search").pipe(He(i=>!i)).subscribe(()=>{let i=ve();i.searchParams.delete("q"),history.replaceState({},"",`${i}`)}));let o=vt(e),n=T(t.pipe(He(Ht)),d(e,"keyup"),o).pipe(m(()=>e.value),Y());return Q([n,o]).pipe(m(([i,a])=>({value:i,focus:a})),B(1))}function Jn(e,{worker$:t}){let r=new g,o=r.pipe(ee(),oe(!0));Q([t.pipe(He(Ht)),r],(i,a)=>a).pipe(X("value")).subscribe(({value:i})=>t.next({type:2,data:i})),r.pipe(X("focus")).subscribe(({focus:i})=>{i&&Be("search",i)}),d(e.form,"reset").pipe(U(o)).subscribe(()=>e.focus());let n=P("header [for=__search]");return d(n,"click").subscribe(()=>e.focus()),Ka(e,{worker$:t}).pipe(y(i=>r.next(i)),_(()=>r.complete()),m(i=>F({ref:e},i)),B(1))}function Xn(e,{worker$:t,query$:r}){let o=new g,n=Yo(e.parentElement).pipe(b(Boolean)),i=e.parentElement,a=P(":scope > :first-child",e),s=P(":scope > :last-child",e);We("search").subscribe(l=>s.setAttribute("role",l?"list":"presentation")),o.pipe(ne(r),Ir(t.pipe(He(Ht)))).subscribe(([{items:l},{value:f}])=>{switch(l.length){case 0:a.textContent=f.length?ge("search.result.none"):ge("search.result.placeholder");break;case 1:a.textContent=ge("search.result.one");break;default:let u=ar(l.length);a.textContent=ge("search.result.other",u)}});let c=o.pipe(y(()=>s.innerHTML=""),v(({items:l})=>T($(...l.slice(0,10)),$(...l.slice(10)).pipe(Ke(4),jr(n),v(([f])=>f)))),m(hn),le());return c.subscribe(l=>s.appendChild(l)),c.pipe(re(l=>{let f=me("details",l);return typeof f=="undefined"?L:d(f,"toggle").pipe(U(o),m(()=>f))})).subscribe(l=>{l.open===!1&&l.offsetTop<=i.scrollTop&&i.scrollTo({top:l.offsetTop})}),t.pipe(b(fr),m(({data:l})=>l)).pipe(y(l=>o.next(l)),_(()=>o.complete()),m(l=>F({ref:e},l)))}function Qa(e,{query$:t}){return t.pipe(m(({value:r})=>{let o=ve();return o.hash="",r=r.replace(/\s+/g,"+").replace(/&/g,"%26").replace(/=/g,"%3D"),o.search=`q=${r}`,{url:o}}))}function Zn(e,t){let r=new g,o=r.pipe(ee(),oe(!0));return r.subscribe(({url:n})=>{e.setAttribute("data-clipboard-text",e.href),e.href=`${n}`}),d(e,"click").pipe(U(o)).subscribe(n=>n.preventDefault()),Qa(e,t).pipe(y(n=>r.next(n)),_(()=>r.complete()),m(n=>F({ref:e},n)))}function ei(e,{worker$:t,keyboard$:r}){let o=new g,n=Te("search-query"),i=T(d(n,"keydown"),d(n,"focus")).pipe(Oe(ae),m(()=>n.value),Y());return o.pipe(je(i),m(([{suggest:s},c])=>{let p=c.split(/([\s-]+)/);if(s!=null&&s.length&&p[p.length-1]){let l=s[s.length-1];l.startsWith(p[p.length-1])&&(p[p.length-1]=l)}else p.length=0;return p})).subscribe(s=>e.innerHTML=s.join("").replace(/\s/g," ")),r.pipe(b(({mode:s})=>s==="search")).subscribe(s=>{switch(s.type){case"ArrowRight":e.innerText.length&&n.selectionStart===n.value.length&&(n.value=e.innerText);break}}),t.pipe(b(fr),m(({data:s})=>s)).pipe(y(s=>o.next(s)),_(()=>o.complete()),m(()=>({ref:e})))}function ti(e,{index$:t,keyboard$:r}){let o=we();try{let n=Bn(o.search,t),i=Te("search-query",e),a=Te("search-result",e);d(e,"click").pipe(b(({target:c})=>c instanceof Element&&!!c.closest("a"))).subscribe(()=>Be("search",!1)),r.pipe(b(({mode:c})=>c==="search")).subscribe(c=>{let p=Re();switch(c.type){case"Enter":if(p===i){let l=new Map;for(let f of R(":first-child [href]",a)){let u=f.firstElementChild;l.set(f,parseFloat(u.getAttribute("data-md-score")))}if(l.size){let[[f]]=[...l].sort(([,u],[,h])=>h-u);f.click()}c.claim()}break;case"Escape":case"Tab":Be("search",!1),i.blur();break;case"ArrowUp":case"ArrowDown":if(typeof p=="undefined")i.focus();else{let l=[i,...R(":not(details) > [href], summary, details[open] [href]",a)],f=Math.max(0,(Math.max(0,l.indexOf(p))+l.length+(c.type==="ArrowUp"?-1:1))%l.length);l[f].focus()}c.claim();break;default:i!==Re()&&i.focus()}}),r.pipe(b(({mode:c})=>c==="global")).subscribe(c=>{switch(c.type){case"f":case"s":case"/":i.focus(),i.select(),c.claim();break}});let s=Jn(i,{worker$:n});return T(s,Xn(a,{worker$:n,query$:s})).pipe($e(...ie("search-share",e).map(c=>Zn(c,{query$:s})),...ie("search-suggest",e).map(c=>ei(c,{worker$:n,keyboard$:r}))))}catch(n){return e.hidden=!0,qe}}function ri(e,{index$:t,location$:r}){return Q([t,r.pipe(q(ve()),b(o=>!!o.searchParams.get("h")))]).pipe(m(([o,n])=>Yn(o.config)(n.searchParams.get("h"))),m(o=>{var a;let n=new Map,i=document.createNodeIterator(e,NodeFilter.SHOW_TEXT);for(let s=i.nextNode();s;s=i.nextNode())if((a=s.parentElement)!=null&&a.offsetHeight){let c=s.textContent,p=o(c);p.length>c.length&&n.set(s,p)}for(let[s,c]of n){let{childNodes:p}=E("span",null,c);s.replaceWith(...Array.from(p))}return{ref:e,nodes:n}}))}function Ya(e,{viewport$:t,main$:r}){let o=e.closest(".md-grid"),n=o.offsetTop-o.parentElement.offsetTop;return Q([r,t]).pipe(m(([{offset:i,height:a},{offset:{y:s}}])=>(a=a+Math.min(n,Math.max(0,s-i))-n,{height:a,locked:s>=i+n})),Y((i,a)=>i.height===a.height&&i.locked===a.locked))}function Qr(e,o){var n=o,{header$:t}=n,r=to(n,["header$"]);let i=P(".md-sidebar__scrollwrap",e),{y:a}=Ue(i);return H(()=>{let s=new g,c=s.pipe(ee(),oe(!0)),p=s.pipe(Me(0,de));return p.pipe(ne(t)).subscribe({next([{height:l},{height:f}]){i.style.height=`${l-2*a}px`,e.style.top=`${f}px`},complete(){i.style.height="",e.style.top=""}}),p.pipe(He()).subscribe(()=>{for(let l of R(".md-nav__link--active[href]",e)){if(!l.clientHeight)continue;let f=l.closest(".md-sidebar__scrollwrap");if(typeof f!="undefined"){let u=l.offsetTop-f.offsetTop,{height:h}=pe(f);f.scrollTo({top:u-h/2})}}}),fe(R("label[tabindex]",e)).pipe(re(l=>d(l,"click").pipe(Oe(ae),m(()=>l),U(c)))).subscribe(l=>{let f=P(`[id="${l.htmlFor}"]`);P(`[aria-labelledby="${l.id}"]`).setAttribute("aria-expanded",`${f.checked}`)}),Ya(e,r).pipe(y(l=>s.next(l)),_(()=>s.complete()),m(l=>F({ref:e},l)))})}function oi(e,t){if(typeof t!="undefined"){let r=`https://api.github.com/repos/${e}/${t}`;return Lt(De(`${r}/releases/latest`).pipe(he(()=>L),m(o=>({version:o.tag_name})),Qe({})),De(r).pipe(he(()=>L),m(o=>({stars:o.stargazers_count,forks:o.forks_count})),Qe({}))).pipe(m(([o,n])=>F(F({},o),n)))}else{let r=`https://api.github.com/users/${e}`;return De(r).pipe(m(o=>({repositories:o.public_repos})),Qe({}))}}function ni(e,t){let r=`https://${e}/api/v4/projects/${encodeURIComponent(t)}`;return De(r).pipe(he(()=>L),m(({star_count:o,forks_count:n})=>({stars:o,forks:n})),Qe({}))}function ii(e){let t=e.match(/^.+github\.com\/([^/]+)\/?([^/]+)?/i);if(t){let[,r,o]=t;return oi(r,o)}if(t=e.match(/^.+?([^/]*gitlab[^/]+)\/(.+?)\/?$/i),t){let[,r,o]=t;return ni(r,o)}return L}var Ba;function Ga(e){return Ba||(Ba=H(()=>{let t=__md_get("__source",sessionStorage);if(t)return $(t);if(ie("consent").length){let o=__md_get("__consent");if(!(o&&o.github))return L}return ii(e.href).pipe(y(o=>__md_set("__source",o,sessionStorage)))}).pipe(he(()=>L),b(t=>Object.keys(t).length>0),m(t=>({facts:t})),B(1)))}function ai(e){let t=P(":scope > :last-child",e);return H(()=>{let r=new g;return r.subscribe(({facts:o})=>{t.appendChild(bn(o)),t.classList.add("md-source__repository--active")}),Ga(e).pipe(y(o=>r.next(o)),_(()=>r.complete()),m(o=>F({ref:e},o)))})}function Ja(e,{viewport$:t,header$:r}){return Ee(document.body).pipe(v(()=>pr(e,{header$:r,viewport$:t})),m(({offset:{y:o}})=>({hidden:o>=10})),X("hidden"))}function si(e,t){return H(()=>{let r=new g;return r.subscribe({next({hidden:o}){e.hidden=o},complete(){e.hidden=!1}}),(G("navigation.tabs.sticky")?$({hidden:!1}):Ja(e,t)).pipe(y(o=>r.next(o)),_(()=>r.complete()),m(o=>F({ref:e},o)))})}function Xa(e,{viewport$:t,header$:r}){let o=new Map,n=R(".md-nav__link",e);for(let s of n){let c=decodeURIComponent(s.hash.substring(1)),p=me(`[id="${c}"]`);typeof p!="undefined"&&o.set(s,p)}let i=r.pipe(X("height"),m(({height:s})=>{let c=Te("main"),p=P(":scope > :first-child",c);return s+.8*(p.offsetTop-c.offsetTop)}),le());return Ee(document.body).pipe(X("height"),v(s=>H(()=>{let c=[];return $([...o].reduce((p,[l,f])=>{for(;c.length&&o.get(c[c.length-1]).tagName>=f.tagName;)c.pop();let u=f.offsetTop;for(;!u&&f.parentElement;)f=f.parentElement,u=f.offsetTop;let h=f.offsetParent;for(;h;h=h.offsetParent)u+=h.offsetTop;return p.set([...c=[...c,l]].reverse(),u)},new Map))}).pipe(m(c=>new Map([...c].sort(([,p],[,l])=>p-l))),je(i),v(([c,p])=>t.pipe(Rr(([l,f],{offset:{y:u},size:h})=>{let w=u+h.height>=Math.floor(s.height);for(;f.length;){let[,A]=f[0];if(A-p=u&&!w)f=[l.pop(),...f];else break}return[l,f]},[[],[...c]]),Y((l,f)=>l[0]===f[0]&&l[1]===f[1])))))).pipe(m(([s,c])=>({prev:s.map(([p])=>p),next:c.map(([p])=>p)})),q({prev:[],next:[]}),Ke(2,1),m(([s,c])=>s.prev.length{let i=new g,a=i.pipe(ee(),oe(!0));if(i.subscribe(({prev:s,next:c})=>{for(let[p]of c)p.classList.remove("md-nav__link--passed"),p.classList.remove("md-nav__link--active");for(let[p,[l]]of s.entries())l.classList.add("md-nav__link--passed"),l.classList.toggle("md-nav__link--active",p===s.length-1)}),G("toc.follow")){let s=T(t.pipe(be(1),m(()=>{})),t.pipe(be(250),m(()=>"smooth")));i.pipe(b(({prev:c})=>c.length>0),je(o.pipe(Oe(ae))),ne(s)).subscribe(([[{prev:c}],p])=>{let[l]=c[c.length-1];if(l.offsetHeight){let f=sr(l);if(typeof f!="undefined"){let u=l.offsetTop-f.offsetTop,{height:h}=pe(f);f.scrollTo({top:u-h/2,behavior:p})}}})}return G("navigation.tracking")&&t.pipe(U(a),X("offset"),be(250),Le(1),U(n.pipe(Le(1))),at({delay:250}),ne(i)).subscribe(([,{prev:s}])=>{let c=ve(),p=s[s.length-1];if(p&&p.length){let[l]=p,{hash:f}=new URL(l.href);c.hash!==f&&(c.hash=f,history.replaceState({},"",`${c}`))}else c.hash="",history.replaceState({},"",`${c}`)}),Xa(e,{viewport$:t,header$:r}).pipe(y(s=>i.next(s)),_(()=>i.complete()),m(s=>F({ref:e},s)))})}function Za(e,{viewport$:t,main$:r,target$:o}){let n=t.pipe(m(({offset:{y:a}})=>a),Ke(2,1),m(([a,s])=>a>s&&s>0),Y()),i=r.pipe(m(({active:a})=>a));return Q([i,n]).pipe(m(([a,s])=>!(a&&s)),Y(),U(o.pipe(Le(1))),oe(!0),at({delay:250}),m(a=>({hidden:a})))}function pi(e,{viewport$:t,header$:r,main$:o,target$:n}){let i=new g,a=i.pipe(ee(),oe(!0));return i.subscribe({next({hidden:s}){e.hidden=s,s?(e.setAttribute("tabindex","-1"),e.blur()):e.removeAttribute("tabindex")},complete(){e.style.top="",e.hidden=!0,e.removeAttribute("tabindex")}}),r.pipe(U(a),X("height")).subscribe(({height:s})=>{e.style.top=`${s+16}px`}),d(e,"click").subscribe(s=>{s.preventDefault(),window.scrollTo({top:0})}),Za(e,{viewport$:t,main$:o,target$:n}).pipe(y(s=>i.next(s)),_(()=>i.complete()),m(s=>F({ref:e},s)))}function li({document$:e}){e.pipe(v(()=>R(".md-ellipsis")),re(t=>yt(t).pipe(U(e.pipe(Le(1))),b(r=>r),m(()=>t),ye(1))),b(t=>t.offsetWidth{let r=t.innerText,o=t.closest("a")||t;return o.title=r,Ge(o).pipe(U(e.pipe(Le(1))),_(()=>o.removeAttribute("title")))})).subscribe(),e.pipe(v(()=>R(".md-status")),re(t=>Ge(t))).subscribe()}function mi({document$:e,tablet$:t}){e.pipe(v(()=>R(".md-toggle--indeterminate")),y(r=>{r.indeterminate=!0,r.checked=!1}),re(r=>d(r,"change").pipe(Fr(()=>r.classList.contains("md-toggle--indeterminate")),m(()=>r))),ne(t)).subscribe(([r,o])=>{r.classList.remove("md-toggle--indeterminate"),o&&(r.checked=!1)})}function es(){return/(iPad|iPhone|iPod)/.test(navigator.userAgent)}function fi({document$:e}){e.pipe(v(()=>R("[data-md-scrollfix]")),y(t=>t.removeAttribute("data-md-scrollfix")),b(es),re(t=>d(t,"touchstart").pipe(m(()=>t)))).subscribe(t=>{let r=t.scrollTop;r===0?t.scrollTop=1:r+t.offsetHeight===t.scrollHeight&&(t.scrollTop=r-1)})}function ui({viewport$:e,tablet$:t}){Q([We("search"),t]).pipe(m(([r,o])=>r&&!o),v(r=>$(r).pipe(Ye(r?400:100))),ne(e)).subscribe(([r,{offset:{y:o}}])=>{if(r)document.body.setAttribute("data-md-scrolllock",""),document.body.style.top=`-${o}px`;else{let n=-1*parseInt(document.body.style.top,10);document.body.removeAttribute("data-md-scrolllock"),document.body.style.top="",n&&window.scrollTo(0,n)}})}Object.entries||(Object.entries=function(e){let t=[];for(let r of Object.keys(e))t.push([r,e[r]]);return t});Object.values||(Object.values=function(e){let t=[];for(let r of Object.keys(e))t.push(e[r]);return t});typeof Element!="undefined"&&(Element.prototype.scrollTo||(Element.prototype.scrollTo=function(e,t){typeof e=="object"?(this.scrollLeft=e.left,this.scrollTop=e.top):(this.scrollLeft=e,this.scrollTop=t)}),Element.prototype.replaceWith||(Element.prototype.replaceWith=function(...e){let t=this.parentNode;if(t){e.length===0&&t.removeChild(this);for(let r=e.length-1;r>=0;r--){let o=e[r];typeof o=="string"?o=document.createTextNode(o):o.parentNode&&o.parentNode.removeChild(o),r?t.insertBefore(this.previousSibling,o):t.replaceChild(o,this)}}}));function ts(){return location.protocol==="file:"?gt(`${new URL("search/search_index.js",Yr.base)}`).pipe(m(()=>__index),B(1)):De(new URL("search/search_index.json",Yr.base))}document.documentElement.classList.remove("no-js");document.documentElement.classList.add("js");var rt=No(),Rt=Jo(),wt=en(Rt),Br=Go(),_e=pn(),ur=At("(min-width: 960px)"),hi=At("(min-width: 1220px)"),bi=tn(),Yr=we(),vi=document.forms.namedItem("search")?ts():qe,Gr=new g;Wn({alert$:Gr});var Jr=new g;G("navigation.instant")&&zn({location$:Rt,viewport$:_e,progress$:Jr}).subscribe(rt);var di;((di=Yr.version)==null?void 0:di.provider)==="mike"&&Gn({document$:rt});T(Rt,wt).pipe(Ye(125)).subscribe(()=>{Be("drawer",!1),Be("search",!1)});Br.pipe(b(({mode:e})=>e==="global")).subscribe(e=>{switch(e.type){case"p":case",":let t=me("link[rel=prev]");typeof t!="undefined"&&st(t);break;case"n":case".":let r=me("link[rel=next]");typeof r!="undefined"&&st(r);break;case"Enter":let o=Re();o instanceof HTMLLabelElement&&o.click()}});li({document$:rt});mi({document$:rt,tablet$:ur});fi({document$:rt});ui({viewport$:_e,tablet$:ur});var tt=Rn(Te("header"),{viewport$:_e}),$t=rt.pipe(m(()=>Te("main")),v(e=>Fn(e,{viewport$:_e,header$:tt})),B(1)),rs=T(...ie("consent").map(e=>fn(e,{target$:wt})),...ie("dialog").map(e=>$n(e,{alert$:Gr})),...ie("header").map(e=>Pn(e,{viewport$:_e,header$:tt,main$:$t})),...ie("palette").map(e=>jn(e)),...ie("progress").map(e=>Un(e,{progress$:Jr})),...ie("search").map(e=>ti(e,{index$:vi,keyboard$:Br})),...ie("source").map(e=>ai(e))),os=H(()=>T(...ie("announce").map(e=>mn(e)),...ie("content").map(e=>Hn(e,{viewport$:_e,target$:wt,print$:bi})),...ie("content").map(e=>G("search.highlight")?ri(e,{index$:vi,location$:Rt}):L),...ie("header-title").map(e=>In(e,{viewport$:_e,header$:tt})),...ie("sidebar").map(e=>e.getAttribute("data-md-type")==="navigation"?Ur(hi,()=>Qr(e,{viewport$:_e,header$:tt,main$:$t})):Ur(ur,()=>Qr(e,{viewport$:_e,header$:tt,main$:$t}))),...ie("tabs").map(e=>si(e,{viewport$:_e,header$:tt})),...ie("toc").map(e=>ci(e,{viewport$:_e,header$:tt,main$:$t,target$:wt})),...ie("top").map(e=>pi(e,{viewport$:_e,header$:tt,main$:$t,target$:wt})))),gi=rt.pipe(v(()=>os),$e(rs),B(1));gi.subscribe();window.document$=rt;window.location$=Rt;window.target$=wt;window.keyboard$=Br;window.viewport$=_e;window.tablet$=ur;window.screen$=hi;window.print$=bi;window.alert$=Gr;window.progress$=Jr;window.component$=gi;})(); +//# sourceMappingURL=bundle.1e8ae164.min.js.map + diff --git a/assets/javascripts/bundle.e1c3ead8.min.js.map b/assets/javascripts/bundle.1e8ae164.min.js.map similarity index 73% rename from assets/javascripts/bundle.e1c3ead8.min.js.map rename to assets/javascripts/bundle.1e8ae164.min.js.map index 5449148c..6c33b8e8 100644 --- a/assets/javascripts/bundle.e1c3ead8.min.js.map +++ b/assets/javascripts/bundle.1e8ae164.min.js.map @@ -1,7 +1,7 @@ { "version": 3, "sources": ["node_modules/focus-visible/dist/focus-visible.js", "node_modules/clipboard/dist/clipboard.js", "node_modules/escape-html/index.js", "src/templates/assets/javascripts/bundle.ts", "node_modules/rxjs/node_modules/tslib/tslib.es6.js", "node_modules/rxjs/src/internal/util/isFunction.ts", "node_modules/rxjs/src/internal/util/createErrorClass.ts", "node_modules/rxjs/src/internal/util/UnsubscriptionError.ts", "node_modules/rxjs/src/internal/util/arrRemove.ts", "node_modules/rxjs/src/internal/Subscription.ts", "node_modules/rxjs/src/internal/config.ts", "node_modules/rxjs/src/internal/scheduler/timeoutProvider.ts", "node_modules/rxjs/src/internal/util/reportUnhandledError.ts", "node_modules/rxjs/src/internal/util/noop.ts", "node_modules/rxjs/src/internal/NotificationFactories.ts", "node_modules/rxjs/src/internal/util/errorContext.ts", "node_modules/rxjs/src/internal/Subscriber.ts", "node_modules/rxjs/src/internal/symbol/observable.ts", "node_modules/rxjs/src/internal/util/identity.ts", "node_modules/rxjs/src/internal/util/pipe.ts", "node_modules/rxjs/src/internal/Observable.ts", "node_modules/rxjs/src/internal/util/lift.ts", "node_modules/rxjs/src/internal/operators/OperatorSubscriber.ts", "node_modules/rxjs/src/internal/scheduler/animationFrameProvider.ts", "node_modules/rxjs/src/internal/util/ObjectUnsubscribedError.ts", "node_modules/rxjs/src/internal/Subject.ts", "node_modules/rxjs/src/internal/scheduler/dateTimestampProvider.ts", "node_modules/rxjs/src/internal/ReplaySubject.ts", "node_modules/rxjs/src/internal/scheduler/Action.ts", "node_modules/rxjs/src/internal/scheduler/intervalProvider.ts", "node_modules/rxjs/src/internal/scheduler/AsyncAction.ts", "node_modules/rxjs/src/internal/Scheduler.ts", "node_modules/rxjs/src/internal/scheduler/AsyncScheduler.ts", "node_modules/rxjs/src/internal/scheduler/async.ts", "node_modules/rxjs/src/internal/scheduler/AnimationFrameAction.ts", "node_modules/rxjs/src/internal/scheduler/AnimationFrameScheduler.ts", "node_modules/rxjs/src/internal/scheduler/animationFrame.ts", "node_modules/rxjs/src/internal/observable/empty.ts", "node_modules/rxjs/src/internal/util/isScheduler.ts", "node_modules/rxjs/src/internal/util/args.ts", "node_modules/rxjs/src/internal/util/isArrayLike.ts", "node_modules/rxjs/src/internal/util/isPromise.ts", "node_modules/rxjs/src/internal/util/isInteropObservable.ts", "node_modules/rxjs/src/internal/util/isAsyncIterable.ts", "node_modules/rxjs/src/internal/util/throwUnobservableError.ts", "node_modules/rxjs/src/internal/symbol/iterator.ts", "node_modules/rxjs/src/internal/util/isIterable.ts", "node_modules/rxjs/src/internal/util/isReadableStreamLike.ts", "node_modules/rxjs/src/internal/observable/innerFrom.ts", "node_modules/rxjs/src/internal/util/executeSchedule.ts", "node_modules/rxjs/src/internal/operators/observeOn.ts", "node_modules/rxjs/src/internal/operators/subscribeOn.ts", "node_modules/rxjs/src/internal/scheduled/scheduleObservable.ts", "node_modules/rxjs/src/internal/scheduled/schedulePromise.ts", "node_modules/rxjs/src/internal/scheduled/scheduleArray.ts", "node_modules/rxjs/src/internal/scheduled/scheduleIterable.ts", "node_modules/rxjs/src/internal/scheduled/scheduleAsyncIterable.ts", "node_modules/rxjs/src/internal/scheduled/scheduleReadableStreamLike.ts", "node_modules/rxjs/src/internal/scheduled/scheduled.ts", "node_modules/rxjs/src/internal/observable/from.ts", "node_modules/rxjs/src/internal/observable/of.ts", "node_modules/rxjs/src/internal/observable/throwError.ts", "node_modules/rxjs/src/internal/util/EmptyError.ts", "node_modules/rxjs/src/internal/util/isDate.ts", "node_modules/rxjs/src/internal/operators/map.ts", "node_modules/rxjs/src/internal/util/mapOneOrManyArgs.ts", "node_modules/rxjs/src/internal/util/argsArgArrayOrObject.ts", "node_modules/rxjs/src/internal/util/createObject.ts", "node_modules/rxjs/src/internal/observable/combineLatest.ts", "node_modules/rxjs/src/internal/operators/mergeInternals.ts", "node_modules/rxjs/src/internal/operators/mergeMap.ts", "node_modules/rxjs/src/internal/operators/mergeAll.ts", "node_modules/rxjs/src/internal/operators/concatAll.ts", "node_modules/rxjs/src/internal/observable/concat.ts", "node_modules/rxjs/src/internal/observable/defer.ts", "node_modules/rxjs/src/internal/observable/fromEvent.ts", "node_modules/rxjs/src/internal/observable/fromEventPattern.ts", "node_modules/rxjs/src/internal/observable/timer.ts", "node_modules/rxjs/src/internal/observable/merge.ts", "node_modules/rxjs/src/internal/observable/never.ts", "node_modules/rxjs/src/internal/util/argsOrArgArray.ts", "node_modules/rxjs/src/internal/operators/filter.ts", "node_modules/rxjs/src/internal/observable/zip.ts", "node_modules/rxjs/src/internal/operators/audit.ts", "node_modules/rxjs/src/internal/operators/auditTime.ts", "node_modules/rxjs/src/internal/operators/bufferCount.ts", "node_modules/rxjs/src/internal/operators/catchError.ts", "node_modules/rxjs/src/internal/operators/scanInternals.ts", "node_modules/rxjs/src/internal/operators/combineLatest.ts", "node_modules/rxjs/src/internal/operators/combineLatestWith.ts", "node_modules/rxjs/src/internal/operators/debounceTime.ts", "node_modules/rxjs/src/internal/operators/defaultIfEmpty.ts", "node_modules/rxjs/src/internal/operators/take.ts", "node_modules/rxjs/src/internal/operators/ignoreElements.ts", "node_modules/rxjs/src/internal/operators/mapTo.ts", "node_modules/rxjs/src/internal/operators/delayWhen.ts", "node_modules/rxjs/src/internal/operators/delay.ts", "node_modules/rxjs/src/internal/operators/distinctUntilChanged.ts", "node_modules/rxjs/src/internal/operators/distinctUntilKeyChanged.ts", "node_modules/rxjs/src/internal/operators/throwIfEmpty.ts", "node_modules/rxjs/src/internal/operators/endWith.ts", "node_modules/rxjs/src/internal/operators/finalize.ts", "node_modules/rxjs/src/internal/operators/first.ts", "node_modules/rxjs/src/internal/operators/takeLast.ts", "node_modules/rxjs/src/internal/operators/merge.ts", "node_modules/rxjs/src/internal/operators/mergeWith.ts", "node_modules/rxjs/src/internal/operators/repeat.ts", "node_modules/rxjs/src/internal/operators/scan.ts", "node_modules/rxjs/src/internal/operators/share.ts", "node_modules/rxjs/src/internal/operators/shareReplay.ts", "node_modules/rxjs/src/internal/operators/skip.ts", "node_modules/rxjs/src/internal/operators/skipUntil.ts", "node_modules/rxjs/src/internal/operators/startWith.ts", "node_modules/rxjs/src/internal/operators/switchMap.ts", "node_modules/rxjs/src/internal/operators/takeUntil.ts", "node_modules/rxjs/src/internal/operators/takeWhile.ts", "node_modules/rxjs/src/internal/operators/tap.ts", "node_modules/rxjs/src/internal/operators/throttle.ts", "node_modules/rxjs/src/internal/operators/throttleTime.ts", "node_modules/rxjs/src/internal/operators/withLatestFrom.ts", "node_modules/rxjs/src/internal/operators/zip.ts", "node_modules/rxjs/src/internal/operators/zipWith.ts", "src/templates/assets/javascripts/browser/document/index.ts", "src/templates/assets/javascripts/browser/element/_/index.ts", "src/templates/assets/javascripts/browser/element/focus/index.ts", "src/templates/assets/javascripts/browser/element/hover/index.ts", "src/templates/assets/javascripts/browser/element/offset/_/index.ts", "src/templates/assets/javascripts/browser/element/offset/content/index.ts", "src/templates/assets/javascripts/utilities/h/index.ts", "src/templates/assets/javascripts/utilities/round/index.ts", "src/templates/assets/javascripts/browser/script/index.ts", "src/templates/assets/javascripts/browser/element/size/_/index.ts", "src/templates/assets/javascripts/browser/element/size/content/index.ts", "src/templates/assets/javascripts/browser/element/visibility/index.ts", "src/templates/assets/javascripts/browser/toggle/index.ts", "src/templates/assets/javascripts/browser/keyboard/index.ts", "src/templates/assets/javascripts/browser/location/_/index.ts", "src/templates/assets/javascripts/browser/location/hash/index.ts", "src/templates/assets/javascripts/browser/media/index.ts", "src/templates/assets/javascripts/browser/request/index.ts", "src/templates/assets/javascripts/browser/viewport/offset/index.ts", "src/templates/assets/javascripts/browser/viewport/size/index.ts", "src/templates/assets/javascripts/browser/viewport/_/index.ts", "src/templates/assets/javascripts/browser/viewport/at/index.ts", "src/templates/assets/javascripts/browser/worker/index.ts", "src/templates/assets/javascripts/_/index.ts", "src/templates/assets/javascripts/components/_/index.ts", "src/templates/assets/javascripts/components/announce/index.ts", "src/templates/assets/javascripts/components/consent/index.ts", "src/templates/assets/javascripts/templates/tooltip/index.tsx", "src/templates/assets/javascripts/templates/annotation/index.tsx", "src/templates/assets/javascripts/templates/clipboard/index.tsx", "src/templates/assets/javascripts/templates/search/index.tsx", "src/templates/assets/javascripts/templates/source/index.tsx", "src/templates/assets/javascripts/templates/tabbed/index.tsx", "src/templates/assets/javascripts/templates/table/index.tsx", "src/templates/assets/javascripts/templates/version/index.tsx", "src/templates/assets/javascripts/components/tooltip/index.ts", "src/templates/assets/javascripts/components/content/annotation/_/index.ts", "src/templates/assets/javascripts/components/content/annotation/list/index.ts", "src/templates/assets/javascripts/components/content/annotation/block/index.ts", "src/templates/assets/javascripts/components/content/code/_/index.ts", "src/templates/assets/javascripts/components/content/details/index.ts", "src/templates/assets/javascripts/components/content/mermaid/index.css", "src/templates/assets/javascripts/components/content/mermaid/index.ts", "src/templates/assets/javascripts/components/content/table/index.ts", "src/templates/assets/javascripts/components/content/tabs/index.ts", "src/templates/assets/javascripts/components/content/_/index.ts", "src/templates/assets/javascripts/components/dialog/index.ts", "src/templates/assets/javascripts/components/header/_/index.ts", "src/templates/assets/javascripts/components/header/title/index.ts", "src/templates/assets/javascripts/components/main/index.ts", "src/templates/assets/javascripts/components/palette/index.ts", "src/templates/assets/javascripts/components/progress/index.ts", "src/templates/assets/javascripts/integrations/clipboard/index.ts", "src/templates/assets/javascripts/integrations/sitemap/index.ts", "src/templates/assets/javascripts/integrations/instant/index.ts", "src/templates/assets/javascripts/integrations/search/highlighter/index.ts", "src/templates/assets/javascripts/integrations/search/worker/message/index.ts", "src/templates/assets/javascripts/integrations/search/worker/_/index.ts", "src/templates/assets/javascripts/integrations/version/index.ts", "src/templates/assets/javascripts/components/search/query/index.ts", "src/templates/assets/javascripts/components/search/result/index.ts", "src/templates/assets/javascripts/components/search/share/index.ts", "src/templates/assets/javascripts/components/search/suggest/index.ts", "src/templates/assets/javascripts/components/search/_/index.ts", "src/templates/assets/javascripts/components/search/highlight/index.ts", "src/templates/assets/javascripts/components/sidebar/index.ts", "src/templates/assets/javascripts/components/source/facts/github/index.ts", "src/templates/assets/javascripts/components/source/facts/gitlab/index.ts", "src/templates/assets/javascripts/components/source/facts/_/index.ts", "src/templates/assets/javascripts/components/source/_/index.ts", "src/templates/assets/javascripts/components/tabs/index.ts", "src/templates/assets/javascripts/components/toc/index.ts", "src/templates/assets/javascripts/components/top/index.ts", "src/templates/assets/javascripts/patches/ellipsis/index.ts", "src/templates/assets/javascripts/patches/indeterminate/index.ts", "src/templates/assets/javascripts/patches/scrollfix/index.ts", "src/templates/assets/javascripts/patches/scrolllock/index.ts", "src/templates/assets/javascripts/polyfills/index.ts"], - "sourcesContent": ["(function (global, factory) {\n typeof exports === 'object' && typeof module !== 'undefined' ? factory() :\n typeof define === 'function' && define.amd ? define(factory) :\n (factory());\n}(this, (function () { 'use strict';\n\n /**\n * Applies the :focus-visible polyfill at the given scope.\n * A scope in this case is either the top-level Document or a Shadow Root.\n *\n * @param {(Document|ShadowRoot)} scope\n * @see https://github.com/WICG/focus-visible\n */\n function applyFocusVisiblePolyfill(scope) {\n var hadKeyboardEvent = true;\n var hadFocusVisibleRecently = false;\n var hadFocusVisibleRecentlyTimeout = null;\n\n var inputTypesAllowlist = {\n text: true,\n search: true,\n url: true,\n tel: true,\n email: true,\n password: true,\n number: true,\n date: true,\n month: true,\n week: true,\n time: true,\n datetime: true,\n 'datetime-local': true\n };\n\n /**\n * Helper function for legacy browsers and iframes which sometimes focus\n * elements like document, body, and non-interactive SVG.\n * @param {Element} el\n */\n function isValidFocusTarget(el) {\n if (\n el &&\n el !== document &&\n el.nodeName !== 'HTML' &&\n el.nodeName !== 'BODY' &&\n 'classList' in el &&\n 'contains' in el.classList\n ) {\n return true;\n }\n return false;\n }\n\n /**\n * Computes whether the given element should automatically trigger the\n * `focus-visible` class being added, i.e. whether it should always match\n * `:focus-visible` when focused.\n * @param {Element} el\n * @return {boolean}\n */\n function focusTriggersKeyboardModality(el) {\n var type = el.type;\n var tagName = el.tagName;\n\n if (tagName === 'INPUT' && inputTypesAllowlist[type] && !el.readOnly) {\n return true;\n }\n\n if (tagName === 'TEXTAREA' && !el.readOnly) {\n return true;\n }\n\n if (el.isContentEditable) {\n return true;\n }\n\n return false;\n }\n\n /**\n * Add the `focus-visible` class to the given element if it was not added by\n * the author.\n * @param {Element} el\n */\n function addFocusVisibleClass(el) {\n if (el.classList.contains('focus-visible')) {\n return;\n }\n el.classList.add('focus-visible');\n el.setAttribute('data-focus-visible-added', '');\n }\n\n /**\n * Remove the `focus-visible` class from the given element if it was not\n * originally added by the author.\n * @param {Element} el\n */\n function removeFocusVisibleClass(el) {\n if (!el.hasAttribute('data-focus-visible-added')) {\n return;\n }\n el.classList.remove('focus-visible');\n el.removeAttribute('data-focus-visible-added');\n }\n\n /**\n * If the most recent user interaction was via the keyboard;\n * and the key press did not include a meta, alt/option, or control key;\n * then the modality is keyboard. Otherwise, the modality is not keyboard.\n * Apply `focus-visible` to any current active element and keep track\n * of our keyboard modality state with `hadKeyboardEvent`.\n * @param {KeyboardEvent} e\n */\n function onKeyDown(e) {\n if (e.metaKey || e.altKey || e.ctrlKey) {\n return;\n }\n\n if (isValidFocusTarget(scope.activeElement)) {\n addFocusVisibleClass(scope.activeElement);\n }\n\n hadKeyboardEvent = true;\n }\n\n /**\n * If at any point a user clicks with a pointing device, ensure that we change\n * the modality away from keyboard.\n * This avoids the situation where a user presses a key on an already focused\n * element, and then clicks on a different element, focusing it with a\n * pointing device, while we still think we're in keyboard modality.\n * @param {Event} e\n */\n function onPointerDown(e) {\n hadKeyboardEvent = false;\n }\n\n /**\n * On `focus`, add the `focus-visible` class to the target if:\n * - the target received focus as a result of keyboard navigation, or\n * - the event target is an element that will likely require interaction\n * via the keyboard (e.g. a text box)\n * @param {Event} e\n */\n function onFocus(e) {\n // Prevent IE from focusing the document or HTML element.\n if (!isValidFocusTarget(e.target)) {\n return;\n }\n\n if (hadKeyboardEvent || focusTriggersKeyboardModality(e.target)) {\n addFocusVisibleClass(e.target);\n }\n }\n\n /**\n * On `blur`, remove the `focus-visible` class from the target.\n * @param {Event} e\n */\n function onBlur(e) {\n if (!isValidFocusTarget(e.target)) {\n return;\n }\n\n if (\n e.target.classList.contains('focus-visible') ||\n e.target.hasAttribute('data-focus-visible-added')\n ) {\n // To detect a tab/window switch, we look for a blur event followed\n // rapidly by a visibility change.\n // If we don't see a visibility change within 100ms, it's probably a\n // regular focus change.\n hadFocusVisibleRecently = true;\n window.clearTimeout(hadFocusVisibleRecentlyTimeout);\n hadFocusVisibleRecentlyTimeout = window.setTimeout(function() {\n hadFocusVisibleRecently = false;\n }, 100);\n removeFocusVisibleClass(e.target);\n }\n }\n\n /**\n * If the user changes tabs, keep track of whether or not the previously\n * focused element had .focus-visible.\n * @param {Event} e\n */\n function onVisibilityChange(e) {\n if (document.visibilityState === 'hidden') {\n // If the tab becomes active again, the browser will handle calling focus\n // on the element (Safari actually calls it twice).\n // If this tab change caused a blur on an element with focus-visible,\n // re-apply the class when the user switches back to the tab.\n if (hadFocusVisibleRecently) {\n hadKeyboardEvent = true;\n }\n addInitialPointerMoveListeners();\n }\n }\n\n /**\n * Add a group of listeners to detect usage of any pointing devices.\n * These listeners will be added when the polyfill first loads, and anytime\n * the window is blurred, so that they are active when the window regains\n * focus.\n */\n function addInitialPointerMoveListeners() {\n document.addEventListener('mousemove', onInitialPointerMove);\n document.addEventListener('mousedown', onInitialPointerMove);\n document.addEventListener('mouseup', onInitialPointerMove);\n document.addEventListener('pointermove', onInitialPointerMove);\n document.addEventListener('pointerdown', onInitialPointerMove);\n document.addEventListener('pointerup', onInitialPointerMove);\n document.addEventListener('touchmove', onInitialPointerMove);\n document.addEventListener('touchstart', onInitialPointerMove);\n document.addEventListener('touchend', onInitialPointerMove);\n }\n\n function removeInitialPointerMoveListeners() {\n document.removeEventListener('mousemove', onInitialPointerMove);\n document.removeEventListener('mousedown', onInitialPointerMove);\n document.removeEventListener('mouseup', onInitialPointerMove);\n document.removeEventListener('pointermove', onInitialPointerMove);\n document.removeEventListener('pointerdown', onInitialPointerMove);\n document.removeEventListener('pointerup', onInitialPointerMove);\n document.removeEventListener('touchmove', onInitialPointerMove);\n document.removeEventListener('touchstart', onInitialPointerMove);\n document.removeEventListener('touchend', onInitialPointerMove);\n }\n\n /**\n * When the polfyill first loads, assume the user is in keyboard modality.\n * If any event is received from a pointing device (e.g. mouse, pointer,\n * touch), turn off keyboard modality.\n * This accounts for situations where focus enters the page from the URL bar.\n * @param {Event} e\n */\n function onInitialPointerMove(e) {\n // Work around a Safari quirk that fires a mousemove on whenever the\n // window blurs, even if you're tabbing out of the page. \u00AF\\_(\u30C4)_/\u00AF\n if (e.target.nodeName && e.target.nodeName.toLowerCase() === 'html') {\n return;\n }\n\n hadKeyboardEvent = false;\n removeInitialPointerMoveListeners();\n }\n\n // For some kinds of state, we are interested in changes at the global scope\n // only. For example, global pointer input, global key presses and global\n // visibility change should affect the state at every scope:\n document.addEventListener('keydown', onKeyDown, true);\n document.addEventListener('mousedown', onPointerDown, true);\n document.addEventListener('pointerdown', onPointerDown, true);\n document.addEventListener('touchstart', onPointerDown, true);\n document.addEventListener('visibilitychange', onVisibilityChange, true);\n\n addInitialPointerMoveListeners();\n\n // For focus and blur, we specifically care about state changes in the local\n // scope. This is because focus / blur events that originate from within a\n // shadow root are not re-dispatched from the host element if it was already\n // the active element in its own scope:\n scope.addEventListener('focus', onFocus, true);\n scope.addEventListener('blur', onBlur, true);\n\n // We detect that a node is a ShadowRoot by ensuring that it is a\n // DocumentFragment and also has a host property. This check covers native\n // implementation and polyfill implementation transparently. If we only cared\n // about the native implementation, we could just check if the scope was\n // an instance of a ShadowRoot.\n if (scope.nodeType === Node.DOCUMENT_FRAGMENT_NODE && scope.host) {\n // Since a ShadowRoot is a special kind of DocumentFragment, it does not\n // have a root element to add a class to. So, we add this attribute to the\n // host element instead:\n scope.host.setAttribute('data-js-focus-visible', '');\n } else if (scope.nodeType === Node.DOCUMENT_NODE) {\n document.documentElement.classList.add('js-focus-visible');\n document.documentElement.setAttribute('data-js-focus-visible', '');\n }\n }\n\n // It is important to wrap all references to global window and document in\n // these checks to support server-side rendering use cases\n // @see https://github.com/WICG/focus-visible/issues/199\n if (typeof window !== 'undefined' && typeof document !== 'undefined') {\n // Make the polyfill helper globally available. This can be used as a signal\n // to interested libraries that wish to coordinate with the polyfill for e.g.,\n // applying the polyfill to a shadow root:\n window.applyFocusVisiblePolyfill = applyFocusVisiblePolyfill;\n\n // Notify interested libraries of the polyfill's presence, in case the\n // polyfill was loaded lazily:\n var event;\n\n try {\n event = new CustomEvent('focus-visible-polyfill-ready');\n } catch (error) {\n // IE11 does not support using CustomEvent as a constructor directly:\n event = document.createEvent('CustomEvent');\n event.initCustomEvent('focus-visible-polyfill-ready', false, false, {});\n }\n\n window.dispatchEvent(event);\n }\n\n if (typeof document !== 'undefined') {\n // Apply the polyfill to the global document, so that no JavaScript\n // coordination is required to use the polyfill in the top-level document:\n applyFocusVisiblePolyfill(document);\n }\n\n})));\n", "/*!\n * clipboard.js v2.0.11\n * https://clipboardjs.com/\n *\n * Licensed MIT \u00A9 Zeno Rocha\n */\n(function webpackUniversalModuleDefinition(root, factory) {\n\tif(typeof exports === 'object' && typeof module === 'object')\n\t\tmodule.exports = factory();\n\telse if(typeof define === 'function' && define.amd)\n\t\tdefine([], factory);\n\telse if(typeof exports === 'object')\n\t\texports[\"ClipboardJS\"] = factory();\n\telse\n\t\troot[\"ClipboardJS\"] = factory();\n})(this, function() {\nreturn /******/ (function() { // webpackBootstrap\n/******/ \tvar __webpack_modules__ = ({\n\n/***/ 686:\n/***/ (function(__unused_webpack_module, __webpack_exports__, __webpack_require__) {\n\n\"use strict\";\n\n// EXPORTS\n__webpack_require__.d(__webpack_exports__, {\n \"default\": function() { return /* binding */ clipboard; }\n});\n\n// EXTERNAL MODULE: ./node_modules/tiny-emitter/index.js\nvar tiny_emitter = __webpack_require__(279);\nvar tiny_emitter_default = /*#__PURE__*/__webpack_require__.n(tiny_emitter);\n// EXTERNAL MODULE: ./node_modules/good-listener/src/listen.js\nvar listen = __webpack_require__(370);\nvar listen_default = /*#__PURE__*/__webpack_require__.n(listen);\n// EXTERNAL MODULE: ./node_modules/select/src/select.js\nvar src_select = __webpack_require__(817);\nvar select_default = /*#__PURE__*/__webpack_require__.n(src_select);\n;// CONCATENATED MODULE: ./src/common/command.js\n/**\n * Executes a given operation type.\n * @param {String} type\n * @return {Boolean}\n */\nfunction command(type) {\n try {\n return document.execCommand(type);\n } catch (err) {\n return false;\n }\n}\n;// CONCATENATED MODULE: ./src/actions/cut.js\n\n\n/**\n * Cut action wrapper.\n * @param {String|HTMLElement} target\n * @return {String}\n */\n\nvar ClipboardActionCut = function ClipboardActionCut(target) {\n var selectedText = select_default()(target);\n command('cut');\n return selectedText;\n};\n\n/* harmony default export */ var actions_cut = (ClipboardActionCut);\n;// CONCATENATED MODULE: ./src/common/create-fake-element.js\n/**\n * Creates a fake textarea element with a value.\n * @param {String} value\n * @return {HTMLElement}\n */\nfunction createFakeElement(value) {\n var isRTL = document.documentElement.getAttribute('dir') === 'rtl';\n var fakeElement = document.createElement('textarea'); // Prevent zooming on iOS\n\n fakeElement.style.fontSize = '12pt'; // Reset box model\n\n fakeElement.style.border = '0';\n fakeElement.style.padding = '0';\n fakeElement.style.margin = '0'; // Move element out of screen horizontally\n\n fakeElement.style.position = 'absolute';\n fakeElement.style[isRTL ? 'right' : 'left'] = '-9999px'; // Move element to the same position vertically\n\n var yPosition = window.pageYOffset || document.documentElement.scrollTop;\n fakeElement.style.top = \"\".concat(yPosition, \"px\");\n fakeElement.setAttribute('readonly', '');\n fakeElement.value = value;\n return fakeElement;\n}\n;// CONCATENATED MODULE: ./src/actions/copy.js\n\n\n\n/**\n * Create fake copy action wrapper using a fake element.\n * @param {String} target\n * @param {Object} options\n * @return {String}\n */\n\nvar fakeCopyAction = function fakeCopyAction(value, options) {\n var fakeElement = createFakeElement(value);\n options.container.appendChild(fakeElement);\n var selectedText = select_default()(fakeElement);\n command('copy');\n fakeElement.remove();\n return selectedText;\n};\n/**\n * Copy action wrapper.\n * @param {String|HTMLElement} target\n * @param {Object} options\n * @return {String}\n */\n\n\nvar ClipboardActionCopy = function ClipboardActionCopy(target) {\n var options = arguments.length > 1 && arguments[1] !== undefined ? arguments[1] : {\n container: document.body\n };\n var selectedText = '';\n\n if (typeof target === 'string') {\n selectedText = fakeCopyAction(target, options);\n } else if (target instanceof HTMLInputElement && !['text', 'search', 'url', 'tel', 'password'].includes(target === null || target === void 0 ? void 0 : target.type)) {\n // If input type doesn't support `setSelectionRange`. Simulate it. https://developer.mozilla.org/en-US/docs/Web/API/HTMLInputElement/setSelectionRange\n selectedText = fakeCopyAction(target.value, options);\n } else {\n selectedText = select_default()(target);\n command('copy');\n }\n\n return selectedText;\n};\n\n/* harmony default export */ var actions_copy = (ClipboardActionCopy);\n;// CONCATENATED MODULE: ./src/actions/default.js\nfunction _typeof(obj) { \"@babel/helpers - typeof\"; if (typeof Symbol === \"function\" && typeof Symbol.iterator === \"symbol\") { _typeof = function _typeof(obj) { return typeof obj; }; } else { _typeof = function _typeof(obj) { return obj && typeof Symbol === \"function\" && obj.constructor === Symbol && obj !== Symbol.prototype ? \"symbol\" : typeof obj; }; } return _typeof(obj); }\n\n\n\n/**\n * Inner function which performs selection from either `text` or `target`\n * properties and then executes copy or cut operations.\n * @param {Object} options\n */\n\nvar ClipboardActionDefault = function ClipboardActionDefault() {\n var options = arguments.length > 0 && arguments[0] !== undefined ? arguments[0] : {};\n // Defines base properties passed from constructor.\n var _options$action = options.action,\n action = _options$action === void 0 ? 'copy' : _options$action,\n container = options.container,\n target = options.target,\n text = options.text; // Sets the `action` to be performed which can be either 'copy' or 'cut'.\n\n if (action !== 'copy' && action !== 'cut') {\n throw new Error('Invalid \"action\" value, use either \"copy\" or \"cut\"');\n } // Sets the `target` property using an element that will be have its content copied.\n\n\n if (target !== undefined) {\n if (target && _typeof(target) === 'object' && target.nodeType === 1) {\n if (action === 'copy' && target.hasAttribute('disabled')) {\n throw new Error('Invalid \"target\" attribute. Please use \"readonly\" instead of \"disabled\" attribute');\n }\n\n if (action === 'cut' && (target.hasAttribute('readonly') || target.hasAttribute('disabled'))) {\n throw new Error('Invalid \"target\" attribute. You can\\'t cut text from elements with \"readonly\" or \"disabled\" attributes');\n }\n } else {\n throw new Error('Invalid \"target\" value, use a valid Element');\n }\n } // Define selection strategy based on `text` property.\n\n\n if (text) {\n return actions_copy(text, {\n container: container\n });\n } // Defines which selection strategy based on `target` property.\n\n\n if (target) {\n return action === 'cut' ? actions_cut(target) : actions_copy(target, {\n container: container\n });\n }\n};\n\n/* harmony default export */ var actions_default = (ClipboardActionDefault);\n;// CONCATENATED MODULE: ./src/clipboard.js\nfunction clipboard_typeof(obj) { \"@babel/helpers - typeof\"; if (typeof Symbol === \"function\" && typeof Symbol.iterator === \"symbol\") { clipboard_typeof = function _typeof(obj) { return typeof obj; }; } else { clipboard_typeof = function _typeof(obj) { return obj && typeof Symbol === \"function\" && obj.constructor === Symbol && obj !== Symbol.prototype ? \"symbol\" : typeof obj; }; } return clipboard_typeof(obj); }\n\nfunction _classCallCheck(instance, Constructor) { if (!(instance instanceof Constructor)) { throw new TypeError(\"Cannot call a class as a function\"); } }\n\nfunction _defineProperties(target, props) { for (var i = 0; i < props.length; i++) { var descriptor = props[i]; descriptor.enumerable = descriptor.enumerable || false; descriptor.configurable = true; if (\"value\" in descriptor) descriptor.writable = true; Object.defineProperty(target, descriptor.key, descriptor); } }\n\nfunction _createClass(Constructor, protoProps, staticProps) { if (protoProps) _defineProperties(Constructor.prototype, protoProps); if (staticProps) _defineProperties(Constructor, staticProps); return Constructor; }\n\nfunction _inherits(subClass, superClass) { if (typeof superClass !== \"function\" && superClass !== null) { throw new TypeError(\"Super expression must either be null or a function\"); } subClass.prototype = Object.create(superClass && superClass.prototype, { constructor: { value: subClass, writable: true, configurable: true } }); if (superClass) _setPrototypeOf(subClass, superClass); }\n\nfunction _setPrototypeOf(o, p) { _setPrototypeOf = Object.setPrototypeOf || function _setPrototypeOf(o, p) { o.__proto__ = p; return o; }; return _setPrototypeOf(o, p); }\n\nfunction _createSuper(Derived) { var hasNativeReflectConstruct = _isNativeReflectConstruct(); return function _createSuperInternal() { var Super = _getPrototypeOf(Derived), result; if (hasNativeReflectConstruct) { var NewTarget = _getPrototypeOf(this).constructor; result = Reflect.construct(Super, arguments, NewTarget); } else { result = Super.apply(this, arguments); } return _possibleConstructorReturn(this, result); }; }\n\nfunction _possibleConstructorReturn(self, call) { if (call && (clipboard_typeof(call) === \"object\" || typeof call === \"function\")) { return call; } return _assertThisInitialized(self); }\n\nfunction _assertThisInitialized(self) { if (self === void 0) { throw new ReferenceError(\"this hasn't been initialised - super() hasn't been called\"); } return self; }\n\nfunction _isNativeReflectConstruct() { if (typeof Reflect === \"undefined\" || !Reflect.construct) return false; if (Reflect.construct.sham) return false; if (typeof Proxy === \"function\") return true; try { Date.prototype.toString.call(Reflect.construct(Date, [], function () {})); return true; } catch (e) { return false; } }\n\nfunction _getPrototypeOf(o) { _getPrototypeOf = Object.setPrototypeOf ? Object.getPrototypeOf : function _getPrototypeOf(o) { return o.__proto__ || Object.getPrototypeOf(o); }; return _getPrototypeOf(o); }\n\n\n\n\n\n\n/**\n * Helper function to retrieve attribute value.\n * @param {String} suffix\n * @param {Element} element\n */\n\nfunction getAttributeValue(suffix, element) {\n var attribute = \"data-clipboard-\".concat(suffix);\n\n if (!element.hasAttribute(attribute)) {\n return;\n }\n\n return element.getAttribute(attribute);\n}\n/**\n * Base class which takes one or more elements, adds event listeners to them,\n * and instantiates a new `ClipboardAction` on each click.\n */\n\n\nvar Clipboard = /*#__PURE__*/function (_Emitter) {\n _inherits(Clipboard, _Emitter);\n\n var _super = _createSuper(Clipboard);\n\n /**\n * @param {String|HTMLElement|HTMLCollection|NodeList} trigger\n * @param {Object} options\n */\n function Clipboard(trigger, options) {\n var _this;\n\n _classCallCheck(this, Clipboard);\n\n _this = _super.call(this);\n\n _this.resolveOptions(options);\n\n _this.listenClick(trigger);\n\n return _this;\n }\n /**\n * Defines if attributes would be resolved using internal setter functions\n * or custom functions that were passed in the constructor.\n * @param {Object} options\n */\n\n\n _createClass(Clipboard, [{\n key: \"resolveOptions\",\n value: function resolveOptions() {\n var options = arguments.length > 0 && arguments[0] !== undefined ? arguments[0] : {};\n this.action = typeof options.action === 'function' ? options.action : this.defaultAction;\n this.target = typeof options.target === 'function' ? options.target : this.defaultTarget;\n this.text = typeof options.text === 'function' ? options.text : this.defaultText;\n this.container = clipboard_typeof(options.container) === 'object' ? options.container : document.body;\n }\n /**\n * Adds a click event listener to the passed trigger.\n * @param {String|HTMLElement|HTMLCollection|NodeList} trigger\n */\n\n }, {\n key: \"listenClick\",\n value: function listenClick(trigger) {\n var _this2 = this;\n\n this.listener = listen_default()(trigger, 'click', function (e) {\n return _this2.onClick(e);\n });\n }\n /**\n * Defines a new `ClipboardAction` on each click event.\n * @param {Event} e\n */\n\n }, {\n key: \"onClick\",\n value: function onClick(e) {\n var trigger = e.delegateTarget || e.currentTarget;\n var action = this.action(trigger) || 'copy';\n var text = actions_default({\n action: action,\n container: this.container,\n target: this.target(trigger),\n text: this.text(trigger)\n }); // Fires an event based on the copy operation result.\n\n this.emit(text ? 'success' : 'error', {\n action: action,\n text: text,\n trigger: trigger,\n clearSelection: function clearSelection() {\n if (trigger) {\n trigger.focus();\n }\n\n window.getSelection().removeAllRanges();\n }\n });\n }\n /**\n * Default `action` lookup function.\n * @param {Element} trigger\n */\n\n }, {\n key: \"defaultAction\",\n value: function defaultAction(trigger) {\n return getAttributeValue('action', trigger);\n }\n /**\n * Default `target` lookup function.\n * @param {Element} trigger\n */\n\n }, {\n key: \"defaultTarget\",\n value: function defaultTarget(trigger) {\n var selector = getAttributeValue('target', trigger);\n\n if (selector) {\n return document.querySelector(selector);\n }\n }\n /**\n * Allow fire programmatically a copy action\n * @param {String|HTMLElement} target\n * @param {Object} options\n * @returns Text copied.\n */\n\n }, {\n key: \"defaultText\",\n\n /**\n * Default `text` lookup function.\n * @param {Element} trigger\n */\n value: function defaultText(trigger) {\n return getAttributeValue('text', trigger);\n }\n /**\n * Destroy lifecycle.\n */\n\n }, {\n key: \"destroy\",\n value: function destroy() {\n this.listener.destroy();\n }\n }], [{\n key: \"copy\",\n value: function copy(target) {\n var options = arguments.length > 1 && arguments[1] !== undefined ? arguments[1] : {\n container: document.body\n };\n return actions_copy(target, options);\n }\n /**\n * Allow fire programmatically a cut action\n * @param {String|HTMLElement} target\n * @returns Text cutted.\n */\n\n }, {\n key: \"cut\",\n value: function cut(target) {\n return actions_cut(target);\n }\n /**\n * Returns the support of the given action, or all actions if no action is\n * given.\n * @param {String} [action]\n */\n\n }, {\n key: \"isSupported\",\n value: function isSupported() {\n var action = arguments.length > 0 && arguments[0] !== undefined ? arguments[0] : ['copy', 'cut'];\n var actions = typeof action === 'string' ? [action] : action;\n var support = !!document.queryCommandSupported;\n actions.forEach(function (action) {\n support = support && !!document.queryCommandSupported(action);\n });\n return support;\n }\n }]);\n\n return Clipboard;\n}((tiny_emitter_default()));\n\n/* harmony default export */ var clipboard = (Clipboard);\n\n/***/ }),\n\n/***/ 828:\n/***/ (function(module) {\n\nvar DOCUMENT_NODE_TYPE = 9;\n\n/**\n * A polyfill for Element.matches()\n */\nif (typeof Element !== 'undefined' && !Element.prototype.matches) {\n var proto = Element.prototype;\n\n proto.matches = proto.matchesSelector ||\n proto.mozMatchesSelector ||\n proto.msMatchesSelector ||\n proto.oMatchesSelector ||\n proto.webkitMatchesSelector;\n}\n\n/**\n * Finds the closest parent that matches a selector.\n *\n * @param {Element} element\n * @param {String} selector\n * @return {Function}\n */\nfunction closest (element, selector) {\n while (element && element.nodeType !== DOCUMENT_NODE_TYPE) {\n if (typeof element.matches === 'function' &&\n element.matches(selector)) {\n return element;\n }\n element = element.parentNode;\n }\n}\n\nmodule.exports = closest;\n\n\n/***/ }),\n\n/***/ 438:\n/***/ (function(module, __unused_webpack_exports, __webpack_require__) {\n\nvar closest = __webpack_require__(828);\n\n/**\n * Delegates event to a selector.\n *\n * @param {Element} element\n * @param {String} selector\n * @param {String} type\n * @param {Function} callback\n * @param {Boolean} useCapture\n * @return {Object}\n */\nfunction _delegate(element, selector, type, callback, useCapture) {\n var listenerFn = listener.apply(this, arguments);\n\n element.addEventListener(type, listenerFn, useCapture);\n\n return {\n destroy: function() {\n element.removeEventListener(type, listenerFn, useCapture);\n }\n }\n}\n\n/**\n * Delegates event to a selector.\n *\n * @param {Element|String|Array} [elements]\n * @param {String} selector\n * @param {String} type\n * @param {Function} callback\n * @param {Boolean} useCapture\n * @return {Object}\n */\nfunction delegate(elements, selector, type, callback, useCapture) {\n // Handle the regular Element usage\n if (typeof elements.addEventListener === 'function') {\n return _delegate.apply(null, arguments);\n }\n\n // Handle Element-less usage, it defaults to global delegation\n if (typeof type === 'function') {\n // Use `document` as the first parameter, then apply arguments\n // This is a short way to .unshift `arguments` without running into deoptimizations\n return _delegate.bind(null, document).apply(null, arguments);\n }\n\n // Handle Selector-based usage\n if (typeof elements === 'string') {\n elements = document.querySelectorAll(elements);\n }\n\n // Handle Array-like based usage\n return Array.prototype.map.call(elements, function (element) {\n return _delegate(element, selector, type, callback, useCapture);\n });\n}\n\n/**\n * Finds closest match and invokes callback.\n *\n * @param {Element} element\n * @param {String} selector\n * @param {String} type\n * @param {Function} callback\n * @return {Function}\n */\nfunction listener(element, selector, type, callback) {\n return function(e) {\n e.delegateTarget = closest(e.target, selector);\n\n if (e.delegateTarget) {\n callback.call(element, e);\n }\n }\n}\n\nmodule.exports = delegate;\n\n\n/***/ }),\n\n/***/ 879:\n/***/ (function(__unused_webpack_module, exports) {\n\n/**\n * Check if argument is a HTML element.\n *\n * @param {Object} value\n * @return {Boolean}\n */\nexports.node = function(value) {\n return value !== undefined\n && value instanceof HTMLElement\n && value.nodeType === 1;\n};\n\n/**\n * Check if argument is a list of HTML elements.\n *\n * @param {Object} value\n * @return {Boolean}\n */\nexports.nodeList = function(value) {\n var type = Object.prototype.toString.call(value);\n\n return value !== undefined\n && (type === '[object NodeList]' || type === '[object HTMLCollection]')\n && ('length' in value)\n && (value.length === 0 || exports.node(value[0]));\n};\n\n/**\n * Check if argument is a string.\n *\n * @param {Object} value\n * @return {Boolean}\n */\nexports.string = function(value) {\n return typeof value === 'string'\n || value instanceof String;\n};\n\n/**\n * Check if argument is a function.\n *\n * @param {Object} value\n * @return {Boolean}\n */\nexports.fn = function(value) {\n var type = Object.prototype.toString.call(value);\n\n return type === '[object Function]';\n};\n\n\n/***/ }),\n\n/***/ 370:\n/***/ (function(module, __unused_webpack_exports, __webpack_require__) {\n\nvar is = __webpack_require__(879);\nvar delegate = __webpack_require__(438);\n\n/**\n * Validates all params and calls the right\n * listener function based on its target type.\n *\n * @param {String|HTMLElement|HTMLCollection|NodeList} target\n * @param {String} type\n * @param {Function} callback\n * @return {Object}\n */\nfunction listen(target, type, callback) {\n if (!target && !type && !callback) {\n throw new Error('Missing required arguments');\n }\n\n if (!is.string(type)) {\n throw new TypeError('Second argument must be a String');\n }\n\n if (!is.fn(callback)) {\n throw new TypeError('Third argument must be a Function');\n }\n\n if (is.node(target)) {\n return listenNode(target, type, callback);\n }\n else if (is.nodeList(target)) {\n return listenNodeList(target, type, callback);\n }\n else if (is.string(target)) {\n return listenSelector(target, type, callback);\n }\n else {\n throw new TypeError('First argument must be a String, HTMLElement, HTMLCollection, or NodeList');\n }\n}\n\n/**\n * Adds an event listener to a HTML element\n * and returns a remove listener function.\n *\n * @param {HTMLElement} node\n * @param {String} type\n * @param {Function} callback\n * @return {Object}\n */\nfunction listenNode(node, type, callback) {\n node.addEventListener(type, callback);\n\n return {\n destroy: function() {\n node.removeEventListener(type, callback);\n }\n }\n}\n\n/**\n * Add an event listener to a list of HTML elements\n * and returns a remove listener function.\n *\n * @param {NodeList|HTMLCollection} nodeList\n * @param {String} type\n * @param {Function} callback\n * @return {Object}\n */\nfunction listenNodeList(nodeList, type, callback) {\n Array.prototype.forEach.call(nodeList, function(node) {\n node.addEventListener(type, callback);\n });\n\n return {\n destroy: function() {\n Array.prototype.forEach.call(nodeList, function(node) {\n node.removeEventListener(type, callback);\n });\n }\n }\n}\n\n/**\n * Add an event listener to a selector\n * and returns a remove listener function.\n *\n * @param {String} selector\n * @param {String} type\n * @param {Function} callback\n * @return {Object}\n */\nfunction listenSelector(selector, type, callback) {\n return delegate(document.body, selector, type, callback);\n}\n\nmodule.exports = listen;\n\n\n/***/ }),\n\n/***/ 817:\n/***/ (function(module) {\n\nfunction select(element) {\n var selectedText;\n\n if (element.nodeName === 'SELECT') {\n element.focus();\n\n selectedText = element.value;\n }\n else if (element.nodeName === 'INPUT' || element.nodeName === 'TEXTAREA') {\n var isReadOnly = element.hasAttribute('readonly');\n\n if (!isReadOnly) {\n element.setAttribute('readonly', '');\n }\n\n element.select();\n element.setSelectionRange(0, element.value.length);\n\n if (!isReadOnly) {\n element.removeAttribute('readonly');\n }\n\n selectedText = element.value;\n }\n else {\n if (element.hasAttribute('contenteditable')) {\n element.focus();\n }\n\n var selection = window.getSelection();\n var range = document.createRange();\n\n range.selectNodeContents(element);\n selection.removeAllRanges();\n selection.addRange(range);\n\n selectedText = selection.toString();\n }\n\n return selectedText;\n}\n\nmodule.exports = select;\n\n\n/***/ }),\n\n/***/ 279:\n/***/ (function(module) {\n\nfunction E () {\n // Keep this empty so it's easier to inherit from\n // (via https://github.com/lipsmack from https://github.com/scottcorgan/tiny-emitter/issues/3)\n}\n\nE.prototype = {\n on: function (name, callback, ctx) {\n var e = this.e || (this.e = {});\n\n (e[name] || (e[name] = [])).push({\n fn: callback,\n ctx: ctx\n });\n\n return this;\n },\n\n once: function (name, callback, ctx) {\n var self = this;\n function listener () {\n self.off(name, listener);\n callback.apply(ctx, arguments);\n };\n\n listener._ = callback\n return this.on(name, listener, ctx);\n },\n\n emit: function (name) {\n var data = [].slice.call(arguments, 1);\n var evtArr = ((this.e || (this.e = {}))[name] || []).slice();\n var i = 0;\n var len = evtArr.length;\n\n for (i; i < len; i++) {\n evtArr[i].fn.apply(evtArr[i].ctx, data);\n }\n\n return this;\n },\n\n off: function (name, callback) {\n var e = this.e || (this.e = {});\n var evts = e[name];\n var liveEvents = [];\n\n if (evts && callback) {\n for (var i = 0, len = evts.length; i < len; i++) {\n if (evts[i].fn !== callback && evts[i].fn._ !== callback)\n liveEvents.push(evts[i]);\n }\n }\n\n // Remove event from queue to prevent memory leak\n // Suggested by https://github.com/lazd\n // Ref: https://github.com/scottcorgan/tiny-emitter/commit/c6ebfaa9bc973b33d110a84a307742b7cf94c953#commitcomment-5024910\n\n (liveEvents.length)\n ? e[name] = liveEvents\n : delete e[name];\n\n return this;\n }\n};\n\nmodule.exports = E;\nmodule.exports.TinyEmitter = E;\n\n\n/***/ })\n\n/******/ \t});\n/************************************************************************/\n/******/ \t// The module cache\n/******/ \tvar __webpack_module_cache__ = {};\n/******/ \t\n/******/ \t// The require function\n/******/ \tfunction __webpack_require__(moduleId) {\n/******/ \t\t// Check if module is in cache\n/******/ \t\tif(__webpack_module_cache__[moduleId]) {\n/******/ \t\t\treturn __webpack_module_cache__[moduleId].exports;\n/******/ \t\t}\n/******/ \t\t// Create a new module (and put it into the cache)\n/******/ \t\tvar module = __webpack_module_cache__[moduleId] = {\n/******/ \t\t\t// no module.id needed\n/******/ \t\t\t// no module.loaded needed\n/******/ \t\t\texports: {}\n/******/ \t\t};\n/******/ \t\n/******/ \t\t// Execute the module function\n/******/ \t\t__webpack_modules__[moduleId](module, module.exports, __webpack_require__);\n/******/ \t\n/******/ \t\t// Return the exports of the module\n/******/ \t\treturn module.exports;\n/******/ \t}\n/******/ \t\n/************************************************************************/\n/******/ \t/* webpack/runtime/compat get default export */\n/******/ \t!function() {\n/******/ \t\t// getDefaultExport function for compatibility with non-harmony modules\n/******/ \t\t__webpack_require__.n = function(module) {\n/******/ \t\t\tvar getter = module && module.__esModule ?\n/******/ \t\t\t\tfunction() { return module['default']; } :\n/******/ \t\t\t\tfunction() { return module; };\n/******/ \t\t\t__webpack_require__.d(getter, { a: getter });\n/******/ \t\t\treturn getter;\n/******/ \t\t};\n/******/ \t}();\n/******/ \t\n/******/ \t/* webpack/runtime/define property getters */\n/******/ \t!function() {\n/******/ \t\t// define getter functions for harmony exports\n/******/ \t\t__webpack_require__.d = function(exports, definition) {\n/******/ \t\t\tfor(var key in definition) {\n/******/ \t\t\t\tif(__webpack_require__.o(definition, key) && !__webpack_require__.o(exports, key)) {\n/******/ \t\t\t\t\tObject.defineProperty(exports, key, { enumerable: true, get: definition[key] });\n/******/ \t\t\t\t}\n/******/ \t\t\t}\n/******/ \t\t};\n/******/ \t}();\n/******/ \t\n/******/ \t/* webpack/runtime/hasOwnProperty shorthand */\n/******/ \t!function() {\n/******/ \t\t__webpack_require__.o = function(obj, prop) { return Object.prototype.hasOwnProperty.call(obj, prop); }\n/******/ \t}();\n/******/ \t\n/************************************************************************/\n/******/ \t// module exports must be returned from runtime so entry inlining is disabled\n/******/ \t// startup\n/******/ \t// Load entry module and return exports\n/******/ \treturn __webpack_require__(686);\n/******/ })()\n.default;\n});", "/*!\n * escape-html\n * Copyright(c) 2012-2013 TJ Holowaychuk\n * Copyright(c) 2015 Andreas Lubbe\n * Copyright(c) 2015 Tiancheng \"Timothy\" Gu\n * MIT Licensed\n */\n\n'use strict';\n\n/**\n * Module variables.\n * @private\n */\n\nvar matchHtmlRegExp = /[\"'&<>]/;\n\n/**\n * Module exports.\n * @public\n */\n\nmodule.exports = escapeHtml;\n\n/**\n * Escape special characters in the given string of html.\n *\n * @param {string} string The string to escape for inserting into HTML\n * @return {string}\n * @public\n */\n\nfunction escapeHtml(string) {\n var str = '' + string;\n var match = matchHtmlRegExp.exec(str);\n\n if (!match) {\n return str;\n }\n\n var escape;\n var html = '';\n var index = 0;\n var lastIndex = 0;\n\n for (index = match.index; index < str.length; index++) {\n switch (str.charCodeAt(index)) {\n case 34: // \"\n escape = '"';\n break;\n case 38: // &\n escape = '&';\n break;\n case 39: // '\n escape = ''';\n break;\n case 60: // <\n escape = '<';\n break;\n case 62: // >\n escape = '>';\n break;\n default:\n continue;\n }\n\n if (lastIndex !== index) {\n html += str.substring(lastIndex, index);\n }\n\n lastIndex = index + 1;\n html += escape;\n }\n\n return lastIndex !== index\n ? html + str.substring(lastIndex, index)\n : html;\n}\n", "/*\n * Copyright (c) 2016-2024 Martin Donath \n *\n * Permission is hereby granted, free of charge, to any person obtaining a copy\n * of this software and associated documentation files (the \"Software\"), to\n * deal in the Software without restriction, including without limitation the\n * rights to use, copy, modify, merge, publish, distribute, sublicense, and/or\n * sell copies of the Software, and to permit persons to whom the Software is\n * furnished to do so, subject to the following conditions:\n *\n * The above copyright notice and this permission notice shall be included in\n * all copies or substantial portions of the Software.\n *\n * THE SOFTWARE IS PROVIDED \"AS IS\", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR\n * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,\n * FITNESS FOR A PARTICULAR PURPOSE AND NON-INFRINGEMENT. IN NO EVENT SHALL THE\n * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER\n * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING\n * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS\n * IN THE SOFTWARE.\n */\n\nimport \"focus-visible\"\n\nimport {\n EMPTY,\n NEVER,\n Observable,\n Subject,\n defer,\n delay,\n filter,\n map,\n merge,\n mergeWith,\n shareReplay,\n switchMap\n} from \"rxjs\"\n\nimport { configuration, feature } from \"./_\"\nimport {\n at,\n getActiveElement,\n getOptionalElement,\n requestJSON,\n setLocation,\n setToggle,\n watchDocument,\n watchKeyboard,\n watchLocation,\n watchLocationTarget,\n watchMedia,\n watchPrint,\n watchScript,\n watchViewport\n} from \"./browser\"\nimport {\n getComponentElement,\n getComponentElements,\n mountAnnounce,\n mountBackToTop,\n mountConsent,\n mountContent,\n mountDialog,\n mountHeader,\n mountHeaderTitle,\n mountPalette,\n mountProgress,\n mountSearch,\n mountSearchHiglight,\n mountSidebar,\n mountSource,\n mountTableOfContents,\n mountTabs,\n watchHeader,\n watchMain\n} from \"./components\"\nimport {\n SearchIndex,\n setupClipboardJS,\n setupInstantNavigation,\n setupVersionSelector\n} from \"./integrations\"\nimport {\n patchEllipsis,\n patchIndeterminate,\n patchScrollfix,\n patchScrolllock\n} from \"./patches\"\nimport \"./polyfills\"\n\n/* ----------------------------------------------------------------------------\n * Functions - @todo refactor\n * ------------------------------------------------------------------------- */\n\n/**\n * Fetch search index\n *\n * @returns Search index observable\n */\nfunction fetchSearchIndex(): Observable {\n if (location.protocol === \"file:\") {\n return watchScript(\n `${new URL(\"search/search_index.js\", config.base)}`\n )\n .pipe(\n // @ts-ignore - @todo fix typings\n map(() => __index),\n shareReplay(1)\n )\n } else {\n return requestJSON(\n new URL(\"search/search_index.json\", config.base)\n )\n }\n}\n\n/* ----------------------------------------------------------------------------\n * Application\n * ------------------------------------------------------------------------- */\n\n/* Yay, JavaScript is available */\ndocument.documentElement.classList.remove(\"no-js\")\ndocument.documentElement.classList.add(\"js\")\n\n/* Set up navigation observables and subjects */\nconst document$ = watchDocument()\nconst location$ = watchLocation()\nconst target$ = watchLocationTarget(location$)\nconst keyboard$ = watchKeyboard()\n\n/* Set up media observables */\nconst viewport$ = watchViewport()\nconst tablet$ = watchMedia(\"(min-width: 960px)\")\nconst screen$ = watchMedia(\"(min-width: 1220px)\")\nconst print$ = watchPrint()\n\n/* Retrieve search index, if search is enabled */\nconst config = configuration()\nconst index$ = document.forms.namedItem(\"search\")\n ? fetchSearchIndex()\n : NEVER\n\n/* Set up Clipboard.js integration */\nconst alert$ = new Subject()\nsetupClipboardJS({ alert$ })\n\n/* Set up progress indicator */\nconst progress$ = new Subject()\n\n/* Set up instant navigation, if enabled */\nif (feature(\"navigation.instant\"))\n setupInstantNavigation({ location$, viewport$, progress$ })\n .subscribe(document$)\n\n/* Set up version selector */\nif (config.version?.provider === \"mike\")\n setupVersionSelector({ document$ })\n\n/* Always close drawer and search on navigation */\nmerge(location$, target$)\n .pipe(\n delay(125)\n )\n .subscribe(() => {\n setToggle(\"drawer\", false)\n setToggle(\"search\", false)\n })\n\n/* Set up global keyboard handlers */\nkeyboard$\n .pipe(\n filter(({ mode }) => mode === \"global\")\n )\n .subscribe(key => {\n switch (key.type) {\n\n /* Go to previous page */\n case \"p\":\n case \",\":\n const prev = getOptionalElement(\"link[rel=prev]\")\n if (typeof prev !== \"undefined\")\n setLocation(prev)\n break\n\n /* Go to next page */\n case \"n\":\n case \".\":\n const next = getOptionalElement(\"link[rel=next]\")\n if (typeof next !== \"undefined\")\n setLocation(next)\n break\n\n /* Expand navigation, see https://bit.ly/3ZjG5io */\n case \"Enter\":\n const active = getActiveElement()\n if (active instanceof HTMLLabelElement)\n active.click()\n }\n })\n\n/* Set up patches */\npatchEllipsis({ document$ })\npatchIndeterminate({ document$, tablet$ })\npatchScrollfix({ document$ })\npatchScrolllock({ viewport$, tablet$ })\n\n/* Set up header and main area observable */\nconst header$ = watchHeader(getComponentElement(\"header\"), { viewport$ })\nconst main$ = document$\n .pipe(\n map(() => getComponentElement(\"main\")),\n switchMap(el => watchMain(el, { viewport$, header$ })),\n shareReplay(1)\n )\n\n/* Set up control component observables */\nconst control$ = merge(\n\n /* Consent */\n ...getComponentElements(\"consent\")\n .map(el => mountConsent(el, { target$ })),\n\n /* Dialog */\n ...getComponentElements(\"dialog\")\n .map(el => mountDialog(el, { alert$ })),\n\n /* Header */\n ...getComponentElements(\"header\")\n .map(el => mountHeader(el, { viewport$, header$, main$ })),\n\n /* Color palette */\n ...getComponentElements(\"palette\")\n .map(el => mountPalette(el)),\n\n /* Progress bar */\n ...getComponentElements(\"progress\")\n .map(el => mountProgress(el, { progress$ })),\n\n /* Search */\n ...getComponentElements(\"search\")\n .map(el => mountSearch(el, { index$, keyboard$ })),\n\n /* Repository information */\n ...getComponentElements(\"source\")\n .map(el => mountSource(el))\n)\n\n/* Set up content component observables */\nconst content$ = defer(() => merge(\n\n /* Announcement bar */\n ...getComponentElements(\"announce\")\n .map(el => mountAnnounce(el)),\n\n /* Content */\n ...getComponentElements(\"content\")\n .map(el => mountContent(el, { viewport$, target$, print$ })),\n\n /* Search highlighting */\n ...getComponentElements(\"content\")\n .map(el => feature(\"search.highlight\")\n ? mountSearchHiglight(el, { index$, location$ })\n : EMPTY\n ),\n\n /* Header title */\n ...getComponentElements(\"header-title\")\n .map(el => mountHeaderTitle(el, { viewport$, header$ })),\n\n /* Sidebar */\n ...getComponentElements(\"sidebar\")\n .map(el => el.getAttribute(\"data-md-type\") === \"navigation\"\n ? at(screen$, () => mountSidebar(el, { viewport$, header$, main$ }))\n : at(tablet$, () => mountSidebar(el, { viewport$, header$, main$ }))\n ),\n\n /* Navigation tabs */\n ...getComponentElements(\"tabs\")\n .map(el => mountTabs(el, { viewport$, header$ })),\n\n /* Table of contents */\n ...getComponentElements(\"toc\")\n .map(el => mountTableOfContents(el, {\n viewport$, header$, main$, target$\n })),\n\n /* Back-to-top button */\n ...getComponentElements(\"top\")\n .map(el => mountBackToTop(el, { viewport$, header$, main$, target$ }))\n))\n\n/* Set up component observables */\nconst component$ = document$\n .pipe(\n switchMap(() => content$),\n mergeWith(control$),\n shareReplay(1)\n )\n\n/* Subscribe to all components */\ncomponent$.subscribe()\n\n/* ----------------------------------------------------------------------------\n * Exports\n * ------------------------------------------------------------------------- */\n\nwindow.document$ = document$ /* Document observable */\nwindow.location$ = location$ /* Location subject */\nwindow.target$ = target$ /* Location target observable */\nwindow.keyboard$ = keyboard$ /* Keyboard observable */\nwindow.viewport$ = viewport$ /* Viewport observable */\nwindow.tablet$ = tablet$ /* Media tablet observable */\nwindow.screen$ = screen$ /* Media screen observable */\nwindow.print$ = print$ /* Media print observable */\nwindow.alert$ = alert$ /* Alert subject */\nwindow.progress$ = progress$ /* Progress indicator subject */\nwindow.component$ = component$ /* Component observable */\n", "/*! *****************************************************************************\r\nCopyright (c) Microsoft Corporation.\r\n\r\nPermission to use, copy, modify, and/or distribute this software for any\r\npurpose with or without fee is hereby granted.\r\n\r\nTHE SOFTWARE IS PROVIDED \"AS IS\" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH\r\nREGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY\r\nAND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT,\r\nINDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM\r\nLOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR\r\nOTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR\r\nPERFORMANCE OF THIS SOFTWARE.\r\n***************************************************************************** */\r\n/* global Reflect, Promise */\r\n\r\nvar extendStatics = function(d, b) {\r\n extendStatics = Object.setPrototypeOf ||\r\n ({ __proto__: [] } instanceof Array && function (d, b) { d.__proto__ = b; }) ||\r\n function (d, b) { for (var p in b) if (Object.prototype.hasOwnProperty.call(b, p)) d[p] = b[p]; };\r\n return extendStatics(d, b);\r\n};\r\n\r\nexport function __extends(d, b) {\r\n if (typeof b !== \"function\" && b !== null)\r\n throw new TypeError(\"Class extends value \" + String(b) + \" is not a constructor or null\");\r\n extendStatics(d, b);\r\n function __() { this.constructor = d; }\r\n d.prototype = b === null ? Object.create(b) : (__.prototype = b.prototype, new __());\r\n}\r\n\r\nexport var __assign = function() {\r\n __assign = Object.assign || function __assign(t) {\r\n for (var s, i = 1, n = arguments.length; i < n; i++) {\r\n s = arguments[i];\r\n for (var p in s) if (Object.prototype.hasOwnProperty.call(s, p)) t[p] = s[p];\r\n }\r\n return t;\r\n }\r\n return __assign.apply(this, arguments);\r\n}\r\n\r\nexport function __rest(s, e) {\r\n var t = {};\r\n for (var p in s) if (Object.prototype.hasOwnProperty.call(s, p) && e.indexOf(p) < 0)\r\n t[p] = s[p];\r\n if (s != null && typeof Object.getOwnPropertySymbols === \"function\")\r\n for (var i = 0, p = Object.getOwnPropertySymbols(s); i < p.length; i++) {\r\n if (e.indexOf(p[i]) < 0 && Object.prototype.propertyIsEnumerable.call(s, p[i]))\r\n t[p[i]] = s[p[i]];\r\n }\r\n return t;\r\n}\r\n\r\nexport function __decorate(decorators, target, key, desc) {\r\n var c = arguments.length, r = c < 3 ? target : desc === null ? desc = Object.getOwnPropertyDescriptor(target, key) : desc, d;\r\n if (typeof Reflect === \"object\" && typeof Reflect.decorate === \"function\") r = Reflect.decorate(decorators, target, key, desc);\r\n else for (var i = decorators.length - 1; i >= 0; i--) if (d = decorators[i]) r = (c < 3 ? d(r) : c > 3 ? d(target, key, r) : d(target, key)) || r;\r\n return c > 3 && r && Object.defineProperty(target, key, r), r;\r\n}\r\n\r\nexport function __param(paramIndex, decorator) {\r\n return function (target, key) { decorator(target, key, paramIndex); }\r\n}\r\n\r\nexport function __metadata(metadataKey, metadataValue) {\r\n if (typeof Reflect === \"object\" && typeof Reflect.metadata === \"function\") return Reflect.metadata(metadataKey, metadataValue);\r\n}\r\n\r\nexport function __awaiter(thisArg, _arguments, P, generator) {\r\n function adopt(value) { return value instanceof P ? value : new P(function (resolve) { resolve(value); }); }\r\n return new (P || (P = Promise))(function (resolve, reject) {\r\n function fulfilled(value) { try { step(generator.next(value)); } catch (e) { reject(e); } }\r\n function rejected(value) { try { step(generator[\"throw\"](value)); } catch (e) { reject(e); } }\r\n function step(result) { result.done ? resolve(result.value) : adopt(result.value).then(fulfilled, rejected); }\r\n step((generator = generator.apply(thisArg, _arguments || [])).next());\r\n });\r\n}\r\n\r\nexport function __generator(thisArg, body) {\r\n var _ = { label: 0, sent: function() { if (t[0] & 1) throw t[1]; return t[1]; }, trys: [], ops: [] }, f, y, t, g;\r\n return g = { next: verb(0), \"throw\": verb(1), \"return\": verb(2) }, typeof Symbol === \"function\" && (g[Symbol.iterator] = function() { return this; }), g;\r\n function verb(n) { return function (v) { return step([n, v]); }; }\r\n function step(op) {\r\n if (f) throw new TypeError(\"Generator is already executing.\");\r\n while (_) try {\r\n if (f = 1, y && (t = op[0] & 2 ? y[\"return\"] : op[0] ? y[\"throw\"] || ((t = y[\"return\"]) && t.call(y), 0) : y.next) && !(t = t.call(y, op[1])).done) return t;\r\n if (y = 0, t) op = [op[0] & 2, t.value];\r\n switch (op[0]) {\r\n case 0: case 1: t = op; break;\r\n case 4: _.label++; return { value: op[1], done: false };\r\n case 5: _.label++; y = op[1]; op = [0]; continue;\r\n case 7: op = _.ops.pop(); _.trys.pop(); continue;\r\n default:\r\n if (!(t = _.trys, t = t.length > 0 && t[t.length - 1]) && (op[0] === 6 || op[0] === 2)) { _ = 0; continue; }\r\n if (op[0] === 3 && (!t || (op[1] > t[0] && op[1] < t[3]))) { _.label = op[1]; break; }\r\n if (op[0] === 6 && _.label < t[1]) { _.label = t[1]; t = op; break; }\r\n if (t && _.label < t[2]) { _.label = t[2]; _.ops.push(op); break; }\r\n if (t[2]) _.ops.pop();\r\n _.trys.pop(); continue;\r\n }\r\n op = body.call(thisArg, _);\r\n } catch (e) { op = [6, e]; y = 0; } finally { f = t = 0; }\r\n if (op[0] & 5) throw op[1]; return { value: op[0] ? op[1] : void 0, done: true };\r\n }\r\n}\r\n\r\nexport var __createBinding = Object.create ? (function(o, m, k, k2) {\r\n if (k2 === undefined) k2 = k;\r\n Object.defineProperty(o, k2, { enumerable: true, get: function() { return m[k]; } });\r\n}) : (function(o, m, k, k2) {\r\n if (k2 === undefined) k2 = k;\r\n o[k2] = m[k];\r\n});\r\n\r\nexport function __exportStar(m, o) {\r\n for (var p in m) if (p !== \"default\" && !Object.prototype.hasOwnProperty.call(o, p)) __createBinding(o, m, p);\r\n}\r\n\r\nexport function __values(o) {\r\n var s = typeof Symbol === \"function\" && Symbol.iterator, m = s && o[s], i = 0;\r\n if (m) return m.call(o);\r\n if (o && typeof o.length === \"number\") return {\r\n next: function () {\r\n if (o && i >= o.length) o = void 0;\r\n return { value: o && o[i++], done: !o };\r\n }\r\n };\r\n throw new TypeError(s ? \"Object is not iterable.\" : \"Symbol.iterator is not defined.\");\r\n}\r\n\r\nexport function __read(o, n) {\r\n var m = typeof Symbol === \"function\" && o[Symbol.iterator];\r\n if (!m) return o;\r\n var i = m.call(o), r, ar = [], e;\r\n try {\r\n while ((n === void 0 || n-- > 0) && !(r = i.next()).done) ar.push(r.value);\r\n }\r\n catch (error) { e = { error: error }; }\r\n finally {\r\n try {\r\n if (r && !r.done && (m = i[\"return\"])) m.call(i);\r\n }\r\n finally { if (e) throw e.error; }\r\n }\r\n return ar;\r\n}\r\n\r\n/** @deprecated */\r\nexport function __spread() {\r\n for (var ar = [], i = 0; i < arguments.length; i++)\r\n ar = ar.concat(__read(arguments[i]));\r\n return ar;\r\n}\r\n\r\n/** @deprecated */\r\nexport function __spreadArrays() {\r\n for (var s = 0, i = 0, il = arguments.length; i < il; i++) s += arguments[i].length;\r\n for (var r = Array(s), k = 0, i = 0; i < il; i++)\r\n for (var a = arguments[i], j = 0, jl = a.length; j < jl; j++, k++)\r\n r[k] = a[j];\r\n return r;\r\n}\r\n\r\nexport function __spreadArray(to, from, pack) {\r\n if (pack || arguments.length === 2) for (var i = 0, l = from.length, ar; i < l; i++) {\r\n if (ar || !(i in from)) {\r\n if (!ar) ar = Array.prototype.slice.call(from, 0, i);\r\n ar[i] = from[i];\r\n }\r\n }\r\n return to.concat(ar || Array.prototype.slice.call(from));\r\n}\r\n\r\nexport function __await(v) {\r\n return this instanceof __await ? (this.v = v, this) : new __await(v);\r\n}\r\n\r\nexport function __asyncGenerator(thisArg, _arguments, generator) {\r\n if (!Symbol.asyncIterator) throw new TypeError(\"Symbol.asyncIterator is not defined.\");\r\n var g = generator.apply(thisArg, _arguments || []), i, q = [];\r\n return i = {}, verb(\"next\"), verb(\"throw\"), verb(\"return\"), i[Symbol.asyncIterator] = function () { return this; }, i;\r\n function verb(n) { if (g[n]) i[n] = function (v) { return new Promise(function (a, b) { q.push([n, v, a, b]) > 1 || resume(n, v); }); }; }\r\n function resume(n, v) { try { step(g[n](v)); } catch (e) { settle(q[0][3], e); } }\r\n function step(r) { r.value instanceof __await ? Promise.resolve(r.value.v).then(fulfill, reject) : settle(q[0][2], r); }\r\n function fulfill(value) { resume(\"next\", value); }\r\n function reject(value) { resume(\"throw\", value); }\r\n function settle(f, v) { if (f(v), q.shift(), q.length) resume(q[0][0], q[0][1]); }\r\n}\r\n\r\nexport function __asyncDelegator(o) {\r\n var i, p;\r\n return i = {}, verb(\"next\"), verb(\"throw\", function (e) { throw e; }), verb(\"return\"), i[Symbol.iterator] = function () { return this; }, i;\r\n function verb(n, f) { i[n] = o[n] ? function (v) { return (p = !p) ? { value: __await(o[n](v)), done: n === \"return\" } : f ? f(v) : v; } : f; }\r\n}\r\n\r\nexport function __asyncValues(o) {\r\n if (!Symbol.asyncIterator) throw new TypeError(\"Symbol.asyncIterator is not defined.\");\r\n var m = o[Symbol.asyncIterator], i;\r\n return m ? m.call(o) : (o = typeof __values === \"function\" ? __values(o) : o[Symbol.iterator](), i = {}, verb(\"next\"), verb(\"throw\"), verb(\"return\"), i[Symbol.asyncIterator] = function () { return this; }, i);\r\n function verb(n) { i[n] = o[n] && function (v) { return new Promise(function (resolve, reject) { v = o[n](v), settle(resolve, reject, v.done, v.value); }); }; }\r\n function settle(resolve, reject, d, v) { Promise.resolve(v).then(function(v) { resolve({ value: v, done: d }); }, reject); }\r\n}\r\n\r\nexport function __makeTemplateObject(cooked, raw) {\r\n if (Object.defineProperty) { Object.defineProperty(cooked, \"raw\", { value: raw }); } else { cooked.raw = raw; }\r\n return cooked;\r\n};\r\n\r\nvar __setModuleDefault = Object.create ? (function(o, v) {\r\n Object.defineProperty(o, \"default\", { enumerable: true, value: v });\r\n}) : function(o, v) {\r\n o[\"default\"] = v;\r\n};\r\n\r\nexport function __importStar(mod) {\r\n if (mod && mod.__esModule) return mod;\r\n var result = {};\r\n if (mod != null) for (var k in mod) if (k !== \"default\" && Object.prototype.hasOwnProperty.call(mod, k)) __createBinding(result, mod, k);\r\n __setModuleDefault(result, mod);\r\n return result;\r\n}\r\n\r\nexport function __importDefault(mod) {\r\n return (mod && mod.__esModule) ? mod : { default: mod };\r\n}\r\n\r\nexport function __classPrivateFieldGet(receiver, state, kind, f) {\r\n if (kind === \"a\" && !f) throw new TypeError(\"Private accessor was defined without a getter\");\r\n if (typeof state === \"function\" ? receiver !== state || !f : !state.has(receiver)) throw new TypeError(\"Cannot read private member from an object whose class did not declare it\");\r\n return kind === \"m\" ? f : kind === \"a\" ? f.call(receiver) : f ? f.value : state.get(receiver);\r\n}\r\n\r\nexport function __classPrivateFieldSet(receiver, state, value, kind, f) {\r\n if (kind === \"m\") throw new TypeError(\"Private method is not writable\");\r\n if (kind === \"a\" && !f) throw new TypeError(\"Private accessor was defined without a setter\");\r\n if (typeof state === \"function\" ? receiver !== state || !f : !state.has(receiver)) throw new TypeError(\"Cannot write private member to an object whose class did not declare it\");\r\n return (kind === \"a\" ? f.call(receiver, value) : f ? f.value = value : state.set(receiver, value)), value;\r\n}\r\n", "/**\n * Returns true if the object is a function.\n * @param value The value to check\n */\nexport function isFunction(value: any): value is (...args: any[]) => any {\n return typeof value === 'function';\n}\n", "/**\n * Used to create Error subclasses until the community moves away from ES5.\n *\n * This is because compiling from TypeScript down to ES5 has issues with subclassing Errors\n * as well as other built-in types: https://github.com/Microsoft/TypeScript/issues/12123\n *\n * @param createImpl A factory function to create the actual constructor implementation. The returned\n * function should be a named function that calls `_super` internally.\n */\nexport function createErrorClass(createImpl: (_super: any) => any): T {\n const _super = (instance: any) => {\n Error.call(instance);\n instance.stack = new Error().stack;\n };\n\n const ctorFunc = createImpl(_super);\n ctorFunc.prototype = Object.create(Error.prototype);\n ctorFunc.prototype.constructor = ctorFunc;\n return ctorFunc;\n}\n", "import { createErrorClass } from './createErrorClass';\n\nexport interface UnsubscriptionError extends Error {\n readonly errors: any[];\n}\n\nexport interface UnsubscriptionErrorCtor {\n /**\n * @deprecated Internal implementation detail. Do not construct error instances.\n * Cannot be tagged as internal: https://github.com/ReactiveX/rxjs/issues/6269\n */\n new (errors: any[]): UnsubscriptionError;\n}\n\n/**\n * An error thrown when one or more errors have occurred during the\n * `unsubscribe` of a {@link Subscription}.\n */\nexport const UnsubscriptionError: UnsubscriptionErrorCtor = createErrorClass(\n (_super) =>\n function UnsubscriptionErrorImpl(this: any, errors: (Error | string)[]) {\n _super(this);\n this.message = errors\n ? `${errors.length} errors occurred during unsubscription:\n${errors.map((err, i) => `${i + 1}) ${err.toString()}`).join('\\n ')}`\n : '';\n this.name = 'UnsubscriptionError';\n this.errors = errors;\n }\n);\n", "/**\n * Removes an item from an array, mutating it.\n * @param arr The array to remove the item from\n * @param item The item to remove\n */\nexport function arrRemove(arr: T[] | undefined | null, item: T) {\n if (arr) {\n const index = arr.indexOf(item);\n 0 <= index && arr.splice(index, 1);\n }\n}\n", "import { isFunction } from './util/isFunction';\nimport { UnsubscriptionError } from './util/UnsubscriptionError';\nimport { SubscriptionLike, TeardownLogic, Unsubscribable } from './types';\nimport { arrRemove } from './util/arrRemove';\n\n/**\n * Represents a disposable resource, such as the execution of an Observable. A\n * Subscription has one important method, `unsubscribe`, that takes no argument\n * and just disposes the resource held by the subscription.\n *\n * Additionally, subscriptions may be grouped together through the `add()`\n * method, which will attach a child Subscription to the current Subscription.\n * When a Subscription is unsubscribed, all its children (and its grandchildren)\n * will be unsubscribed as well.\n *\n * @class Subscription\n */\nexport class Subscription implements SubscriptionLike {\n /** @nocollapse */\n public static EMPTY = (() => {\n const empty = new Subscription();\n empty.closed = true;\n return empty;\n })();\n\n /**\n * A flag to indicate whether this Subscription has already been unsubscribed.\n */\n public closed = false;\n\n private _parentage: Subscription[] | Subscription | null = null;\n\n /**\n * The list of registered finalizers to execute upon unsubscription. Adding and removing from this\n * list occurs in the {@link #add} and {@link #remove} methods.\n */\n private _finalizers: Exclude[] | null = null;\n\n /**\n * @param initialTeardown A function executed first as part of the finalization\n * process that is kicked off when {@link #unsubscribe} is called.\n */\n constructor(private initialTeardown?: () => void) {}\n\n /**\n * Disposes the resources held by the subscription. May, for instance, cancel\n * an ongoing Observable execution or cancel any other type of work that\n * started when the Subscription was created.\n * @return {void}\n */\n unsubscribe(): void {\n let errors: any[] | undefined;\n\n if (!this.closed) {\n this.closed = true;\n\n // Remove this from it's parents.\n const { _parentage } = this;\n if (_parentage) {\n this._parentage = null;\n if (Array.isArray(_parentage)) {\n for (const parent of _parentage) {\n parent.remove(this);\n }\n } else {\n _parentage.remove(this);\n }\n }\n\n const { initialTeardown: initialFinalizer } = this;\n if (isFunction(initialFinalizer)) {\n try {\n initialFinalizer();\n } catch (e) {\n errors = e instanceof UnsubscriptionError ? e.errors : [e];\n }\n }\n\n const { _finalizers } = this;\n if (_finalizers) {\n this._finalizers = null;\n for (const finalizer of _finalizers) {\n try {\n execFinalizer(finalizer);\n } catch (err) {\n errors = errors ?? [];\n if (err instanceof UnsubscriptionError) {\n errors = [...errors, ...err.errors];\n } else {\n errors.push(err);\n }\n }\n }\n }\n\n if (errors) {\n throw new UnsubscriptionError(errors);\n }\n }\n }\n\n /**\n * Adds a finalizer to this subscription, so that finalization will be unsubscribed/called\n * when this subscription is unsubscribed. If this subscription is already {@link #closed},\n * because it has already been unsubscribed, then whatever finalizer is passed to it\n * will automatically be executed (unless the finalizer itself is also a closed subscription).\n *\n * Closed Subscriptions cannot be added as finalizers to any subscription. Adding a closed\n * subscription to a any subscription will result in no operation. (A noop).\n *\n * Adding a subscription to itself, or adding `null` or `undefined` will not perform any\n * operation at all. (A noop).\n *\n * `Subscription` instances that are added to this instance will automatically remove themselves\n * if they are unsubscribed. Functions and {@link Unsubscribable} objects that you wish to remove\n * will need to be removed manually with {@link #remove}\n *\n * @param teardown The finalization logic to add to this subscription.\n */\n add(teardown: TeardownLogic): void {\n // Only add the finalizer if it's not undefined\n // and don't add a subscription to itself.\n if (teardown && teardown !== this) {\n if (this.closed) {\n // If this subscription is already closed,\n // execute whatever finalizer is handed to it automatically.\n execFinalizer(teardown);\n } else {\n if (teardown instanceof Subscription) {\n // We don't add closed subscriptions, and we don't add the same subscription\n // twice. Subscription unsubscribe is idempotent.\n if (teardown.closed || teardown._hasParent(this)) {\n return;\n }\n teardown._addParent(this);\n }\n (this._finalizers = this._finalizers ?? []).push(teardown);\n }\n }\n }\n\n /**\n * Checks to see if a this subscription already has a particular parent.\n * This will signal that this subscription has already been added to the parent in question.\n * @param parent the parent to check for\n */\n private _hasParent(parent: Subscription) {\n const { _parentage } = this;\n return _parentage === parent || (Array.isArray(_parentage) && _parentage.includes(parent));\n }\n\n /**\n * Adds a parent to this subscription so it can be removed from the parent if it\n * unsubscribes on it's own.\n *\n * NOTE: THIS ASSUMES THAT {@link _hasParent} HAS ALREADY BEEN CHECKED.\n * @param parent The parent subscription to add\n */\n private _addParent(parent: Subscription) {\n const { _parentage } = this;\n this._parentage = Array.isArray(_parentage) ? (_parentage.push(parent), _parentage) : _parentage ? [_parentage, parent] : parent;\n }\n\n /**\n * Called on a child when it is removed via {@link #remove}.\n * @param parent The parent to remove\n */\n private _removeParent(parent: Subscription) {\n const { _parentage } = this;\n if (_parentage === parent) {\n this._parentage = null;\n } else if (Array.isArray(_parentage)) {\n arrRemove(_parentage, parent);\n }\n }\n\n /**\n * Removes a finalizer from this subscription that was previously added with the {@link #add} method.\n *\n * Note that `Subscription` instances, when unsubscribed, will automatically remove themselves\n * from every other `Subscription` they have been added to. This means that using the `remove` method\n * is not a common thing and should be used thoughtfully.\n *\n * If you add the same finalizer instance of a function or an unsubscribable object to a `Subscription` instance\n * more than once, you will need to call `remove` the same number of times to remove all instances.\n *\n * All finalizer instances are removed to free up memory upon unsubscription.\n *\n * @param teardown The finalizer to remove from this subscription\n */\n remove(teardown: Exclude): void {\n const { _finalizers } = this;\n _finalizers && arrRemove(_finalizers, teardown);\n\n if (teardown instanceof Subscription) {\n teardown._removeParent(this);\n }\n }\n}\n\nexport const EMPTY_SUBSCRIPTION = Subscription.EMPTY;\n\nexport function isSubscription(value: any): value is Subscription {\n return (\n value instanceof Subscription ||\n (value && 'closed' in value && isFunction(value.remove) && isFunction(value.add) && isFunction(value.unsubscribe))\n );\n}\n\nfunction execFinalizer(finalizer: Unsubscribable | (() => void)) {\n if (isFunction(finalizer)) {\n finalizer();\n } else {\n finalizer.unsubscribe();\n }\n}\n", "import { Subscriber } from './Subscriber';\nimport { ObservableNotification } from './types';\n\n/**\n * The {@link GlobalConfig} object for RxJS. It is used to configure things\n * like how to react on unhandled errors.\n */\nexport const config: GlobalConfig = {\n onUnhandledError: null,\n onStoppedNotification: null,\n Promise: undefined,\n useDeprecatedSynchronousErrorHandling: false,\n useDeprecatedNextContext: false,\n};\n\n/**\n * The global configuration object for RxJS, used to configure things\n * like how to react on unhandled errors. Accessible via {@link config}\n * object.\n */\nexport interface GlobalConfig {\n /**\n * A registration point for unhandled errors from RxJS. These are errors that\n * cannot were not handled by consuming code in the usual subscription path. For\n * example, if you have this configured, and you subscribe to an observable without\n * providing an error handler, errors from that subscription will end up here. This\n * will _always_ be called asynchronously on another job in the runtime. This is because\n * we do not want errors thrown in this user-configured handler to interfere with the\n * behavior of the library.\n */\n onUnhandledError: ((err: any) => void) | null;\n\n /**\n * A registration point for notifications that cannot be sent to subscribers because they\n * have completed, errored or have been explicitly unsubscribed. By default, next, complete\n * and error notifications sent to stopped subscribers are noops. However, sometimes callers\n * might want a different behavior. For example, with sources that attempt to report errors\n * to stopped subscribers, a caller can configure RxJS to throw an unhandled error instead.\n * This will _always_ be called asynchronously on another job in the runtime. This is because\n * we do not want errors thrown in this user-configured handler to interfere with the\n * behavior of the library.\n */\n onStoppedNotification: ((notification: ObservableNotification, subscriber: Subscriber) => void) | null;\n\n /**\n * The promise constructor used by default for {@link Observable#toPromise toPromise} and {@link Observable#forEach forEach}\n * methods.\n *\n * @deprecated As of version 8, RxJS will no longer support this sort of injection of a\n * Promise constructor. If you need a Promise implementation other than native promises,\n * please polyfill/patch Promise as you see appropriate. Will be removed in v8.\n */\n Promise?: PromiseConstructorLike;\n\n /**\n * If true, turns on synchronous error rethrowing, which is a deprecated behavior\n * in v6 and higher. This behavior enables bad patterns like wrapping a subscribe\n * call in a try/catch block. It also enables producer interference, a nasty bug\n * where a multicast can be broken for all observers by a downstream consumer with\n * an unhandled error. DO NOT USE THIS FLAG UNLESS IT'S NEEDED TO BUY TIME\n * FOR MIGRATION REASONS.\n *\n * @deprecated As of version 8, RxJS will no longer support synchronous throwing\n * of unhandled errors. All errors will be thrown on a separate call stack to prevent bad\n * behaviors described above. Will be removed in v8.\n */\n useDeprecatedSynchronousErrorHandling: boolean;\n\n /**\n * If true, enables an as-of-yet undocumented feature from v5: The ability to access\n * `unsubscribe()` via `this` context in `next` functions created in observers passed\n * to `subscribe`.\n *\n * This is being removed because the performance was severely problematic, and it could also cause\n * issues when types other than POJOs are passed to subscribe as subscribers, as they will likely have\n * their `this` context overwritten.\n *\n * @deprecated As of version 8, RxJS will no longer support altering the\n * context of next functions provided as part of an observer to Subscribe. Instead,\n * you will have access to a subscription or a signal or token that will allow you to do things like\n * unsubscribe and test closed status. Will be removed in v8.\n */\n useDeprecatedNextContext: boolean;\n}\n", "import type { TimerHandle } from './timerHandle';\ntype SetTimeoutFunction = (handler: () => void, timeout?: number, ...args: any[]) => TimerHandle;\ntype ClearTimeoutFunction = (handle: TimerHandle) => void;\n\ninterface TimeoutProvider {\n setTimeout: SetTimeoutFunction;\n clearTimeout: ClearTimeoutFunction;\n delegate:\n | {\n setTimeout: SetTimeoutFunction;\n clearTimeout: ClearTimeoutFunction;\n }\n | undefined;\n}\n\nexport const timeoutProvider: TimeoutProvider = {\n // When accessing the delegate, use the variable rather than `this` so that\n // the functions can be called without being bound to the provider.\n setTimeout(handler: () => void, timeout?: number, ...args) {\n const { delegate } = timeoutProvider;\n if (delegate?.setTimeout) {\n return delegate.setTimeout(handler, timeout, ...args);\n }\n return setTimeout(handler, timeout, ...args);\n },\n clearTimeout(handle) {\n const { delegate } = timeoutProvider;\n return (delegate?.clearTimeout || clearTimeout)(handle as any);\n },\n delegate: undefined,\n};\n", "import { config } from '../config';\nimport { timeoutProvider } from '../scheduler/timeoutProvider';\n\n/**\n * Handles an error on another job either with the user-configured {@link onUnhandledError},\n * or by throwing it on that new job so it can be picked up by `window.onerror`, `process.on('error')`, etc.\n *\n * This should be called whenever there is an error that is out-of-band with the subscription\n * or when an error hits a terminal boundary of the subscription and no error handler was provided.\n *\n * @param err the error to report\n */\nexport function reportUnhandledError(err: any) {\n timeoutProvider.setTimeout(() => {\n const { onUnhandledError } = config;\n if (onUnhandledError) {\n // Execute the user-configured error handler.\n onUnhandledError(err);\n } else {\n // Throw so it is picked up by the runtime's uncaught error mechanism.\n throw err;\n }\n });\n}\n", "/* tslint:disable:no-empty */\nexport function noop() { }\n", "import { CompleteNotification, NextNotification, ErrorNotification } from './types';\n\n/**\n * A completion object optimized for memory use and created to be the\n * same \"shape\" as other notifications in v8.\n * @internal\n */\nexport const COMPLETE_NOTIFICATION = (() => createNotification('C', undefined, undefined) as CompleteNotification)();\n\n/**\n * Internal use only. Creates an optimized error notification that is the same \"shape\"\n * as other notifications.\n * @internal\n */\nexport function errorNotification(error: any): ErrorNotification {\n return createNotification('E', undefined, error) as any;\n}\n\n/**\n * Internal use only. Creates an optimized next notification that is the same \"shape\"\n * as other notifications.\n * @internal\n */\nexport function nextNotification(value: T) {\n return createNotification('N', value, undefined) as NextNotification;\n}\n\n/**\n * Ensures that all notifications created internally have the same \"shape\" in v8.\n *\n * TODO: This is only exported to support a crazy legacy test in `groupBy`.\n * @internal\n */\nexport function createNotification(kind: 'N' | 'E' | 'C', value: any, error: any) {\n return {\n kind,\n value,\n error,\n };\n}\n", "import { config } from '../config';\n\nlet context: { errorThrown: boolean; error: any } | null = null;\n\n/**\n * Handles dealing with errors for super-gross mode. Creates a context, in which\n * any synchronously thrown errors will be passed to {@link captureError}. Which\n * will record the error such that it will be rethrown after the call back is complete.\n * TODO: Remove in v8\n * @param cb An immediately executed function.\n */\nexport function errorContext(cb: () => void) {\n if (config.useDeprecatedSynchronousErrorHandling) {\n const isRoot = !context;\n if (isRoot) {\n context = { errorThrown: false, error: null };\n }\n cb();\n if (isRoot) {\n const { errorThrown, error } = context!;\n context = null;\n if (errorThrown) {\n throw error;\n }\n }\n } else {\n // This is the general non-deprecated path for everyone that\n // isn't crazy enough to use super-gross mode (useDeprecatedSynchronousErrorHandling)\n cb();\n }\n}\n\n/**\n * Captures errors only in super-gross mode.\n * @param err the error to capture\n */\nexport function captureError(err: any) {\n if (config.useDeprecatedSynchronousErrorHandling && context) {\n context.errorThrown = true;\n context.error = err;\n }\n}\n", "import { isFunction } from './util/isFunction';\nimport { Observer, ObservableNotification } from './types';\nimport { isSubscription, Subscription } from './Subscription';\nimport { config } from './config';\nimport { reportUnhandledError } from './util/reportUnhandledError';\nimport { noop } from './util/noop';\nimport { nextNotification, errorNotification, COMPLETE_NOTIFICATION } from './NotificationFactories';\nimport { timeoutProvider } from './scheduler/timeoutProvider';\nimport { captureError } from './util/errorContext';\n\n/**\n * Implements the {@link Observer} interface and extends the\n * {@link Subscription} class. While the {@link Observer} is the public API for\n * consuming the values of an {@link Observable}, all Observers get converted to\n * a Subscriber, in order to provide Subscription-like capabilities such as\n * `unsubscribe`. Subscriber is a common type in RxJS, and crucial for\n * implementing operators, but it is rarely used as a public API.\n *\n * @class Subscriber\n */\nexport class Subscriber extends Subscription implements Observer {\n /**\n * A static factory for a Subscriber, given a (potentially partial) definition\n * of an Observer.\n * @param next The `next` callback of an Observer.\n * @param error The `error` callback of an\n * Observer.\n * @param complete The `complete` callback of an\n * Observer.\n * @return A Subscriber wrapping the (partially defined)\n * Observer represented by the given arguments.\n * @nocollapse\n * @deprecated Do not use. Will be removed in v8. There is no replacement for this\n * method, and there is no reason to be creating instances of `Subscriber` directly.\n * If you have a specific use case, please file an issue.\n */\n static create(next?: (x?: T) => void, error?: (e?: any) => void, complete?: () => void): Subscriber {\n return new SafeSubscriber(next, error, complete);\n }\n\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n protected isStopped: boolean = false;\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n protected destination: Subscriber | Observer; // this `any` is the escape hatch to erase extra type param (e.g. R)\n\n /**\n * @deprecated Internal implementation detail, do not use directly. Will be made internal in v8.\n * There is no reason to directly create an instance of Subscriber. This type is exported for typings reasons.\n */\n constructor(destination?: Subscriber | Observer) {\n super();\n if (destination) {\n this.destination = destination;\n // Automatically chain subscriptions together here.\n // if destination is a Subscription, then it is a Subscriber.\n if (isSubscription(destination)) {\n destination.add(this);\n }\n } else {\n this.destination = EMPTY_OBSERVER;\n }\n }\n\n /**\n * The {@link Observer} callback to receive notifications of type `next` from\n * the Observable, with a value. The Observable may call this method 0 or more\n * times.\n * @param {T} [value] The `next` value.\n * @return {void}\n */\n next(value?: T): void {\n if (this.isStopped) {\n handleStoppedNotification(nextNotification(value), this);\n } else {\n this._next(value!);\n }\n }\n\n /**\n * The {@link Observer} callback to receive notifications of type `error` from\n * the Observable, with an attached `Error`. Notifies the Observer that\n * the Observable has experienced an error condition.\n * @param {any} [err] The `error` exception.\n * @return {void}\n */\n error(err?: any): void {\n if (this.isStopped) {\n handleStoppedNotification(errorNotification(err), this);\n } else {\n this.isStopped = true;\n this._error(err);\n }\n }\n\n /**\n * The {@link Observer} callback to receive a valueless notification of type\n * `complete` from the Observable. Notifies the Observer that the Observable\n * has finished sending push-based notifications.\n * @return {void}\n */\n complete(): void {\n if (this.isStopped) {\n handleStoppedNotification(COMPLETE_NOTIFICATION, this);\n } else {\n this.isStopped = true;\n this._complete();\n }\n }\n\n unsubscribe(): void {\n if (!this.closed) {\n this.isStopped = true;\n super.unsubscribe();\n this.destination = null!;\n }\n }\n\n protected _next(value: T): void {\n this.destination.next(value);\n }\n\n protected _error(err: any): void {\n try {\n this.destination.error(err);\n } finally {\n this.unsubscribe();\n }\n }\n\n protected _complete(): void {\n try {\n this.destination.complete();\n } finally {\n this.unsubscribe();\n }\n }\n}\n\n/**\n * This bind is captured here because we want to be able to have\n * compatibility with monoid libraries that tend to use a method named\n * `bind`. In particular, a library called Monio requires this.\n */\nconst _bind = Function.prototype.bind;\n\nfunction bind any>(fn: Fn, thisArg: any): Fn {\n return _bind.call(fn, thisArg);\n}\n\n/**\n * Internal optimization only, DO NOT EXPOSE.\n * @internal\n */\nclass ConsumerObserver implements Observer {\n constructor(private partialObserver: Partial>) {}\n\n next(value: T): void {\n const { partialObserver } = this;\n if (partialObserver.next) {\n try {\n partialObserver.next(value);\n } catch (error) {\n handleUnhandledError(error);\n }\n }\n }\n\n error(err: any): void {\n const { partialObserver } = this;\n if (partialObserver.error) {\n try {\n partialObserver.error(err);\n } catch (error) {\n handleUnhandledError(error);\n }\n } else {\n handleUnhandledError(err);\n }\n }\n\n complete(): void {\n const { partialObserver } = this;\n if (partialObserver.complete) {\n try {\n partialObserver.complete();\n } catch (error) {\n handleUnhandledError(error);\n }\n }\n }\n}\n\nexport class SafeSubscriber extends Subscriber {\n constructor(\n observerOrNext?: Partial> | ((value: T) => void) | null,\n error?: ((e?: any) => void) | null,\n complete?: (() => void) | null\n ) {\n super();\n\n let partialObserver: Partial>;\n if (isFunction(observerOrNext) || !observerOrNext) {\n // The first argument is a function, not an observer. The next\n // two arguments *could* be observers, or they could be empty.\n partialObserver = {\n next: (observerOrNext ?? undefined) as (((value: T) => void) | undefined),\n error: error ?? undefined,\n complete: complete ?? undefined,\n };\n } else {\n // The first argument is a partial observer.\n let context: any;\n if (this && config.useDeprecatedNextContext) {\n // This is a deprecated path that made `this.unsubscribe()` available in\n // next handler functions passed to subscribe. This only exists behind a flag\n // now, as it is *very* slow.\n context = Object.create(observerOrNext);\n context.unsubscribe = () => this.unsubscribe();\n partialObserver = {\n next: observerOrNext.next && bind(observerOrNext.next, context),\n error: observerOrNext.error && bind(observerOrNext.error, context),\n complete: observerOrNext.complete && bind(observerOrNext.complete, context),\n };\n } else {\n // The \"normal\" path. Just use the partial observer directly.\n partialObserver = observerOrNext;\n }\n }\n\n // Wrap the partial observer to ensure it's a full observer, and\n // make sure proper error handling is accounted for.\n this.destination = new ConsumerObserver(partialObserver);\n }\n}\n\nfunction handleUnhandledError(error: any) {\n if (config.useDeprecatedSynchronousErrorHandling) {\n captureError(error);\n } else {\n // Ideal path, we report this as an unhandled error,\n // which is thrown on a new call stack.\n reportUnhandledError(error);\n }\n}\n\n/**\n * An error handler used when no error handler was supplied\n * to the SafeSubscriber -- meaning no error handler was supplied\n * do the `subscribe` call on our observable.\n * @param err The error to handle\n */\nfunction defaultErrorHandler(err: any) {\n throw err;\n}\n\n/**\n * A handler for notifications that cannot be sent to a stopped subscriber.\n * @param notification The notification being sent\n * @param subscriber The stopped subscriber\n */\nfunction handleStoppedNotification(notification: ObservableNotification, subscriber: Subscriber) {\n const { onStoppedNotification } = config;\n onStoppedNotification && timeoutProvider.setTimeout(() => onStoppedNotification(notification, subscriber));\n}\n\n/**\n * The observer used as a stub for subscriptions where the user did not\n * pass any arguments to `subscribe`. Comes with the default error handling\n * behavior.\n */\nexport const EMPTY_OBSERVER: Readonly> & { closed: true } = {\n closed: true,\n next: noop,\n error: defaultErrorHandler,\n complete: noop,\n};\n", "/**\n * Symbol.observable or a string \"@@observable\". Used for interop\n *\n * @deprecated We will no longer be exporting this symbol in upcoming versions of RxJS.\n * Instead polyfill and use Symbol.observable directly *or* use https://www.npmjs.com/package/symbol-observable\n */\nexport const observable: string | symbol = (() => (typeof Symbol === 'function' && Symbol.observable) || '@@observable')();\n", "/**\n * This function takes one parameter and just returns it. Simply put,\n * this is like `(x: T): T => x`.\n *\n * ## Examples\n *\n * This is useful in some cases when using things like `mergeMap`\n *\n * ```ts\n * import { interval, take, map, range, mergeMap, identity } from 'rxjs';\n *\n * const source$ = interval(1000).pipe(take(5));\n *\n * const result$ = source$.pipe(\n * map(i => range(i)),\n * mergeMap(identity) // same as mergeMap(x => x)\n * );\n *\n * result$.subscribe({\n * next: console.log\n * });\n * ```\n *\n * Or when you want to selectively apply an operator\n *\n * ```ts\n * import { interval, take, identity } from 'rxjs';\n *\n * const shouldLimit = () => Math.random() < 0.5;\n *\n * const source$ = interval(1000);\n *\n * const result$ = source$.pipe(shouldLimit() ? take(5) : identity);\n *\n * result$.subscribe({\n * next: console.log\n * });\n * ```\n *\n * @param x Any value that is returned by this function\n * @returns The value passed as the first parameter to this function\n */\nexport function identity(x: T): T {\n return x;\n}\n", "import { identity } from './identity';\nimport { UnaryFunction } from '../types';\n\nexport function pipe(): typeof identity;\nexport function pipe(fn1: UnaryFunction): UnaryFunction;\nexport function pipe(fn1: UnaryFunction, fn2: UnaryFunction): UnaryFunction;\nexport function pipe(fn1: UnaryFunction, fn2: UnaryFunction, fn3: UnaryFunction): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction,\n fn6: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction,\n fn6: UnaryFunction,\n fn7: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction,\n fn6: UnaryFunction,\n fn7: UnaryFunction,\n fn8: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction,\n fn6: UnaryFunction,\n fn7: UnaryFunction,\n fn8: UnaryFunction,\n fn9: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction,\n fn6: UnaryFunction,\n fn7: UnaryFunction,\n fn8: UnaryFunction,\n fn9: UnaryFunction,\n ...fns: UnaryFunction[]\n): UnaryFunction;\n\n/**\n * pipe() can be called on one or more functions, each of which can take one argument (\"UnaryFunction\")\n * and uses it to return a value.\n * It returns a function that takes one argument, passes it to the first UnaryFunction, and then\n * passes the result to the next one, passes that result to the next one, and so on. \n */\nexport function pipe(...fns: Array>): UnaryFunction {\n return pipeFromArray(fns);\n}\n\n/** @internal */\nexport function pipeFromArray(fns: Array>): UnaryFunction {\n if (fns.length === 0) {\n return identity as UnaryFunction;\n }\n\n if (fns.length === 1) {\n return fns[0];\n }\n\n return function piped(input: T): R {\n return fns.reduce((prev: any, fn: UnaryFunction) => fn(prev), input as any);\n };\n}\n", "import { Operator } from './Operator';\nimport { SafeSubscriber, Subscriber } from './Subscriber';\nimport { isSubscription, Subscription } from './Subscription';\nimport { TeardownLogic, OperatorFunction, Subscribable, Observer } from './types';\nimport { observable as Symbol_observable } from './symbol/observable';\nimport { pipeFromArray } from './util/pipe';\nimport { config } from './config';\nimport { isFunction } from './util/isFunction';\nimport { errorContext } from './util/errorContext';\n\n/**\n * A representation of any set of values over any amount of time. This is the most basic building block\n * of RxJS.\n *\n * @class Observable\n */\nexport class Observable implements Subscribable {\n /**\n * @deprecated Internal implementation detail, do not use directly. Will be made internal in v8.\n */\n source: Observable | undefined;\n\n /**\n * @deprecated Internal implementation detail, do not use directly. Will be made internal in v8.\n */\n operator: Operator | undefined;\n\n /**\n * @constructor\n * @param {Function} subscribe the function that is called when the Observable is\n * initially subscribed to. This function is given a Subscriber, to which new values\n * can be `next`ed, or an `error` method can be called to raise an error, or\n * `complete` can be called to notify of a successful completion.\n */\n constructor(subscribe?: (this: Observable, subscriber: Subscriber) => TeardownLogic) {\n if (subscribe) {\n this._subscribe = subscribe;\n }\n }\n\n // HACK: Since TypeScript inherits static properties too, we have to\n // fight against TypeScript here so Subject can have a different static create signature\n /**\n * Creates a new Observable by calling the Observable constructor\n * @owner Observable\n * @method create\n * @param {Function} subscribe? the subscriber function to be passed to the Observable constructor\n * @return {Observable} a new observable\n * @nocollapse\n * @deprecated Use `new Observable()` instead. Will be removed in v8.\n */\n static create: (...args: any[]) => any = (subscribe?: (subscriber: Subscriber) => TeardownLogic) => {\n return new Observable(subscribe);\n };\n\n /**\n * Creates a new Observable, with this Observable instance as the source, and the passed\n * operator defined as the new observable's operator.\n * @method lift\n * @param operator the operator defining the operation to take on the observable\n * @return a new observable with the Operator applied\n * @deprecated Internal implementation detail, do not use directly. Will be made internal in v8.\n * If you have implemented an operator using `lift`, it is recommended that you create an\n * operator by simply returning `new Observable()` directly. See \"Creating new operators from\n * scratch\" section here: https://rxjs.dev/guide/operators\n */\n lift(operator?: Operator): Observable {\n const observable = new Observable();\n observable.source = this;\n observable.operator = operator;\n return observable;\n }\n\n subscribe(observerOrNext?: Partial> | ((value: T) => void)): Subscription;\n /** @deprecated Instead of passing separate callback arguments, use an observer argument. Signatures taking separate callback arguments will be removed in v8. Details: https://rxjs.dev/deprecations/subscribe-arguments */\n subscribe(next?: ((value: T) => void) | null, error?: ((error: any) => void) | null, complete?: (() => void) | null): Subscription;\n /**\n * Invokes an execution of an Observable and registers Observer handlers for notifications it will emit.\n *\n * Use it when you have all these Observables, but still nothing is happening.\n *\n * `subscribe` is not a regular operator, but a method that calls Observable's internal `subscribe` function. It\n * might be for example a function that you passed to Observable's constructor, but most of the time it is\n * a library implementation, which defines what will be emitted by an Observable, and when it be will emitted. This means\n * that calling `subscribe` is actually the moment when Observable starts its work, not when it is created, as it is often\n * the thought.\n *\n * Apart from starting the execution of an Observable, this method allows you to listen for values\n * that an Observable emits, as well as for when it completes or errors. You can achieve this in two\n * of the following ways.\n *\n * The first way is creating an object that implements {@link Observer} interface. It should have methods\n * defined by that interface, but note that it should be just a regular JavaScript object, which you can create\n * yourself in any way you want (ES6 class, classic function constructor, object literal etc.). In particular, do\n * not attempt to use any RxJS implementation details to create Observers - you don't need them. Remember also\n * that your object does not have to implement all methods. If you find yourself creating a method that doesn't\n * do anything, you can simply omit it. Note however, if the `error` method is not provided and an error happens,\n * it will be thrown asynchronously. Errors thrown asynchronously cannot be caught using `try`/`catch`. Instead,\n * use the {@link onUnhandledError} configuration option or use a runtime handler (like `window.onerror` or\n * `process.on('error)`) to be notified of unhandled errors. Because of this, it's recommended that you provide\n * an `error` method to avoid missing thrown errors.\n *\n * The second way is to give up on Observer object altogether and simply provide callback functions in place of its methods.\n * This means you can provide three functions as arguments to `subscribe`, where the first function is equivalent\n * of a `next` method, the second of an `error` method and the third of a `complete` method. Just as in case of an Observer,\n * if you do not need to listen for something, you can omit a function by passing `undefined` or `null`,\n * since `subscribe` recognizes these functions by where they were placed in function call. When it comes\n * to the `error` function, as with an Observer, if not provided, errors emitted by an Observable will be thrown asynchronously.\n *\n * You can, however, subscribe with no parameters at all. This may be the case where you're not interested in terminal events\n * and you also handled emissions internally by using operators (e.g. using `tap`).\n *\n * Whichever style of calling `subscribe` you use, in both cases it returns a Subscription object.\n * This object allows you to call `unsubscribe` on it, which in turn will stop the work that an Observable does and will clean\n * up all resources that an Observable used. Note that cancelling a subscription will not call `complete` callback\n * provided to `subscribe` function, which is reserved for a regular completion signal that comes from an Observable.\n *\n * Remember that callbacks provided to `subscribe` are not guaranteed to be called asynchronously.\n * It is an Observable itself that decides when these functions will be called. For example {@link of}\n * by default emits all its values synchronously. Always check documentation for how given Observable\n * will behave when subscribed and if its default behavior can be modified with a `scheduler`.\n *\n * #### Examples\n *\n * Subscribe with an {@link guide/observer Observer}\n *\n * ```ts\n * import { of } from 'rxjs';\n *\n * const sumObserver = {\n * sum: 0,\n * next(value) {\n * console.log('Adding: ' + value);\n * this.sum = this.sum + value;\n * },\n * error() {\n * // We actually could just remove this method,\n * // since we do not really care about errors right now.\n * },\n * complete() {\n * console.log('Sum equals: ' + this.sum);\n * }\n * };\n *\n * of(1, 2, 3) // Synchronously emits 1, 2, 3 and then completes.\n * .subscribe(sumObserver);\n *\n * // Logs:\n * // 'Adding: 1'\n * // 'Adding: 2'\n * // 'Adding: 3'\n * // 'Sum equals: 6'\n * ```\n *\n * Subscribe with functions ({@link deprecations/subscribe-arguments deprecated})\n *\n * ```ts\n * import { of } from 'rxjs'\n *\n * let sum = 0;\n *\n * of(1, 2, 3).subscribe(\n * value => {\n * console.log('Adding: ' + value);\n * sum = sum + value;\n * },\n * undefined,\n * () => console.log('Sum equals: ' + sum)\n * );\n *\n * // Logs:\n * // 'Adding: 1'\n * // 'Adding: 2'\n * // 'Adding: 3'\n * // 'Sum equals: 6'\n * ```\n *\n * Cancel a subscription\n *\n * ```ts\n * import { interval } from 'rxjs';\n *\n * const subscription = interval(1000).subscribe({\n * next(num) {\n * console.log(num)\n * },\n * complete() {\n * // Will not be called, even when cancelling subscription.\n * console.log('completed!');\n * }\n * });\n *\n * setTimeout(() => {\n * subscription.unsubscribe();\n * console.log('unsubscribed!');\n * }, 2500);\n *\n * // Logs:\n * // 0 after 1s\n * // 1 after 2s\n * // 'unsubscribed!' after 2.5s\n * ```\n *\n * @param {Observer|Function} observerOrNext (optional) Either an observer with methods to be called,\n * or the first of three possible handlers, which is the handler for each value emitted from the subscribed\n * Observable.\n * @param {Function} error (optional) A handler for a terminal event resulting from an error. If no error handler is provided,\n * the error will be thrown asynchronously as unhandled.\n * @param {Function} complete (optional) A handler for a terminal event resulting from successful completion.\n * @return {Subscription} a subscription reference to the registered handlers\n * @method subscribe\n */\n subscribe(\n observerOrNext?: Partial> | ((value: T) => void) | null,\n error?: ((error: any) => void) | null,\n complete?: (() => void) | null\n ): Subscription {\n const subscriber = isSubscriber(observerOrNext) ? observerOrNext : new SafeSubscriber(observerOrNext, error, complete);\n\n errorContext(() => {\n const { operator, source } = this;\n subscriber.add(\n operator\n ? // We're dealing with a subscription in the\n // operator chain to one of our lifted operators.\n operator.call(subscriber, source)\n : source\n ? // If `source` has a value, but `operator` does not, something that\n // had intimate knowledge of our API, like our `Subject`, must have\n // set it. We're going to just call `_subscribe` directly.\n this._subscribe(subscriber)\n : // In all other cases, we're likely wrapping a user-provided initializer\n // function, so we need to catch errors and handle them appropriately.\n this._trySubscribe(subscriber)\n );\n });\n\n return subscriber;\n }\n\n /** @internal */\n protected _trySubscribe(sink: Subscriber): TeardownLogic {\n try {\n return this._subscribe(sink);\n } catch (err) {\n // We don't need to return anything in this case,\n // because it's just going to try to `add()` to a subscription\n // above.\n sink.error(err);\n }\n }\n\n /**\n * Used as a NON-CANCELLABLE means of subscribing to an observable, for use with\n * APIs that expect promises, like `async/await`. You cannot unsubscribe from this.\n *\n * **WARNING**: Only use this with observables you *know* will complete. If the source\n * observable does not complete, you will end up with a promise that is hung up, and\n * potentially all of the state of an async function hanging out in memory. To avoid\n * this situation, look into adding something like {@link timeout}, {@link take},\n * {@link takeWhile}, or {@link takeUntil} amongst others.\n *\n * #### Example\n *\n * ```ts\n * import { interval, take } from 'rxjs';\n *\n * const source$ = interval(1000).pipe(take(4));\n *\n * async function getTotal() {\n * let total = 0;\n *\n * await source$.forEach(value => {\n * total += value;\n * console.log('observable -> ' + value);\n * });\n *\n * return total;\n * }\n *\n * getTotal().then(\n * total => console.log('Total: ' + total)\n * );\n *\n * // Expected:\n * // 'observable -> 0'\n * // 'observable -> 1'\n * // 'observable -> 2'\n * // 'observable -> 3'\n * // 'Total: 6'\n * ```\n *\n * @param next a handler for each value emitted by the observable\n * @return a promise that either resolves on observable completion or\n * rejects with the handled error\n */\n forEach(next: (value: T) => void): Promise;\n\n /**\n * @param next a handler for each value emitted by the observable\n * @param promiseCtor a constructor function used to instantiate the Promise\n * @return a promise that either resolves on observable completion or\n * rejects with the handled error\n * @deprecated Passing a Promise constructor will no longer be available\n * in upcoming versions of RxJS. This is because it adds weight to the library, for very\n * little benefit. If you need this functionality, it is recommended that you either\n * polyfill Promise, or you create an adapter to convert the returned native promise\n * to whatever promise implementation you wanted. Will be removed in v8.\n */\n forEach(next: (value: T) => void, promiseCtor: PromiseConstructorLike): Promise;\n\n forEach(next: (value: T) => void, promiseCtor?: PromiseConstructorLike): Promise {\n promiseCtor = getPromiseCtor(promiseCtor);\n\n return new promiseCtor((resolve, reject) => {\n const subscriber = new SafeSubscriber({\n next: (value) => {\n try {\n next(value);\n } catch (err) {\n reject(err);\n subscriber.unsubscribe();\n }\n },\n error: reject,\n complete: resolve,\n });\n this.subscribe(subscriber);\n }) as Promise;\n }\n\n /** @internal */\n protected _subscribe(subscriber: Subscriber): TeardownLogic {\n return this.source?.subscribe(subscriber);\n }\n\n /**\n * An interop point defined by the es7-observable spec https://github.com/zenparsing/es-observable\n * @method Symbol.observable\n * @return {Observable} this instance of the observable\n */\n [Symbol_observable]() {\n return this;\n }\n\n /* tslint:disable:max-line-length */\n pipe(): Observable;\n pipe(op1: OperatorFunction): Observable;\n pipe(op1: OperatorFunction, op2: OperatorFunction): Observable;\n pipe(op1: OperatorFunction, op2: OperatorFunction, op3: OperatorFunction): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction,\n op6: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction,\n op6: OperatorFunction,\n op7: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction,\n op6: OperatorFunction,\n op7: OperatorFunction,\n op8: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction,\n op6: OperatorFunction,\n op7: OperatorFunction,\n op8: OperatorFunction,\n op9: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction,\n op6: OperatorFunction,\n op7: OperatorFunction,\n op8: OperatorFunction,\n op9: OperatorFunction,\n ...operations: OperatorFunction[]\n ): Observable;\n /* tslint:enable:max-line-length */\n\n /**\n * Used to stitch together functional operators into a chain.\n * @method pipe\n * @return {Observable} the Observable result of all of the operators having\n * been called in the order they were passed in.\n *\n * ## Example\n *\n * ```ts\n * import { interval, filter, map, scan } from 'rxjs';\n *\n * interval(1000)\n * .pipe(\n * filter(x => x % 2 === 0),\n * map(x => x + x),\n * scan((acc, x) => acc + x)\n * )\n * .subscribe(x => console.log(x));\n * ```\n */\n pipe(...operations: OperatorFunction[]): Observable {\n return pipeFromArray(operations)(this);\n }\n\n /* tslint:disable:max-line-length */\n /** @deprecated Replaced with {@link firstValueFrom} and {@link lastValueFrom}. Will be removed in v8. Details: https://rxjs.dev/deprecations/to-promise */\n toPromise(): Promise;\n /** @deprecated Replaced with {@link firstValueFrom} and {@link lastValueFrom}. Will be removed in v8. Details: https://rxjs.dev/deprecations/to-promise */\n toPromise(PromiseCtor: typeof Promise): Promise;\n /** @deprecated Replaced with {@link firstValueFrom} and {@link lastValueFrom}. Will be removed in v8. Details: https://rxjs.dev/deprecations/to-promise */\n toPromise(PromiseCtor: PromiseConstructorLike): Promise;\n /* tslint:enable:max-line-length */\n\n /**\n * Subscribe to this Observable and get a Promise resolving on\n * `complete` with the last emission (if any).\n *\n * **WARNING**: Only use this with observables you *know* will complete. If the source\n * observable does not complete, you will end up with a promise that is hung up, and\n * potentially all of the state of an async function hanging out in memory. To avoid\n * this situation, look into adding something like {@link timeout}, {@link take},\n * {@link takeWhile}, or {@link takeUntil} amongst others.\n *\n * @method toPromise\n * @param [promiseCtor] a constructor function used to instantiate\n * the Promise\n * @return A Promise that resolves with the last value emit, or\n * rejects on an error. If there were no emissions, Promise\n * resolves with undefined.\n * @deprecated Replaced with {@link firstValueFrom} and {@link lastValueFrom}. Will be removed in v8. Details: https://rxjs.dev/deprecations/to-promise\n */\n toPromise(promiseCtor?: PromiseConstructorLike): Promise {\n promiseCtor = getPromiseCtor(promiseCtor);\n\n return new promiseCtor((resolve, reject) => {\n let value: T | undefined;\n this.subscribe(\n (x: T) => (value = x),\n (err: any) => reject(err),\n () => resolve(value)\n );\n }) as Promise;\n }\n}\n\n/**\n * Decides between a passed promise constructor from consuming code,\n * A default configured promise constructor, and the native promise\n * constructor and returns it. If nothing can be found, it will throw\n * an error.\n * @param promiseCtor The optional promise constructor to passed by consuming code\n */\nfunction getPromiseCtor(promiseCtor: PromiseConstructorLike | undefined) {\n return promiseCtor ?? config.Promise ?? Promise;\n}\n\nfunction isObserver(value: any): value is Observer {\n return value && isFunction(value.next) && isFunction(value.error) && isFunction(value.complete);\n}\n\nfunction isSubscriber(value: any): value is Subscriber {\n return (value && value instanceof Subscriber) || (isObserver(value) && isSubscription(value));\n}\n", "import { Observable } from '../Observable';\nimport { Subscriber } from '../Subscriber';\nimport { OperatorFunction } from '../types';\nimport { isFunction } from './isFunction';\n\n/**\n * Used to determine if an object is an Observable with a lift function.\n */\nexport function hasLift(source: any): source is { lift: InstanceType['lift'] } {\n return isFunction(source?.lift);\n}\n\n/**\n * Creates an `OperatorFunction`. Used to define operators throughout the library in a concise way.\n * @param init The logic to connect the liftedSource to the subscriber at the moment of subscription.\n */\nexport function operate(\n init: (liftedSource: Observable, subscriber: Subscriber) => (() => void) | void\n): OperatorFunction {\n return (source: Observable) => {\n if (hasLift(source)) {\n return source.lift(function (this: Subscriber, liftedSource: Observable) {\n try {\n return init(liftedSource, this);\n } catch (err) {\n this.error(err);\n }\n });\n }\n throw new TypeError('Unable to lift unknown Observable type');\n };\n}\n", "import { Subscriber } from '../Subscriber';\n\n/**\n * Creates an instance of an `OperatorSubscriber`.\n * @param destination The downstream subscriber.\n * @param onNext Handles next values, only called if this subscriber is not stopped or closed. Any\n * error that occurs in this function is caught and sent to the `error` method of this subscriber.\n * @param onError Handles errors from the subscription, any errors that occur in this handler are caught\n * and send to the `destination` error handler.\n * @param onComplete Handles completion notification from the subscription. Any errors that occur in\n * this handler are sent to the `destination` error handler.\n * @param onFinalize Additional teardown logic here. This will only be called on teardown if the\n * subscriber itself is not already closed. This is called after all other teardown logic is executed.\n */\nexport function createOperatorSubscriber(\n destination: Subscriber,\n onNext?: (value: T) => void,\n onComplete?: () => void,\n onError?: (err: any) => void,\n onFinalize?: () => void\n): Subscriber {\n return new OperatorSubscriber(destination, onNext, onComplete, onError, onFinalize);\n}\n\n/**\n * A generic helper for allowing operators to be created with a Subscriber and\n * use closures to capture necessary state from the operator function itself.\n */\nexport class OperatorSubscriber extends Subscriber {\n /**\n * Creates an instance of an `OperatorSubscriber`.\n * @param destination The downstream subscriber.\n * @param onNext Handles next values, only called if this subscriber is not stopped or closed. Any\n * error that occurs in this function is caught and sent to the `error` method of this subscriber.\n * @param onError Handles errors from the subscription, any errors that occur in this handler are caught\n * and send to the `destination` error handler.\n * @param onComplete Handles completion notification from the subscription. Any errors that occur in\n * this handler are sent to the `destination` error handler.\n * @param onFinalize Additional finalization logic here. This will only be called on finalization if the\n * subscriber itself is not already closed. This is called after all other finalization logic is executed.\n * @param shouldUnsubscribe An optional check to see if an unsubscribe call should truly unsubscribe.\n * NOTE: This currently **ONLY** exists to support the strange behavior of {@link groupBy}, where unsubscription\n * to the resulting observable does not actually disconnect from the source if there are active subscriptions\n * to any grouped observable. (DO NOT EXPOSE OR USE EXTERNALLY!!!)\n */\n constructor(\n destination: Subscriber,\n onNext?: (value: T) => void,\n onComplete?: () => void,\n onError?: (err: any) => void,\n private onFinalize?: () => void,\n private shouldUnsubscribe?: () => boolean\n ) {\n // It's important - for performance reasons - that all of this class's\n // members are initialized and that they are always initialized in the same\n // order. This will ensure that all OperatorSubscriber instances have the\n // same hidden class in V8. This, in turn, will help keep the number of\n // hidden classes involved in property accesses within the base class as\n // low as possible. If the number of hidden classes involved exceeds four,\n // the property accesses will become megamorphic and performance penalties\n // will be incurred - i.e. inline caches won't be used.\n //\n // The reasons for ensuring all instances have the same hidden class are\n // further discussed in this blog post from Benedikt Meurer:\n // https://benediktmeurer.de/2018/03/23/impact-of-polymorphism-on-component-based-frameworks-like-react/\n super(destination);\n this._next = onNext\n ? function (this: OperatorSubscriber, value: T) {\n try {\n onNext(value);\n } catch (err) {\n destination.error(err);\n }\n }\n : super._next;\n this._error = onError\n ? function (this: OperatorSubscriber, err: any) {\n try {\n onError(err);\n } catch (err) {\n // Send any errors that occur down stream.\n destination.error(err);\n } finally {\n // Ensure finalization.\n this.unsubscribe();\n }\n }\n : super._error;\n this._complete = onComplete\n ? function (this: OperatorSubscriber) {\n try {\n onComplete();\n } catch (err) {\n // Send any errors that occur down stream.\n destination.error(err);\n } finally {\n // Ensure finalization.\n this.unsubscribe();\n }\n }\n : super._complete;\n }\n\n unsubscribe() {\n if (!this.shouldUnsubscribe || this.shouldUnsubscribe()) {\n const { closed } = this;\n super.unsubscribe();\n // Execute additional teardown if we have any and we didn't already do so.\n !closed && this.onFinalize?.();\n }\n }\n}\n", "import { Subscription } from '../Subscription';\n\ninterface AnimationFrameProvider {\n schedule(callback: FrameRequestCallback): Subscription;\n requestAnimationFrame: typeof requestAnimationFrame;\n cancelAnimationFrame: typeof cancelAnimationFrame;\n delegate:\n | {\n requestAnimationFrame: typeof requestAnimationFrame;\n cancelAnimationFrame: typeof cancelAnimationFrame;\n }\n | undefined;\n}\n\nexport const animationFrameProvider: AnimationFrameProvider = {\n // When accessing the delegate, use the variable rather than `this` so that\n // the functions can be called without being bound to the provider.\n schedule(callback) {\n let request = requestAnimationFrame;\n let cancel: typeof cancelAnimationFrame | undefined = cancelAnimationFrame;\n const { delegate } = animationFrameProvider;\n if (delegate) {\n request = delegate.requestAnimationFrame;\n cancel = delegate.cancelAnimationFrame;\n }\n const handle = request((timestamp) => {\n // Clear the cancel function. The request has been fulfilled, so\n // attempting to cancel the request upon unsubscription would be\n // pointless.\n cancel = undefined;\n callback(timestamp);\n });\n return new Subscription(() => cancel?.(handle));\n },\n requestAnimationFrame(...args) {\n const { delegate } = animationFrameProvider;\n return (delegate?.requestAnimationFrame || requestAnimationFrame)(...args);\n },\n cancelAnimationFrame(...args) {\n const { delegate } = animationFrameProvider;\n return (delegate?.cancelAnimationFrame || cancelAnimationFrame)(...args);\n },\n delegate: undefined,\n};\n", "import { createErrorClass } from './createErrorClass';\n\nexport interface ObjectUnsubscribedError extends Error {}\n\nexport interface ObjectUnsubscribedErrorCtor {\n /**\n * @deprecated Internal implementation detail. Do not construct error instances.\n * Cannot be tagged as internal: https://github.com/ReactiveX/rxjs/issues/6269\n */\n new (): ObjectUnsubscribedError;\n}\n\n/**\n * An error thrown when an action is invalid because the object has been\n * unsubscribed.\n *\n * @see {@link Subject}\n * @see {@link BehaviorSubject}\n *\n * @class ObjectUnsubscribedError\n */\nexport const ObjectUnsubscribedError: ObjectUnsubscribedErrorCtor = createErrorClass(\n (_super) =>\n function ObjectUnsubscribedErrorImpl(this: any) {\n _super(this);\n this.name = 'ObjectUnsubscribedError';\n this.message = 'object unsubscribed';\n }\n);\n", "import { Operator } from './Operator';\nimport { Observable } from './Observable';\nimport { Subscriber } from './Subscriber';\nimport { Subscription, EMPTY_SUBSCRIPTION } from './Subscription';\nimport { Observer, SubscriptionLike, TeardownLogic } from './types';\nimport { ObjectUnsubscribedError } from './util/ObjectUnsubscribedError';\nimport { arrRemove } from './util/arrRemove';\nimport { errorContext } from './util/errorContext';\n\n/**\n * A Subject is a special type of Observable that allows values to be\n * multicasted to many Observers. Subjects are like EventEmitters.\n *\n * Every Subject is an Observable and an Observer. You can subscribe to a\n * Subject, and you can call next to feed values as well as error and complete.\n */\nexport class Subject extends Observable implements SubscriptionLike {\n closed = false;\n\n private currentObservers: Observer[] | null = null;\n\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n observers: Observer[] = [];\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n isStopped = false;\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n hasError = false;\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n thrownError: any = null;\n\n /**\n * Creates a \"subject\" by basically gluing an observer to an observable.\n *\n * @nocollapse\n * @deprecated Recommended you do not use. Will be removed at some point in the future. Plans for replacement still under discussion.\n */\n static create: (...args: any[]) => any = (destination: Observer, source: Observable): AnonymousSubject => {\n return new AnonymousSubject(destination, source);\n };\n\n constructor() {\n // NOTE: This must be here to obscure Observable's constructor.\n super();\n }\n\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n lift(operator: Operator): Observable {\n const subject = new AnonymousSubject(this, this);\n subject.operator = operator as any;\n return subject as any;\n }\n\n /** @internal */\n protected _throwIfClosed() {\n if (this.closed) {\n throw new ObjectUnsubscribedError();\n }\n }\n\n next(value: T) {\n errorContext(() => {\n this._throwIfClosed();\n if (!this.isStopped) {\n if (!this.currentObservers) {\n this.currentObservers = Array.from(this.observers);\n }\n for (const observer of this.currentObservers) {\n observer.next(value);\n }\n }\n });\n }\n\n error(err: any) {\n errorContext(() => {\n this._throwIfClosed();\n if (!this.isStopped) {\n this.hasError = this.isStopped = true;\n this.thrownError = err;\n const { observers } = this;\n while (observers.length) {\n observers.shift()!.error(err);\n }\n }\n });\n }\n\n complete() {\n errorContext(() => {\n this._throwIfClosed();\n if (!this.isStopped) {\n this.isStopped = true;\n const { observers } = this;\n while (observers.length) {\n observers.shift()!.complete();\n }\n }\n });\n }\n\n unsubscribe() {\n this.isStopped = this.closed = true;\n this.observers = this.currentObservers = null!;\n }\n\n get observed() {\n return this.observers?.length > 0;\n }\n\n /** @internal */\n protected _trySubscribe(subscriber: Subscriber): TeardownLogic {\n this._throwIfClosed();\n return super._trySubscribe(subscriber);\n }\n\n /** @internal */\n protected _subscribe(subscriber: Subscriber): Subscription {\n this._throwIfClosed();\n this._checkFinalizedStatuses(subscriber);\n return this._innerSubscribe(subscriber);\n }\n\n /** @internal */\n protected _innerSubscribe(subscriber: Subscriber) {\n const { hasError, isStopped, observers } = this;\n if (hasError || isStopped) {\n return EMPTY_SUBSCRIPTION;\n }\n this.currentObservers = null;\n observers.push(subscriber);\n return new Subscription(() => {\n this.currentObservers = null;\n arrRemove(observers, subscriber);\n });\n }\n\n /** @internal */\n protected _checkFinalizedStatuses(subscriber: Subscriber) {\n const { hasError, thrownError, isStopped } = this;\n if (hasError) {\n subscriber.error(thrownError);\n } else if (isStopped) {\n subscriber.complete();\n }\n }\n\n /**\n * Creates a new Observable with this Subject as the source. You can do this\n * to create custom Observer-side logic of the Subject and conceal it from\n * code that uses the Observable.\n * @return {Observable} Observable that the Subject casts to\n */\n asObservable(): Observable {\n const observable: any = new Observable();\n observable.source = this;\n return observable;\n }\n}\n\n/**\n * @class AnonymousSubject\n */\nexport class AnonymousSubject extends Subject {\n constructor(\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n public destination?: Observer,\n source?: Observable\n ) {\n super();\n this.source = source;\n }\n\n next(value: T) {\n this.destination?.next?.(value);\n }\n\n error(err: any) {\n this.destination?.error?.(err);\n }\n\n complete() {\n this.destination?.complete?.();\n }\n\n /** @internal */\n protected _subscribe(subscriber: Subscriber): Subscription {\n return this.source?.subscribe(subscriber) ?? EMPTY_SUBSCRIPTION;\n }\n}\n", "import { TimestampProvider } from '../types';\n\ninterface DateTimestampProvider extends TimestampProvider {\n delegate: TimestampProvider | undefined;\n}\n\nexport const dateTimestampProvider: DateTimestampProvider = {\n now() {\n // Use the variable rather than `this` so that the function can be called\n // without being bound to the provider.\n return (dateTimestampProvider.delegate || Date).now();\n },\n delegate: undefined,\n};\n", "import { Subject } from './Subject';\nimport { TimestampProvider } from './types';\nimport { Subscriber } from './Subscriber';\nimport { Subscription } from './Subscription';\nimport { dateTimestampProvider } from './scheduler/dateTimestampProvider';\n\n/**\n * A variant of {@link Subject} that \"replays\" old values to new subscribers by emitting them when they first subscribe.\n *\n * `ReplaySubject` has an internal buffer that will store a specified number of values that it has observed. Like `Subject`,\n * `ReplaySubject` \"observes\" values by having them passed to its `next` method. When it observes a value, it will store that\n * value for a time determined by the configuration of the `ReplaySubject`, as passed to its constructor.\n *\n * When a new subscriber subscribes to the `ReplaySubject` instance, it will synchronously emit all values in its buffer in\n * a First-In-First-Out (FIFO) manner. The `ReplaySubject` will also complete, if it has observed completion; and it will\n * error if it has observed an error.\n *\n * There are two main configuration items to be concerned with:\n *\n * 1. `bufferSize` - This will determine how many items are stored in the buffer, defaults to infinite.\n * 2. `windowTime` - The amount of time to hold a value in the buffer before removing it from the buffer.\n *\n * Both configurations may exist simultaneously. So if you would like to buffer a maximum of 3 values, as long as the values\n * are less than 2 seconds old, you could do so with a `new ReplaySubject(3, 2000)`.\n *\n * ### Differences with BehaviorSubject\n *\n * `BehaviorSubject` is similar to `new ReplaySubject(1)`, with a couple of exceptions:\n *\n * 1. `BehaviorSubject` comes \"primed\" with a single value upon construction.\n * 2. `ReplaySubject` will replay values, even after observing an error, where `BehaviorSubject` will not.\n *\n * @see {@link Subject}\n * @see {@link BehaviorSubject}\n * @see {@link shareReplay}\n */\nexport class ReplaySubject extends Subject {\n private _buffer: (T | number)[] = [];\n private _infiniteTimeWindow = true;\n\n /**\n * @param bufferSize The size of the buffer to replay on subscription\n * @param windowTime The amount of time the buffered items will stay buffered\n * @param timestampProvider An object with a `now()` method that provides the current timestamp. This is used to\n * calculate the amount of time something has been buffered.\n */\n constructor(\n private _bufferSize = Infinity,\n private _windowTime = Infinity,\n private _timestampProvider: TimestampProvider = dateTimestampProvider\n ) {\n super();\n this._infiniteTimeWindow = _windowTime === Infinity;\n this._bufferSize = Math.max(1, _bufferSize);\n this._windowTime = Math.max(1, _windowTime);\n }\n\n next(value: T): void {\n const { isStopped, _buffer, _infiniteTimeWindow, _timestampProvider, _windowTime } = this;\n if (!isStopped) {\n _buffer.push(value);\n !_infiniteTimeWindow && _buffer.push(_timestampProvider.now() + _windowTime);\n }\n this._trimBuffer();\n super.next(value);\n }\n\n /** @internal */\n protected _subscribe(subscriber: Subscriber): Subscription {\n this._throwIfClosed();\n this._trimBuffer();\n\n const subscription = this._innerSubscribe(subscriber);\n\n const { _infiniteTimeWindow, _buffer } = this;\n // We use a copy here, so reentrant code does not mutate our array while we're\n // emitting it to a new subscriber.\n const copy = _buffer.slice();\n for (let i = 0; i < copy.length && !subscriber.closed; i += _infiniteTimeWindow ? 1 : 2) {\n subscriber.next(copy[i] as T);\n }\n\n this._checkFinalizedStatuses(subscriber);\n\n return subscription;\n }\n\n private _trimBuffer() {\n const { _bufferSize, _timestampProvider, _buffer, _infiniteTimeWindow } = this;\n // If we don't have an infinite buffer size, and we're over the length,\n // use splice to truncate the old buffer values off. Note that we have to\n // double the size for instances where we're not using an infinite time window\n // because we're storing the values and the timestamps in the same array.\n const adjustedBufferSize = (_infiniteTimeWindow ? 1 : 2) * _bufferSize;\n _bufferSize < Infinity && adjustedBufferSize < _buffer.length && _buffer.splice(0, _buffer.length - adjustedBufferSize);\n\n // Now, if we're not in an infinite time window, remove all values where the time is\n // older than what is allowed.\n if (!_infiniteTimeWindow) {\n const now = _timestampProvider.now();\n let last = 0;\n // Search the array for the first timestamp that isn't expired and\n // truncate the buffer up to that point.\n for (let i = 1; i < _buffer.length && (_buffer[i] as number) <= now; i += 2) {\n last = i;\n }\n last && _buffer.splice(0, last + 1);\n }\n }\n}\n", "import { Scheduler } from '../Scheduler';\nimport { Subscription } from '../Subscription';\nimport { SchedulerAction } from '../types';\n\n/**\n * A unit of work to be executed in a `scheduler`. An action is typically\n * created from within a {@link SchedulerLike} and an RxJS user does not need to concern\n * themselves about creating and manipulating an Action.\n *\n * ```ts\n * class Action extends Subscription {\n * new (scheduler: Scheduler, work: (state?: T) => void);\n * schedule(state?: T, delay: number = 0): Subscription;\n * }\n * ```\n *\n * @class Action\n */\nexport class Action extends Subscription {\n constructor(scheduler: Scheduler, work: (this: SchedulerAction, state?: T) => void) {\n super();\n }\n /**\n * Schedules this action on its parent {@link SchedulerLike} for execution. May be passed\n * some context object, `state`. May happen at some point in the future,\n * according to the `delay` parameter, if specified.\n * @param {T} [state] Some contextual data that the `work` function uses when\n * called by the Scheduler.\n * @param {number} [delay] Time to wait before executing the work, where the\n * time unit is implicit and defined by the Scheduler.\n * @return {void}\n */\n public schedule(state?: T, delay: number = 0): Subscription {\n return this;\n }\n}\n", "import type { TimerHandle } from './timerHandle';\ntype SetIntervalFunction = (handler: () => void, timeout?: number, ...args: any[]) => TimerHandle;\ntype ClearIntervalFunction = (handle: TimerHandle) => void;\n\ninterface IntervalProvider {\n setInterval: SetIntervalFunction;\n clearInterval: ClearIntervalFunction;\n delegate:\n | {\n setInterval: SetIntervalFunction;\n clearInterval: ClearIntervalFunction;\n }\n | undefined;\n}\n\nexport const intervalProvider: IntervalProvider = {\n // When accessing the delegate, use the variable rather than `this` so that\n // the functions can be called without being bound to the provider.\n setInterval(handler: () => void, timeout?: number, ...args) {\n const { delegate } = intervalProvider;\n if (delegate?.setInterval) {\n return delegate.setInterval(handler, timeout, ...args);\n }\n return setInterval(handler, timeout, ...args);\n },\n clearInterval(handle) {\n const { delegate } = intervalProvider;\n return (delegate?.clearInterval || clearInterval)(handle as any);\n },\n delegate: undefined,\n};\n", "import { Action } from './Action';\nimport { SchedulerAction } from '../types';\nimport { Subscription } from '../Subscription';\nimport { AsyncScheduler } from './AsyncScheduler';\nimport { intervalProvider } from './intervalProvider';\nimport { arrRemove } from '../util/arrRemove';\nimport { TimerHandle } from './timerHandle';\n\nexport class AsyncAction extends Action {\n public id: TimerHandle | undefined;\n public state?: T;\n // @ts-ignore: Property has no initializer and is not definitely assigned\n public delay: number;\n protected pending: boolean = false;\n\n constructor(protected scheduler: AsyncScheduler, protected work: (this: SchedulerAction, state?: T) => void) {\n super(scheduler, work);\n }\n\n public schedule(state?: T, delay: number = 0): Subscription {\n if (this.closed) {\n return this;\n }\n\n // Always replace the current state with the new state.\n this.state = state;\n\n const id = this.id;\n const scheduler = this.scheduler;\n\n //\n // Important implementation note:\n //\n // Actions only execute once by default, unless rescheduled from within the\n // scheduled callback. This allows us to implement single and repeat\n // actions via the same code path, without adding API surface area, as well\n // as mimic traditional recursion but across asynchronous boundaries.\n //\n // However, JS runtimes and timers distinguish between intervals achieved by\n // serial `setTimeout` calls vs. a single `setInterval` call. An interval of\n // serial `setTimeout` calls can be individually delayed, which delays\n // scheduling the next `setTimeout`, and so on. `setInterval` attempts to\n // guarantee the interval callback will be invoked more precisely to the\n // interval period, regardless of load.\n //\n // Therefore, we use `setInterval` to schedule single and repeat actions.\n // If the action reschedules itself with the same delay, the interval is not\n // canceled. If the action doesn't reschedule, or reschedules with a\n // different delay, the interval will be canceled after scheduled callback\n // execution.\n //\n if (id != null) {\n this.id = this.recycleAsyncId(scheduler, id, delay);\n }\n\n // Set the pending flag indicating that this action has been scheduled, or\n // has recursively rescheduled itself.\n this.pending = true;\n\n this.delay = delay;\n // If this action has already an async Id, don't request a new one.\n this.id = this.id ?? this.requestAsyncId(scheduler, this.id, delay);\n\n return this;\n }\n\n protected requestAsyncId(scheduler: AsyncScheduler, _id?: TimerHandle, delay: number = 0): TimerHandle {\n return intervalProvider.setInterval(scheduler.flush.bind(scheduler, this), delay);\n }\n\n protected recycleAsyncId(_scheduler: AsyncScheduler, id?: TimerHandle, delay: number | null = 0): TimerHandle | undefined {\n // If this action is rescheduled with the same delay time, don't clear the interval id.\n if (delay != null && this.delay === delay && this.pending === false) {\n return id;\n }\n // Otherwise, if the action's delay time is different from the current delay,\n // or the action has been rescheduled before it's executed, clear the interval id\n if (id != null) {\n intervalProvider.clearInterval(id);\n }\n\n return undefined;\n }\n\n /**\n * Immediately executes this action and the `work` it contains.\n * @return {any}\n */\n public execute(state: T, delay: number): any {\n if (this.closed) {\n return new Error('executing a cancelled action');\n }\n\n this.pending = false;\n const error = this._execute(state, delay);\n if (error) {\n return error;\n } else if (this.pending === false && this.id != null) {\n // Dequeue if the action didn't reschedule itself. Don't call\n // unsubscribe(), because the action could reschedule later.\n // For example:\n // ```\n // scheduler.schedule(function doWork(counter) {\n // /* ... I'm a busy worker bee ... */\n // var originalAction = this;\n // /* wait 100ms before rescheduling the action */\n // setTimeout(function () {\n // originalAction.schedule(counter + 1);\n // }, 100);\n // }, 1000);\n // ```\n this.id = this.recycleAsyncId(this.scheduler, this.id, null);\n }\n }\n\n protected _execute(state: T, _delay: number): any {\n let errored: boolean = false;\n let errorValue: any;\n try {\n this.work(state);\n } catch (e) {\n errored = true;\n // HACK: Since code elsewhere is relying on the \"truthiness\" of the\n // return here, we can't have it return \"\" or 0 or false.\n // TODO: Clean this up when we refactor schedulers mid-version-8 or so.\n errorValue = e ? e : new Error('Scheduled action threw falsy error');\n }\n if (errored) {\n this.unsubscribe();\n return errorValue;\n }\n }\n\n unsubscribe() {\n if (!this.closed) {\n const { id, scheduler } = this;\n const { actions } = scheduler;\n\n this.work = this.state = this.scheduler = null!;\n this.pending = false;\n\n arrRemove(actions, this);\n if (id != null) {\n this.id = this.recycleAsyncId(scheduler, id, null);\n }\n\n this.delay = null!;\n super.unsubscribe();\n }\n }\n}\n", "import { Action } from './scheduler/Action';\nimport { Subscription } from './Subscription';\nimport { SchedulerLike, SchedulerAction } from './types';\nimport { dateTimestampProvider } from './scheduler/dateTimestampProvider';\n\n/**\n * An execution context and a data structure to order tasks and schedule their\n * execution. Provides a notion of (potentially virtual) time, through the\n * `now()` getter method.\n *\n * Each unit of work in a Scheduler is called an `Action`.\n *\n * ```ts\n * class Scheduler {\n * now(): number;\n * schedule(work, delay?, state?): Subscription;\n * }\n * ```\n *\n * @class Scheduler\n * @deprecated Scheduler is an internal implementation detail of RxJS, and\n * should not be used directly. Rather, create your own class and implement\n * {@link SchedulerLike}. Will be made internal in v8.\n */\nexport class Scheduler implements SchedulerLike {\n public static now: () => number = dateTimestampProvider.now;\n\n constructor(private schedulerActionCtor: typeof Action, now: () => number = Scheduler.now) {\n this.now = now;\n }\n\n /**\n * A getter method that returns a number representing the current time\n * (at the time this function was called) according to the scheduler's own\n * internal clock.\n * @return {number} A number that represents the current time. May or may not\n * have a relation to wall-clock time. May or may not refer to a time unit\n * (e.g. milliseconds).\n */\n public now: () => number;\n\n /**\n * Schedules a function, `work`, for execution. May happen at some point in\n * the future, according to the `delay` parameter, if specified. May be passed\n * some context object, `state`, which will be passed to the `work` function.\n *\n * The given arguments will be processed an stored as an Action object in a\n * queue of actions.\n *\n * @param {function(state: ?T): ?Subscription} work A function representing a\n * task, or some unit of work to be executed by the Scheduler.\n * @param {number} [delay] Time to wait before executing the work, where the\n * time unit is implicit and defined by the Scheduler itself.\n * @param {T} [state] Some contextual data that the `work` function uses when\n * called by the Scheduler.\n * @return {Subscription} A subscription in order to be able to unsubscribe\n * the scheduled work.\n */\n public schedule(work: (this: SchedulerAction, state?: T) => void, delay: number = 0, state?: T): Subscription {\n return new this.schedulerActionCtor(this, work).schedule(state, delay);\n }\n}\n", "import { Scheduler } from '../Scheduler';\nimport { Action } from './Action';\nimport { AsyncAction } from './AsyncAction';\nimport { TimerHandle } from './timerHandle';\n\nexport class AsyncScheduler extends Scheduler {\n public actions: Array> = [];\n /**\n * A flag to indicate whether the Scheduler is currently executing a batch of\n * queued actions.\n * @type {boolean}\n * @internal\n */\n public _active: boolean = false;\n /**\n * An internal ID used to track the latest asynchronous task such as those\n * coming from `setTimeout`, `setInterval`, `requestAnimationFrame`, and\n * others.\n * @type {any}\n * @internal\n */\n public _scheduled: TimerHandle | undefined;\n\n constructor(SchedulerAction: typeof Action, now: () => number = Scheduler.now) {\n super(SchedulerAction, now);\n }\n\n public flush(action: AsyncAction): void {\n const { actions } = this;\n\n if (this._active) {\n actions.push(action);\n return;\n }\n\n let error: any;\n this._active = true;\n\n do {\n if ((error = action.execute(action.state, action.delay))) {\n break;\n }\n } while ((action = actions.shift()!)); // exhaust the scheduler queue\n\n this._active = false;\n\n if (error) {\n while ((action = actions.shift()!)) {\n action.unsubscribe();\n }\n throw error;\n }\n }\n}\n", "import { AsyncAction } from './AsyncAction';\nimport { AsyncScheduler } from './AsyncScheduler';\n\n/**\n *\n * Async Scheduler\n *\n * Schedule task as if you used setTimeout(task, duration)\n *\n * `async` scheduler schedules tasks asynchronously, by putting them on the JavaScript\n * event loop queue. It is best used to delay tasks in time or to schedule tasks repeating\n * in intervals.\n *\n * If you just want to \"defer\" task, that is to perform it right after currently\n * executing synchronous code ends (commonly achieved by `setTimeout(deferredTask, 0)`),\n * better choice will be the {@link asapScheduler} scheduler.\n *\n * ## Examples\n * Use async scheduler to delay task\n * ```ts\n * import { asyncScheduler } from 'rxjs';\n *\n * const task = () => console.log('it works!');\n *\n * asyncScheduler.schedule(task, 2000);\n *\n * // After 2 seconds logs:\n * // \"it works!\"\n * ```\n *\n * Use async scheduler to repeat task in intervals\n * ```ts\n * import { asyncScheduler } from 'rxjs';\n *\n * function task(state) {\n * console.log(state);\n * this.schedule(state + 1, 1000); // `this` references currently executing Action,\n * // which we reschedule with new state and delay\n * }\n *\n * asyncScheduler.schedule(task, 3000, 0);\n *\n * // Logs:\n * // 0 after 3s\n * // 1 after 4s\n * // 2 after 5s\n * // 3 after 6s\n * ```\n */\n\nexport const asyncScheduler = new AsyncScheduler(AsyncAction);\n\n/**\n * @deprecated Renamed to {@link asyncScheduler}. Will be removed in v8.\n */\nexport const async = asyncScheduler;\n", "import { AsyncAction } from './AsyncAction';\nimport { AnimationFrameScheduler } from './AnimationFrameScheduler';\nimport { SchedulerAction } from '../types';\nimport { animationFrameProvider } from './animationFrameProvider';\nimport { TimerHandle } from './timerHandle';\n\nexport class AnimationFrameAction extends AsyncAction {\n constructor(protected scheduler: AnimationFrameScheduler, protected work: (this: SchedulerAction, state?: T) => void) {\n super(scheduler, work);\n }\n\n protected requestAsyncId(scheduler: AnimationFrameScheduler, id?: TimerHandle, delay: number = 0): TimerHandle {\n // If delay is greater than 0, request as an async action.\n if (delay !== null && delay > 0) {\n return super.requestAsyncId(scheduler, id, delay);\n }\n // Push the action to the end of the scheduler queue.\n scheduler.actions.push(this);\n // If an animation frame has already been requested, don't request another\n // one. If an animation frame hasn't been requested yet, request one. Return\n // the current animation frame request id.\n return scheduler._scheduled || (scheduler._scheduled = animationFrameProvider.requestAnimationFrame(() => scheduler.flush(undefined)));\n }\n\n protected recycleAsyncId(scheduler: AnimationFrameScheduler, id?: TimerHandle, delay: number = 0): TimerHandle | undefined {\n // If delay exists and is greater than 0, or if the delay is null (the\n // action wasn't rescheduled) but was originally scheduled as an async\n // action, then recycle as an async action.\n if (delay != null ? delay > 0 : this.delay > 0) {\n return super.recycleAsyncId(scheduler, id, delay);\n }\n // If the scheduler queue has no remaining actions with the same async id,\n // cancel the requested animation frame and set the scheduled flag to\n // undefined so the next AnimationFrameAction will request its own.\n const { actions } = scheduler;\n if (id != null && actions[actions.length - 1]?.id !== id) {\n animationFrameProvider.cancelAnimationFrame(id as number);\n scheduler._scheduled = undefined;\n }\n // Return undefined so the action knows to request a new async id if it's rescheduled.\n return undefined;\n }\n}\n", "import { AsyncAction } from './AsyncAction';\nimport { AsyncScheduler } from './AsyncScheduler';\n\nexport class AnimationFrameScheduler extends AsyncScheduler {\n public flush(action?: AsyncAction): void {\n this._active = true;\n // The async id that effects a call to flush is stored in _scheduled.\n // Before executing an action, it's necessary to check the action's async\n // id to determine whether it's supposed to be executed in the current\n // flush.\n // Previous implementations of this method used a count to determine this,\n // but that was unsound, as actions that are unsubscribed - i.e. cancelled -\n // are removed from the actions array and that can shift actions that are\n // scheduled to be executed in a subsequent flush into positions at which\n // they are executed within the current flush.\n const flushId = this._scheduled;\n this._scheduled = undefined;\n\n const { actions } = this;\n let error: any;\n action = action || actions.shift()!;\n\n do {\n if ((error = action.execute(action.state, action.delay))) {\n break;\n }\n } while ((action = actions[0]) && action.id === flushId && actions.shift());\n\n this._active = false;\n\n if (error) {\n while ((action = actions[0]) && action.id === flushId && actions.shift()) {\n action.unsubscribe();\n }\n throw error;\n }\n }\n}\n", "import { AnimationFrameAction } from './AnimationFrameAction';\nimport { AnimationFrameScheduler } from './AnimationFrameScheduler';\n\n/**\n *\n * Animation Frame Scheduler\n *\n * Perform task when `window.requestAnimationFrame` would fire\n *\n * When `animationFrame` scheduler is used with delay, it will fall back to {@link asyncScheduler} scheduler\n * behaviour.\n *\n * Without delay, `animationFrame` scheduler can be used to create smooth browser animations.\n * It makes sure scheduled task will happen just before next browser content repaint,\n * thus performing animations as efficiently as possible.\n *\n * ## Example\n * Schedule div height animation\n * ```ts\n * // html:
    \n * import { animationFrameScheduler } from 'rxjs';\n *\n * const div = document.querySelector('div');\n *\n * animationFrameScheduler.schedule(function(height) {\n * div.style.height = height + \"px\";\n *\n * this.schedule(height + 1); // `this` references currently executing Action,\n * // which we reschedule with new state\n * }, 0, 0);\n *\n * // You will see a div element growing in height\n * ```\n */\n\nexport const animationFrameScheduler = new AnimationFrameScheduler(AnimationFrameAction);\n\n/**\n * @deprecated Renamed to {@link animationFrameScheduler}. Will be removed in v8.\n */\nexport const animationFrame = animationFrameScheduler;\n", "import { Observable } from '../Observable';\nimport { SchedulerLike } from '../types';\n\n/**\n * A simple Observable that emits no items to the Observer and immediately\n * emits a complete notification.\n *\n * Just emits 'complete', and nothing else.\n *\n * ![](empty.png)\n *\n * A simple Observable that only emits the complete notification. It can be used\n * for composing with other Observables, such as in a {@link mergeMap}.\n *\n * ## Examples\n *\n * Log complete notification\n *\n * ```ts\n * import { EMPTY } from 'rxjs';\n *\n * EMPTY.subscribe({\n * next: () => console.log('Next'),\n * complete: () => console.log('Complete!')\n * });\n *\n * // Outputs\n * // Complete!\n * ```\n *\n * Emit the number 7, then complete\n *\n * ```ts\n * import { EMPTY, startWith } from 'rxjs';\n *\n * const result = EMPTY.pipe(startWith(7));\n * result.subscribe(x => console.log(x));\n *\n * // Outputs\n * // 7\n * ```\n *\n * Map and flatten only odd numbers to the sequence `'a'`, `'b'`, `'c'`\n *\n * ```ts\n * import { interval, mergeMap, of, EMPTY } from 'rxjs';\n *\n * const interval$ = interval(1000);\n * const result = interval$.pipe(\n * mergeMap(x => x % 2 === 1 ? of('a', 'b', 'c') : EMPTY),\n * );\n * result.subscribe(x => console.log(x));\n *\n * // Results in the following to the console:\n * // x is equal to the count on the interval, e.g. (0, 1, 2, 3, ...)\n * // x will occur every 1000ms\n * // if x % 2 is equal to 1, print a, b, c (each on its own)\n * // if x % 2 is not equal to 1, nothing will be output\n * ```\n *\n * @see {@link Observable}\n * @see {@link NEVER}\n * @see {@link of}\n * @see {@link throwError}\n */\nexport const EMPTY = new Observable((subscriber) => subscriber.complete());\n\n/**\n * @param scheduler A {@link SchedulerLike} to use for scheduling\n * the emission of the complete notification.\n * @deprecated Replaced with the {@link EMPTY} constant or {@link scheduled} (e.g. `scheduled([], scheduler)`). Will be removed in v8.\n */\nexport function empty(scheduler?: SchedulerLike) {\n return scheduler ? emptyScheduled(scheduler) : EMPTY;\n}\n\nfunction emptyScheduled(scheduler: SchedulerLike) {\n return new Observable((subscriber) => scheduler.schedule(() => subscriber.complete()));\n}\n", "import { SchedulerLike } from '../types';\nimport { isFunction } from './isFunction';\n\nexport function isScheduler(value: any): value is SchedulerLike {\n return value && isFunction(value.schedule);\n}\n", "import { SchedulerLike } from '../types';\nimport { isFunction } from './isFunction';\nimport { isScheduler } from './isScheduler';\n\nfunction last(arr: T[]): T | undefined {\n return arr[arr.length - 1];\n}\n\nexport function popResultSelector(args: any[]): ((...args: unknown[]) => unknown) | undefined {\n return isFunction(last(args)) ? args.pop() : undefined;\n}\n\nexport function popScheduler(args: any[]): SchedulerLike | undefined {\n return isScheduler(last(args)) ? args.pop() : undefined;\n}\n\nexport function popNumber(args: any[], defaultValue: number): number {\n return typeof last(args) === 'number' ? args.pop()! : defaultValue;\n}\n", "export const isArrayLike = ((x: any): x is ArrayLike => x && typeof x.length === 'number' && typeof x !== 'function');", "import { isFunction } from \"./isFunction\";\n\n/**\n * Tests to see if the object is \"thennable\".\n * @param value the object to test\n */\nexport function isPromise(value: any): value is PromiseLike {\n return isFunction(value?.then);\n}\n", "import { InteropObservable } from '../types';\nimport { observable as Symbol_observable } from '../symbol/observable';\nimport { isFunction } from './isFunction';\n\n/** Identifies an input as being Observable (but not necessary an Rx Observable) */\nexport function isInteropObservable(input: any): input is InteropObservable {\n return isFunction(input[Symbol_observable]);\n}\n", "import { isFunction } from './isFunction';\n\nexport function isAsyncIterable(obj: any): obj is AsyncIterable {\n return Symbol.asyncIterator && isFunction(obj?.[Symbol.asyncIterator]);\n}\n", "/**\n * Creates the TypeError to throw if an invalid object is passed to `from` or `scheduled`.\n * @param input The object that was passed.\n */\nexport function createInvalidObservableTypeError(input: any) {\n // TODO: We should create error codes that can be looked up, so this can be less verbose.\n return new TypeError(\n `You provided ${\n input !== null && typeof input === 'object' ? 'an invalid object' : `'${input}'`\n } where a stream was expected. You can provide an Observable, Promise, ReadableStream, Array, AsyncIterable, or Iterable.`\n );\n}\n", "export function getSymbolIterator(): symbol {\n if (typeof Symbol !== 'function' || !Symbol.iterator) {\n return '@@iterator' as any;\n }\n\n return Symbol.iterator;\n}\n\nexport const iterator = getSymbolIterator();\n", "import { iterator as Symbol_iterator } from '../symbol/iterator';\nimport { isFunction } from './isFunction';\n\n/** Identifies an input as being an Iterable */\nexport function isIterable(input: any): input is Iterable {\n return isFunction(input?.[Symbol_iterator]);\n}\n", "import { ReadableStreamLike } from '../types';\nimport { isFunction } from './isFunction';\n\nexport async function* readableStreamLikeToAsyncGenerator(readableStream: ReadableStreamLike): AsyncGenerator {\n const reader = readableStream.getReader();\n try {\n while (true) {\n const { value, done } = await reader.read();\n if (done) {\n return;\n }\n yield value!;\n }\n } finally {\n reader.releaseLock();\n }\n}\n\nexport function isReadableStreamLike(obj: any): obj is ReadableStreamLike {\n // We don't want to use instanceof checks because they would return\n // false for instances from another Realm, like an @@ -1389,7 +1404,7 @@

    {"base": "..", "features": ["content.tooltips", "navigation.footer", "navigation.tabs", "search.highlight", "search.share", "search.suggest", "toc.integrate", "content.tabs.link", "content.code.copy"], "search": "../assets/javascripts/workers/search.b8dbb3d2.min.js", "translations": {"clipboard.copied": "Copied to clipboard", "clipboard.copy": "Copy to clipboard", "search.result.more.one": "1 more on this page", "search.result.more.other": "# more on this page", "search.result.none": "No matching documents", "search.result.one": "1 matching document", "search.result.other": "# matching documents", "search.result.placeholder": "Type to start searching", "search.result.term.missing": "Missing", "select.version": "Select version"}} - + diff --git a/search/search_index.json b/search/search_index.json index 485381f5..4d073111 100644 --- a/search/search_index.json +++ b/search/search_index.json @@ -1 +1 @@ -{"config":{"lang":["en"],"separator":"[\\s\\-]+","pipeline":["stopWordFilter"]},"docs":[{"location":"","title":"Home","text":""},{"location":"#nf-test-a-simple-testing-framework-for-nextflow-pipelines","title":"nf-test: A simple testing framework for Nextflow pipelines","text":"

    Test your production ready\u00a0Nextflow\u00a0pipelines in an efficient and automated way. \ud83d\ude80

    Getting Started Installation Source

    A DSL language similar to Nextflow Describes expected behavior using 'when' and 'then' blocks Abundance of functions for writing elegant and readable assertions Utilizes snapshots to write tests for complex data structures Provides commands for generating boilerplate code Includes a test-runner that executes these scripts Easy installation on CI systems

    "},{"location":"#unit-testing","title":"Unit testing","text":"

    nf-test enables you to test all components of your data science pipeline: from end-to-end testing of the entire pipeline to specific tests of processes or even custom functions. This ensures that all testing is conducted consistently across your project.

    Pipeline Process Functions 
    nextflow_pipeline {\n\n  name \"Test Hello World\"\n  script \"nextflow-io/hello\"\n\n  test(\"hello world example should start 4 processes\") {\n    expect {\n      with(workflow) {\n        assert success\n        assert trace.tasks().size() == 4\n        assert \"Ciao world!\" in stdout\n        assert \"Bonjour world!\" in stdout\n        assert \"Hello world!\" in stdout\n        assert \"Hola world!\" in stdout\n      }\n    }\n  }\n\n}\n
    nextflow_process {\n\n    name \"Test Process SALMON_INDEX\"\n    script \"modules/local/salmon_index.nf\"\n    process \"SALMON_INDEX\"\n\n    test(\"Should create channel index files\") {\n\n        when {\n            process {\n                \"\"\"\n                input[0] = file(\"test_data/transcriptome.fa\")\n                \"\"\"\n            }\n        }\n\n        then {\n            //check if test case succeeded\n            assert process.success\n            //analyze trace file\n            assert process.trace.tasks().size() == 1\n            with(process.out) {\n                // check if emitted output has been created\n                assert index.size() == 1\n                // count amount of created files\n                assert path(index.get(0)).list().size() == 16\n                // parse info.json file\n                def info = path(index.get(0)+'/info.json').json\n                assert info.num_kmers == 375730\n                assert info.seq_length == 443050\n                //verify md5 checksum\n                assert path(index.get(0)+'/info.json').md5 == \"80831602e2ac825e3e63ba9df5d23505\"\n            }\n        }\n\n    }\n\n}\n
    nextflow_function {\n\n    name \"Test functions\"\n    script \"functions.nf\"\n\n    test(\"Test function1\") {\n      function \"function1\"\n      ...\n    }\n\n    test(\"Test function2\") {\n      function \"function2\"\n      ...\n    }\n}\n

    Learn more about pipeline tests, workflow tests, process tests and function tests in the documentation.

    "},{"location":"#snapshot-testing","title":"Snapshot testing","text":"

    nf-test supports snapshot testing and automatically generates a baseline set of unit tests to safeguard against regressions caused by changes.nf-test captures a snapshot of output channels or any other objects and subsequently compares them to reference snapshot files stored alongside the tests. If the two snapshots do not match, the test will fail

    Learn more

    "},{"location":"#highly-extendable","title":"Highly extendable","text":"

    nf-test supports the inclusion of third-party libraries (e.g., jar files) or functions from Groovy files. This can be done to either extend its functionality or to prevent code duplication, thus maintaining simplicity in the logic of test cases. Given that many assertions are specific to use cases, nf-test incorporates a plugin system that allows for the extension of existing classes with custom methods. For example FASTA file support.

    Learn more

    "},{"location":"#support-us","title":"Support us","text":"

    We love stars as much as we love rockets! So make sure you star us on GitHub.

    Star

    Show the world your Nextflow pipeline is using nf-test and add the following badge to your README.md:

    [![nf-test](https://img.shields.io/badge/tested_with-nf--test-337ab7.svg)](https://code.askimed.com/nf-test)\n
    "},{"location":"#about","title":"About","text":"

    nf-test has been created by Lukas Forer and Sebastian Sch\u00f6nherr and is MIT Licensed.

    Thanks to all the contributors to help us maintaining and improving nf-test!

    "},{"location":"about/","title":"About","text":"

    nf-test has been created by Lukas Forer and Sebastian Sch\u00f6nherr and is MIT Licensed.

    "},{"location":"about/#contributors","title":"Contributors","text":""},{"location":"about/#statistics","title":"Statistics","text":"

    GitHub:

    Bioconda:

    "},{"location":"installation/","title":"Installation","text":"

    nf-test has the same requirements as Nextflow and can be used on POSIX compatible systems like Linux or OS X. You can install nf-test using the following command:

    curl -fsSL https://code.askimed.com/install/nf-test | bash\n

    If you don't have curl installed, you could use wget:

    wget -qO- https://code.askimed.com/install/nf-test | bash\n

    It will create the nf-test executable file in the current directory. Optionally, move the nf-test file to a directory accessible by your $PATH variable.

    "},{"location":"installation/#verify-installation","title":"Verify installation","text":"

    Test the installation with the following command:

    nf-test version\n

    You should see something like this:

    \ud83d\ude80 nf-test 0.5.0\nhttps://code.askimed.com/nf-test\n(c) 2021 -2022 Lukas Forer and Sebastian Schoenherr\n\nNextflow Runtime:\n\n      N E X T F L O W\n      version 21.10.6 build 5660\n      created 21-12-2021 16:55 UTC (17:55 CEST)\n      cite doi:10.1038/nbt.3820\n      http://nextflow.io\n

    Now you are ready to write your first testcase.

    "},{"location":"installation/#install-a-specific-version","title":"Install a specific version","text":"

    If you want to install a specific version pass it to the install script as so

    curl -fsSL https://code.askimed.com/install/nf-test | bash -s 0.7.0\n
    "},{"location":"installation/#manual-installation","title":"Manual installation","text":"

    All releases are also available on Github.

    "},{"location":"installation/#nextflow-binary-not-found","title":"Nextflow Binary not found?","text":"

    If you get an error message like this, then nf-test was not able to detect your Nextflow installation.

    \ud83d\ude80 nf-test 0.5.0\nhttps://code.askimed.com/nf-test\n(c) 2021 -2022 Lukas Forer and Sebastian Schoenherr\n\nNextflow Runtime:\nError: Nextflow Binary not found. Please check if Nextflow is in a directory accessible by your $PATH variable or set $NEXTFLOW_HOME.\n

    To solve this issue you have two possibilites:

    • Move your Nextflow binary to a directory accessible by your $PATH variable.
    • Set the environment variable NEXTFLOW_HOME to the directory that contains the Nextflow binary.
    "},{"location":"installation/#updating","title":"Updating","text":"

    To update an existing nf-test installtion to the latest version, run the following command:

    nf-test update\n
    "},{"location":"installation/#compiling-from-source","title":"Compiling from source","text":"

    To compile nf-test from source you shall have maven installed. This will produce a nf-test/target/nf-test.jar file.

    git clone git@github.com:askimed/nf-test.git\ncd nf-test\nmvn install\n
    To use the newly compiled nf-test.jar, update the nf-test bash script that is on your PATH to point to the new .jar file. First locate it with which nf-test, and then modify APP_HOME and APP_JAR vars at the top: 
    #!/bin/bash\nAPP_HOME=\"/PATH/TO/nf-test/target/\"\nAPP_JAR=\"nf-test.jar\"\nAPP_UPDATE_URL=\"https://code.askimed.com/install/nf-test\"\n...\n

    "},{"location":"resources/","title":"Resources","text":"

    This page collects videos and blog posts about nf-test created by the community. Have you authored a blog post or given a talk about nf-test? Feel free to contact us, and we will be delighted to feature it here.

    "},{"location":"resources/#nf-corebytesize-converting-pytest-modules-to-nf-test","title":"nf-core/bytesize: Converting pytest modules to nf-test","text":"

    Adam Talbot & Sateesh Peri do a live demo of converting nf-core DSL2 modules pytests to nf-test

    The presentation was recored as part of the nf-core/bytesize series.

    "},{"location":"resources/#nf-test-a-simple-but-powerful-testing-framework-for-nextflow-pipelines","title":"nf-test: a simple but powerful testing framework for Nextflow pipelines","text":"

    Lukas Forer provides an overview of nf-test, its evolution over time and up-coming features.

    The presentation was recorded as part of the 2023 Nextflow Summit in Barcelona.

    "},{"location":"resources/#nf-test-a-simple-test-framework-specifically-tailored-for-nextflow-pipelines","title":"nf-test, a simple test framework specifically tailored for Nextflow pipelines","text":"

    Sateesh Peri does a hands-on exploration of nf-test, a simple test framework specifically tailored for Nextflow pipelines.

    Slides to follow along can be found here.

    The presentation was recorded as part of the Workflows Community Meetup - All Things Groovy at the Wellcome Genome Campus.

    "},{"location":"resources/#nf-corebytesize-nf-test","title":"nf-core/bytesize: nf-test","text":"

    Edmund Miller shares with us his impressions about nf-test from a user perspective. nf-test is a simple test framework for Nextflow pipelines.

    The presentation was recored as part of the nf-core/bytesize

    "},{"location":"resources/#episode-8-nf-test-mentorships-and-debugging-resume","title":"Episode 8: nf-test, mentorships and debugging resume","text":"

    Phil Ewels, Chris Hakkaart and Marcel Ribeiro-Dantas chat about the nf-test framework for testing Nextflow pipelines.

    The presentation was part of the \"News & Views\" episode of Channels (Nextflow Podcast).

    "},{"location":"resources/#blog-post-a-simple-test-framework-for-nextflow-pipelines","title":"Blog post: A simple test framework for Nextflow pipelines","text":"

    Discover how nf-test originated from the need to efficiently and automatically test production-ready Nextflow pipelines.

    Read blog post

    "},{"location":"docs/configuration/","title":"Configuration","text":""},{"location":"docs/configuration/#nf-testconfig","title":"nf-test.config","text":"

    The nf-test.config file is a configuration file used to customize settings and behavior for nf-test. This file must be located in the root of your project, and it is automatically loaded when you run nf-test test. Below are the parameters that can be adapted:

    Parameter Description Default Value testsDir Location for storing all nf-test cases (test scripts). If you want all test files to be in the same directory as the script itself, you can set the testDir to . \"tests\" workDir Directory for storing temporary files and working directories for each test. This directory should be added to .gitignore. \".nf-test\" configFile Location of an optional nextflow.config file specifically used for executing tests. Learn more. \"tests/nextflow.config\" libDir Location of a library folder that is automatically added to the classpath during testing to include additional libraries or resources needed for test cases. \"tests/lib\" profile Default profile to use for running tests defined in the Nextflow configuration. See Learn more. \"docker\" withTrace Enable or disable tracing options during testing. Disable tracing if your containers don't include the procps tool. true autoSort Enable or disable sorted channels by default when running tests. true options Custom Nextflow command-line options to be applied when running tests. For example \"-dump-channels -stub-run\"

    Here's an example of what an nf-test.config file could look like:

    config {\n    testsDir \"tests\"\n    workDir \".nf-test\"\n    configFile \"tests/nextflow.config\"\n    libDir \"tests/lib\"\n    profile \"docker\"\n    withTrace false\n    autoSort false\n    options \"-dump-channels -stub-run\"\n}\n
    "},{"location":"docs/configuration/#testsnextflowconfig","title":"tests/nextflow.config","text":"

    This optional nextflow.config file is used to execute tests. This is a good place to set default params for all your tests. Example number of threads:

    params {\n    // run all tests with 1 threads\n    threads = 1\n}\n
    "},{"location":"docs/configuration/#configuration-for-tests","title":"Configuration for tests","text":"

    nf-test allows to set and overwrite the config, autoSort and options properties for a specific testsuite:

    nextflow_process {\n\n    name \"Test Process...\"\n    script \"main.nf\"\n    process \"my_process\"\n    config \"path/to/test/nextflow.config\"\n    autoSort false\n    options \"-dump-channels\"\n    ...\n\n}\n

    It is also possible to overwrite these properties for specific test. Depending on the used Nextflow option, also add the --debug nf-test option on the command-line to see the addtional output.

    nextflow_process {\n\n   test(\"my test\") {\n\n      config \"path/to/test/nextflow.config\"\n      autoSort false\n      options \"-dump-channels\"\n      ...\n\n    }\n\n}\n
    "},{"location":"docs/configuration/#managing-profiles","title":"Managing Profiles","text":"

    Profiles in nf-test provide a convenient way to configure and customize Nextflow executions for your test cases. To run your test using a specific Nextflow profile, you can use the --profile argument on the command line or define a default profile in nf-test.config.

    "},{"location":"docs/configuration/#basic-profile-usage","title":"Basic Profile Usage","text":"

    By default, nf-test reads the profile configuration from nf-test.config. If you've defined a profile called A in nf-test.config, running nf-test --profile B will start Nextflow with only the B profile. It replaces any existing profiles.

    "},{"location":"docs/configuration/#combining-profiles-with","title":"Combining Profiles with \"+\"","text":"

    To combine profiles, you can use the + prefix. For example, running nf-test --profile +B will start Nextflow with both A and B profiles, resulting in -profile A,B. This allows you to extend the existing configuration with additional profiles.

    "},{"location":"docs/configuration/#profile-priority-order","title":"Profile Priority Order","text":"

    Profiles are evaluated in a specific order, ensuring predictable behavior:

    1. Profile in nf-test.config: The first profile considered is the one defined in nf-test.config.

    2. Profile Defined in Testcase: If you specify a profile within a testcase, it takes precedence over the one in nf-test.config.

    3. Profile Defined on the Command Line (CLI): Finally, any profiles provided directly through the CLI have the highest priority and override/extends previously defined profiles.

    By understanding this profile evaluation order, you can effectively configure Nextflow executions for your test cases in a flexible and organized manner.

    "},{"location":"docs/configuration/#file-staging","title":"File Staging","text":"

    The stage section of the nf-test.config file is used to define files that are needed by Nextflow in the test environment (meta directory). Additionally, the directories lib, bin, and assets are automatically staged.

    "},{"location":"docs/configuration/#supported-directives","title":"Supported Directives","text":""},{"location":"docs/configuration/#symlink","title":"symlink","text":"

    This directive is used to create symbolic links (symlinks) in the test environment. Symlinks are pointers to files or directories and can be useful for creating references to data files or directories required for the test. The syntax for the symlink directive is as follows:

    symlink \"source_path\"\n

    source_path: The path to the source file or directory that you want to symlink.

    "},{"location":"docs/configuration/#copy","title":"copy","text":"

    This directive is used to copy files or directories into the test environment. It allows you to duplicate files from a specified source to a location within the test environment. The syntax for the copy directive is as follows:

    copy \"source_path\"\n

    source_path: The path to the source file or directory that you want to copy.

    "},{"location":"docs/configuration/#example-usage","title":"Example Usage","text":"

    Here's an example of how to use the stage section in an nf-test.config file:

    config {\n    ...\n    stage {\n        symlink \"data/original_data.txt\"\n        copy \"resources/config.yml\"\n    }\n    ...\n}\n

    In this example:

    • The symlink directive creates a symlink named \"original_data.txt\" in the meta directory pointing to the file located at \"data/original_data.txt.\"
    • The copy directive copies the \"config.yml\" file from the \"resources\" directory to the meta directory.
    "},{"location":"docs/configuration/#testsuite","title":"Testsuite","text":"

    Furthermore, it is also possible to stage files that are specific to a single testsuite:

    nextflow_workflow {\n\n    name \"Test workflow HELLO_WORKFLOW\"\n\n    script \"./hello.nf\"\n    workflow \"HELLO_WORKFLOW\"\n\n    stage {\n        symlink \"test-assets/test.txt\"\n    }\n\n    test(\"Should print out test file\") {\n        expect {\n            assert workflow.success\n        }\n    }\n\n}\n
    "},{"location":"docs/getting-started/","title":"Getting started","text":"

    This guide helps you to understand the concepts of nf-test and to write your first test cases. Before you start, please check if you have installed nf-test properly on your computer. Also, this guide assumes that you have a basic knowledge of Groovy and unit testing. The Groovy documentation is the best place to learn its syntax.

    "},{"location":"docs/getting-started/#lets-get-started","title":"Let's get started","text":"

    To show the power of nf-test, we adapted a recently published proof of concept Nextflow pipeline. We adapted the pipeline to the new DSL2 syntax using modules. First, open the terminal and clone our test pipeline:

    # clone nextflow pipeline\ngit clone https://github.com/askimed/nf-test-examples\n\n# enter project directory\ncd nf-test-examples\n

    The pipeline consists of three modules (salmon.index.nf, salmon_align_quant.nf,fastqc.nf). Here, we use the salmon.index.nf process to create a test case from scratch. This process takes a reference as an input and creates an index using salmon.

    "},{"location":"docs/getting-started/#init-new-project","title":"Init new project","text":"

    Before creating test cases, we use the init command to setup nf-test.

    //Init command has already been executed for our repository\nnf-test init\n

    The init command creates the following files: nf-test.config and the .nf-test/tests folder.

    In the configuration section you can learn more about these files and how to customize the directory layout.

    "},{"location":"docs/getting-started/#create-your-first-test","title":"Create your first test","text":"

    The generate command helps you to create a skeleton test code for a Nextflow process or the complete pipeline/workflow.

    Here we generate a test case for the process salmon.index.nf:

    # delete already existing test case\nrm tests/modules/local/salmon_index.nf.test\nnf-test generate process modules/local/salmon_index.nf\n

    This command creates a new file tests/modules/local/salmon_index.nf with the following content:

    nextflow_process {\n\n    name \"Test Process SALMON_INDEX\"\n    script \"modules/local/salmon_index.nf\"\n    process \"SALMON_INDEX\"\n\n    test(\"Should run without failures\") {\n\n        when {\n            params {\n                // define parameters here. Example:\n                // outdir = \"tests/results\"\n            }\n            process {\n                \"\"\"\n                // define inputs of the process here. Example:\n                // input[0] = file(\"test-file.txt\")\n                \"\"\"\n            }\n        }\n\n        then {\n            assert process.success\n            with(process.out) {\n              // Make assertions about the content and elements of output channels here. Example:\n              // assert out_channel != null\n            }\n        }\n\n    }\n\n}\n

    The generate command filled automatically the name, script and process of our test case as well as created a skeleton for your first test method. Typically you create one file per process and use different test methods to describe the expected behaviour of the process.

    This test has a name, a when and a then closure (when/then closures are required here, since inputs need to be defined). The when block describes the input parameters of the workflow or the process. nf-test executes the process with exactly these parameters and parses the content of the output channels. Then, it evaluates the assertions defined in the then block to check if content of the output channels matches your expectations.

    "},{"location":"docs/getting-started/#the-when-block","title":"The when block","text":"

    The when block describes the input of the process and/or the Nextflow params.

    The params block is optional and is a simple map that can be used to override Nextflow's input params.

    The process block is a multi-line string. The input array can be used to set the different inputs arguments of the process. In our example, we only have one input that expects a file. Let us update the process block by setting the first element of the input array to the path of our reference file:

    when {\n    params {\n        outdir = \"output\"\n    }\n    process {\n        \"\"\"\n        // Use transcriptome.fa as a first input paramter for our process\n        input[0] = file(\"${projectDir}/test_data/transcriptome.fa\")\n        \"\"\"\n    }\n}\n

    Everything which is defined in the process block is later executed in a Nextflow script (created automatically to test your process). Therefore, you can use every Nextflow specific function or command to define the values of the input array (e.g. Channels, files, paths, etc.).

    "},{"location":"docs/getting-started/#the-then-block","title":"The then block","text":"

    The then block describes the expected output channels of the process when we execute it with the input parameters defined in the when block.

    The then block typically contains mainly assertions to check assumptions (e.g. the size and the content of an output channel). However, this block accepts every Groovy script. This means you can also import third party libraries to define very specific assertions.

    nf-test automatically loads all output channels of the process and all their items into a map named process.out. You can then use this map to formulate your assertions.

    For example, in the salmon_index process we expect to get one process executed and 16 files created. But we also want to check the md5 sum and want to look into the actual JSON file. Let us update the then section with some assertions that describe our expectations:

    then {\n    //check if test case succeeded\n    assert process.success\n    //analyze trace file\n    assert process.trace.tasks().size() == 1\n    with(process.out) {\n      // check if emitted output has been created\n      assert index.size() == 1\n      // count amount of created files\n      assert path(index.get(0)).list().size() == 16\n      // parse info.json file using a json parser provided by nf-test\n      def info = path(index.get(0)+'/info.json').json\n      assert info.num_kmers == 375730\n      assert info.seq_length == 443050\n      assert path(index.get(0)+'/info.json').md5 == \"80831602e2ac825e3e63ba9df5d23505\"\n    }\n}\n

    The items of a channel are always sorted by nf-test. This provides a deterministic order inside the channel and enables you to write reproducible tests.

    "},{"location":"docs/getting-started/#your-first-test-specification","title":"Your first test specification","text":"

    You can update the name of the test method to something that gives us later a good description of our specification. When we put everything together, we get the following full working test specification:

    nextflow_process {\n\n    name \"Test Process SALMON_INDEX\"\n    script \"modules/local/salmon_index.nf\"\n    process \"SALMON_INDEX\"\n\n    test(\"Should create channel index files\") {\n\n        when {\n            process {\n                \"\"\"\n                input[0] = file(\"${projectDir}/test_data/transcriptome.fa\")\n                \"\"\"\n            }\n        }\n\n        then {\n            //check if test case succeeded\n            assert process.success\n            //analyze trace file\n            assert process.trace.tasks().size() == 1\n            with(process.out) {\n              // check if emitted output has been created\n              assert index.size() == 1\n              // count amount of created files\n              assert path(index.get(0)).list().size() == 16\n              // parse info.json file\n              def info = path(index.get(0)+'/info.json').json\n              assert info.num_kmers == 375730\n              assert info.seq_length == 443050\n              assert path(index.get(0)+'/info.json').md5 == \"80831602e2ac825e3e63ba9df5d23505\"\n            }\n        }\n    }\n}\n
    "},{"location":"docs/getting-started/#run-your-first-test","title":"Run your first test","text":"

    Now, the test command can be used to run your test:

    nf-test test tests/modules/local/salmon_index.nf.test --profile docker\n
    "},{"location":"docs/getting-started/#specifying-profiles","title":"Specifying profiles","text":"

    In this case, the docker profile defined in the Nextflow pipeline is used to execute the test. The profile is set using the --profile parameter, but you can also define a default profile in the configuration file.

    Congratulations! You created you first nf-test specification.

    "},{"location":"docs/getting-started/#nextflow-options","title":"Nextflow options","text":"

    nf-test also allows to specify Nextflow options (e.g. -dump-channels, -stub-run) globally in the nf-test.config file or by adding an option to the test suite or the actual test. Read more about this in the configuration documentation. 

    nextflow_process {\n\n    options \"-dump-channels\"\n\n}\n
    "},{"location":"docs/getting-started/#whats-next","title":"What's next?","text":"
    • Learn how to write assertions
    • Learn how to write workflow tests (integration test or e2e)
    • Learn how to config nf-test
    "},{"location":"docs/nftest_pipelines/","title":"Pipelines using nf-test","text":""},{"location":"docs/nftest_pipelines/#nf-test-examples","title":"nf-test-examples","text":"

    All test cases described in this documentation can be found in the nf-test-examples repository.

    "},{"location":"docs/nftest_pipelines/#gwas-regenie-pipeline","title":"GWAS-Regenie Pipeline","text":"

    To show the power of nf-test, we applied nf-test to a Nextflow pipeline that performs whole genome regression modelling using regenie. Please click here to learn more about this pipeline and checkout different kind of test cases.

    "},{"location":"docs/running-tests/","title":"Running tests","text":""},{"location":"docs/running-tests/#basic-usage","title":"Basic usage","text":"

    The easiest way to use nf-test is to run the following command. This command will run all tests under the tests directory. The testDir can be changed in the nf-test.config.

    nf-test test\n
    "},{"location":"docs/running-tests/#execute-specific-tests","title":"Execute specific tests","text":"

    You can also specify a list of tests, which should be executed. 

    nf-test test tests/modules/local/salmon_index.nf.test tests/modules/bwa_index.nf.test\n\nnf-test test tests/modules tests/modules/bwa_index.nf.test\n
    "},{"location":"docs/running-tests/#tag-tests","title":"Tag tests","text":"

    nf-test provides a simple tagging mechanism that allows to execute tests by name or by tag.

    Tags can be defined for each testsuite or for each testcase using the new tag directive:

    nextflow_process {\n\n    name \"suite 1\"\n    tag \"tag1\"\n\n    test(\"test 1\") {\n        tag \"tag2\"\n        tag \"tag3\"   \n        ...\n    }\n\n    test(\"test 2\") {\n\n        tag \"tag4\"\n        tag \"tag5\"   \n        ...\n\n    }\n}\n

    For example, to execute all tests with tag2 use the following command.

    nf-test test --tag tag2  # collects test1\n

    Names are automatically added to tags. This enables to execute suits or tests directly. 

    nf-test test --tag \"suite 1\"  # collects test1 and test2\n

    When more tags are provided,\u00a0all tests that match at least one tag will be executed. Tags are also not case-sensitive, both lines will result the same tests.

    nf-test test --tag tag3,tag4  # collects test1 and test2\nnf-test test --tag TAG3,TAG4  # collects test1 and test2\n
    "},{"location":"docs/running-tests/#create-a-tap-output","title":"Create a TAP output","text":"

    To run all tests and create a report.tap file, use the following command.

    nf-test test --tap report.tap\n
    "},{"location":"docs/running-tests/#run-test-by-its-hash-value","title":"Run test by its hash value","text":"

    To run a specific test using its hash, the following command can be used. The hash value is generated during its first execution. 

    nf-test test tests/main.nf.test@d41119e4\n
    "},{"location":"docs/assertions/assertions/","title":"Assertions","text":"

    Writing test cases means formulating assumptions by using assertions. Groovy\u2019s power assert provides a detailed output when the boolean expression validates to false. nf-test provides several extensions and commands to simplify the work with Nextflow channels. Here we summarise how nextflow and nf-test handles channels and provide examples for the tools that nf-test provides:

    • with: assert the contents of an item in a channel by index
    • contains: assert the contents of an item in the channel is present anywhere in the channel
    • assertContainsInAnyOrder: order-agnostic assertion of the contents of a channel
    "},{"location":"docs/assertions/assertions/#nextflow-channels-and-nf-test-channel-sorting","title":"Nextflow channels and nf-test channel sorting","text":"

    Nextflow channels emit (in a random order) a single value or a tuple of values.

    Channels that emit a single item produce an unordered list of objects, List<Object>, for example: 

    process.out.outputCh = ['Hola', 'Hello', 'Bonjour']\n

    Channels that contain Nextflow file values have a unique path each run. For Example: 

    process.out.outputCh = ['/.nf-test/tests/c563c/work/65/85d0/Hola.json', '/.nf-test/tests/c563c/work/65/fa20/Hello.json', '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json']\n

    Channels that emit tuples produce an unordered list of ordered objects, List<List<Object>>: 

    process.out.outputCh = [\n  ['Hola', '/.nf-test/tests/c563c/work/65/85d0/Hola.json'], \n  ['Hello', '/.nf-test/tests/c563c/work/65/fa20/Hello.json'], \n  ['Bonjour', '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json']\n]\n

    Assertions by channel index are made possible through sorting of the nextflow channel. The sorting is performed automatically by nf-test prior to launch of the then closure via integer, string and path comparisons. For example, the above would be sorted by nf-test: 

    process.out.outputCh = [\n  ['Bonjour', '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json'],\n  ['Hello', '/.nf-test/tests/c563c/work/65/fa20/Hello.json'],\n  ['Hola', '/.nf-test/tests/c563c/work/65/85d0/Hola.json']\n]\n

    "},{"location":"docs/assertions/assertions/#using-with","title":"Using with","text":"

    This assertions...

    assert process.out.imputed_plink2\nassert process.out.imputed_plink2.size() == 1\nassert process.out.imputed_plink2.get(0).get(0) == \"example.vcf\"\nassert process.out.imputed_plink2.get(0).get(1) ==~ \".*/example.vcf.pgen\"\nassert process.out.imputed_plink2.get(0).get(2) ==~ \".*/example.vcf.psam\"\nassert process.out.imputed_plink2.get(0).get(3) ==~ \".*/example.vcf.pvar\"\n

    ... can be written by using with(){} to improve readability:

    assert process.out.imputed_plink2\nwith(process.out.imputed_plink2) {\n    assert size() == 1\n    with(get(0)) {\n        assert get(0) == \"example.vcf\"\n        assert get(1) ==~ \".*/example.vcf.pgen\"\n        assert get(2) ==~ \".*/example.vcf.psam\"\n        assert get(3) ==~ \".*/example.vcf.pvar\"\n    }\n}\n
    "},{"location":"docs/assertions/assertions/#using-contains-to-assert-an-item-in-the-channel-is-present","title":"Using contains to assert an item in the channel is present","text":"

    Groovy's contains and collect methods can be used to flexibly assert an item exists in the channel output.

    For example, the below represents a channel that emits a two-element tuple, a string and a json file: 

    /*\ndef process.out.outputCh = [\n  ['Bonjour', '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json'],\n  ['Hello', '/.nf-test/tests/c563c/work/65/fa20/Hello.json'],\n  ['Hola', '/.nf-test/tests/c563c/work/65/85d0/Hola.json']\n]\n*/\n

    To assert the channel contains one of the tuples, parse the json and assert: 

    testData = process.out.outputCh.collect { greeting, jsonPath -> [greeting, path(jsonPath).json] } \nassert testData.contains(['Hello', path('./myTestData/Hello.json').json])\n

    To assert a subset of the tuple data, filter the channel using collect. For example, to assert the greeting only: 

    testData = process.out.outputCh.collect { greeting, jsonPath -> greeting } \nassert testData.contains('Hello')\n

    See the files page for more information on parsing and asserting various file types.

    "},{"location":"docs/assertions/assertions/#using-assertcontainsinanyorder-for-order-agnostic-assertion-of-the-contents-of-a-channel","title":"Using assertContainsInAnyOrder for order-agnostic assertion of the contents of a channel","text":"

    assertContainsInAnyOrder(List<object> list1, List<object> list2) performs an order agnostic assertion on channels contents and is available in every nf-test closure. It is a binding for Hamcrest's assertContainsInAnyOrder.

    Some example use-cases are provided below.

    "},{"location":"docs/assertions/assertions/#channel-that-emits-strings","title":"Channel that emits strings","text":"
    // process.out.outputCh = ['Bonjour', 'Hello', 'Hola'] \n\ndef expected = ['Hola', 'Hello', 'Bonjour']\nassertContainsInAnyOrder(process.out.outputCh, expected)\n
    "},{"location":"docs/assertions/assertions/#channel-that-emits-a-single-maps-eg-valmymap","title":"Channel that emits a single maps, e.g. val(myMap)","text":"
    /*\nprocess.out.outputCh = [\n  [\n    'D': [10,11,12],\n    'C': [7,8,9]\n  ],\n  [\n    'B': [4,5,6],\n    'A': [1,2,3]\n  ]\n]\n*/\n\ndef expected = [\n  [\n    'A': [1,2,3],\n    'B': [4,5,6]\n  ],\n  [\n    'C': [7,8,9],\n    'D': [10,11,12]\n  ]\n]\n\nassertContainsInAnyOrder(process.out.outputCh, expected)\n
    "},{"location":"docs/assertions/assertions/#channel-that-emits-json-files","title":"Channel that emits json files","text":"

    See the files page for more information on parsing and asserting various file types.

    Since the outputCh filepaths are different between consecutive runs, the files need to be read/parsed prior to comparison

    /*\nprocess.out.outputCh = [\n  '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json',\n  '/.nf-test/tests/c563c/work/65/fa20/Hello.json',\n  '/.nf-test/tests/c563c/work/65/85d0/Hola.json'\n]\n*/\n\ndef actual = process.out.outputCh.collect { filepath -> path(filepath).json }\ndef expected = [\n  path('./myTestData/Hello.json').json,\n  path('./myTestData/Hola.json').json,\n  path('./myTestData/Bonjour.json').json,\n]\n\nassertContainsInAnyOrder(actual, expected)\n
    "},{"location":"docs/assertions/assertions/#channel-that-emits-a-tuple-of-strings-and-json-files","title":"Channel that emits a tuple of strings and json files","text":"

    See the files page for more information on parsing and asserting various file types.

    Since the ordering of items within the tuples are consistent, we can assert this case:

    /*\nprocess.out.outputCh = [\n  ['Bonjour', '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json'],\n  ['Hello', '/.nf-test/tests/c563c/work/65/fa20/Hello.json'],\n  ['Hola', '/.nf-test/tests/c563c/work/65/85d0/Hola.json']\n]\n*/\n\ndef actual = process.out.outputCh.collect { greeting, filepath -> [greeting, path(filepath).json] }\ndef expected = [\n  ['Hola', path('./myTestData/Hola.json').json], \n  ['Hello', path('./myTestData/Hello.json').json],\n  ['Bonjour', path('./myTestData/Bonjour.json').json],\n]\n\nassertContainsInAnyOrder(actual, expected)\n

    To assert the json only and ignore the strings: 

    /*\nprocess.out.outputCh = [\n  ['Bonjour', '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json'],\n  ['Hello', '/.nf-test/tests/c563c/work/65/fa20/Hello.json'],\n  ['Hola', '/.nf-test/tests/c563c/work/65/85d0/Hola.json']\n]\n*/\n\ndef actual = process.out.outputCh.collect { greeting, filepath -> path(filepath).json }\ndef expected = [\n  path('./myTestData/Hello.json').json, \n  path('./myTestData/Hola.json').json,\n  path('./myTestData/Bonjour.json').json\n]\n\nassertContainsInAnyOrder(actual, expected)\n

    To assert the strings only and not the json files: 

    /*\nprocess.out.outputCh = [\n  ['Bonjour', '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json'],\n  ['Hello', '/.nf-test/tests/c563c/work/65/fa20/Hello.json'],\n  ['Hola', '/.nf-test/tests/c563c/work/65/85d0/Hola.json']\n]\n*/\n\ndef actual = process.out.outputCh.collect { greeting, filepath -> greeting }\ndef expected = ['Hello', 'Hola', 'Bonjour]\n\nassertContainsInAnyOrder(actual, expected)\n

    "},{"location":"docs/assertions/assertions/#using-assertall","title":"Using assertAll","text":"

    assertAll(Closure... closures) ensures that all supplied closures do no throw exceptions. The number of failed closures is reported in the Exception message. This useful for efficient debugging of a set of test assertions from a single test run.

    def a = 2\n\nassertAll(\n    { assert a==1 },\n    { a = 1/0 },\n    { assert a==2 },\n    { assert a==3 }\n)\n
    The output will look like this: 
    assert a==1\n       ||\n       |false\n       2\n\njava.lang.ArithmeticException: Division by zero\nAssertion failed:\n\nassert a==3\n       ||\n       |false\n       2\n\nFAILED (7.106s)\n\n  java.lang.Exception: 3 of 4 assertions failed\n

    "},{"location":"docs/assertions/fasta/","title":"FASTA Files","text":"

    0.7.0

    The nft-fasta plugin extends path by a fasta property that can be used to read FASTA files into maps. nft-fasta supports also gzipped FASTA files.

    "},{"location":"docs/assertions/fasta/#setup","title":"Setup","text":"

    To use the fasta property you need to activate the nft-fasta plugin in your nf-test.config file:

    config {\n  plugins {\n    load \"nft-fasta@1.0.0\"\n  }\n}\n

    More about plugins can be fond here.

    "},{"location":"docs/assertions/fasta/#comparing-files","title":"Comparing files","text":"
    assert path('path/to/fasta1.fasta').fasta == path(\"path/to/fasta2.fasta'\").fasta\n
    "},{"location":"docs/assertions/fasta/#work-with-individual-samples","title":"Work with individual samples","text":"
    def sequences = path('path/to/fasta1.fasta.gz').fasta\nassert \"seq1\" in sequences\nassert !(\"seq8\" in sequences)\nassert sequences.seq1 == \"AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC\"\n
    "},{"location":"docs/assertions/files/","title":"Files","text":""},{"location":"docs/assertions/files/#md5-checksum","title":"md5 Checksum","text":"

    nf-test extends path by a md5 property that can be used to compare the file content with an expected checksum:

    assert path(process.out.out_ch.get(0)).md5 == \"64debea5017a035ddc67c0b51fa84b16\"\n
    Note that for gzip compressed files, the md5 property is calculated after gunzipping the file contents, whereas for other filetypes the md5 property is directly calculated on the file itself.

    "},{"location":"docs/assertions/files/#json-files","title":"JSON Files","text":"

    nf-test supports comparison of JSON files and keys within JSON files. To assert that two JSON files contain the same keys and values: 

    assert path(process.out.out_ch.get(0)).json == path('./some.json').json\n
    Individual keys can also be asserted:

    assert path(process.out.out_ch.get(0)).json.key == \"value\"\n
    "},{"location":"docs/assertions/files/#yaml-files","title":"YAML Files","text":"

    nf-test supports comparison of YAML files and keys within YAML files. To assert that two YAML files contain the same keys and values: 

    assert path(process.out.out_ch.get(0)).yaml == path('./some.yaml').yaml\n
    Individual keys can also be asserted:

    assert path(process.out.out_ch.get(0)).yaml.key == \"value\"\n
    "},{"location":"docs/assertions/files/#gzip-files","title":"GZip Files","text":"

    nf-test extends path by a linesGzip property that can be used to read gzip compressed files.

    assert path(process.out.out_ch.get(0)).linesGzip.size() == 5\nassert path(process.out.out_ch.get(0)).linesGzip.contains(\"Line Content\")\n
    "},{"location":"docs/assertions/files/#filter-lines","title":"Filter lines","text":"

    The returned array can also be filtered by lines.

    def lines = path(process.out.gzip.get(0)).linesGzip[0..5]\nassert lines.size() == 6\ndef lines = path(process.out.gzip.get(0)).linesGzip[0]\nassert lines.equals(\"MY_HEADER\")\n
    "},{"location":"docs/assertions/files/#grep-lines","title":"Grep lines","text":"

    nf-test also provides the possibility to grep only specific lines with the advantage that only a subset of lines need to be read (especially helpful for larger files).

    def lines = path(process.out.gzip.get(0)).grepLinesGzip(0,5)\nassert lines.size() == 6\ndef lines = path(process.out.gzip.get(0)).grepLineGzip(0)\nassert lines.equals(\"MY_HEADER\")\n
    "},{"location":"docs/assertions/files/#snapshot-support","title":"Snapshot Support","text":"

    The possibility of filter lines from a *.gz file can also be combined with the snapshot functionality. 

    assert snapshot(\npath(process.out.gzip.get(0)).linesGzip[0]\n).match()\n
    "},{"location":"docs/assertions/libraries/","title":"Using Third-Party Libraries","text":"

    nf-test supports including third party libraries (e.g. jar files ) or functions from groovy files to either extend it functionality or to avoid duplicate code and to keep the logic in test cases simple.

    "},{"location":"docs/assertions/libraries/#using-local-groovy-files","title":"Using Local Groovy Files","text":"

    0.7.0 \u00b7

    If nf-test detects a lib folder in the directory of a tescase, then it adds it automatically to the classpath.

    "},{"location":"docs/assertions/libraries/#examples","title":"Examples","text":"

    We have a Groovy script MyWordUtils.groovy that contains the following class:

    class MyWordUtils {\n\n    def static capitalize(String word){\n      return word.toUpperCase();\n    }\n\n}\n

    We can put this file in a subfolder called lib:

    testcase_1\n\u251c\u2500\u2500 capitalizer.nf\n\u251c\u2500\u2500 capitalizer.test\n\u2514\u2500\u2500 lib\n    \u2514\u2500\u2500 MyWordUtils.groovy\n

    The file capitalizer.nf contains the CAPITALIZER process:

    #!/usr/bin/env nextflow\nnextflow.enable.dsl=2\n\nprocess CAPITALIZER {\n    input:\n        val cheers\n    output:\n        stdout emit: output\n    script:\n       println \"$cheers\".toUpperCase()\n    \"\"\"\n    \"\"\"\n\n}\n

    Next, we can use this class in the capitalizer.nf.test like every other class that is provided by nf-test or Groovy itself:

    nextflow_process {\n\n    name \"Test Process CAPITALIZER\"\n    script \"capitalizer.nf\"\n    process \"CAPITALIZER\"\n\n    test(\"Should run without failures\") {\n\n        when {\n            process {\n                \"\"\"\n                input[0] = \"world\"\n                \"\"\"\n            }\n        }\n\n        then {\n            assert process.success\n            assert process.stdout.contains(MyWordUtils.capitalize('world'))\n        }\n\n    }\n\n}\n

    If we have a project and we want to reuse libraries in multiple test cases, then we can store the class in the shared lib folder. Both test cases are now able to use MyWordUtils:

    tests\n\u251c\u2500\u2500 testcase_1\n    \u251c\u2500\u2500 hello_1.nf\n    \u251c\u2500\u2500 hello_1.nf.test\n\u251c\u2500\u2500 testcase_2\n    \u251c\u2500\u2500 hello_2.nf\n    \u251c\u2500\u2500 hello_2.nf.test\n\u2514\u2500\u2500 lib\n    \u2514\u2500\u2500 MyWordUtils.groovy\n

    The default location is tests/lib. This folder location can be changed in nf-test config file.

    It is also possible to use the --lib parameter to add an additional folder to the classpath:

    nf-test test tests/testcase_1/hello_1.nf.test --lib tests/mylibs\n

    If multiple folders are used, the they need to be separate with a colon (like in Java or Groovy).

    "},{"location":"docs/assertions/libraries/#using-local-jar-files","title":"Using Local Jar Files","text":"

    To integrate local jar files, you can either specify the path to the jar within the nf-test --lib option 

    nf-test test test.nf.test --lib tests/lib/groovy-ngs-utils/groovy-ngs-utils.jar\n

    or add it as follows to the nf-test.config file:

    libDir \"tests/lib:tests/lib/groovy-ngs-utils/groovy-ngs-utils.jar\"\n

    You could then import the class and use it in the then statement:

    import gngs.VCF;\n\nnextflow_process {\n\n    name \"Test Process VARIANT_CALLER\"\n    script \"variant_caller.nf\"\n    process \"VARIANT_CALLER\"\n\n    test(\"Should run without failures\") {\n\n        when {\n           ...\n        }\n\n        then {\n            assert process.success             \n            def vcf = VCF.parse(\"$baseDir/tests/test_data/NA12879.vcf.gz\")\n            assert vcf.samples.size() == 10\n            assert vcf.variants.size() == 20\n        }\n\n    }\n\n}\n
    "},{"location":"docs/assertions/libraries/#using-maven-artifcats-with-grab","title":"Using Maven Artifcats with @Grab","text":"

    nf-test supports the @Grab annotation to include third-party libraries that are available in a maven repository. As the dependency is defined as a maven artifact, there is no local copy of the jar file needed and maven enables to include an exact version as well as provides an easy update process.

    "},{"location":"docs/assertions/libraries/#example","title":"Example","text":"

    The following example uses the WordUtil class from commons-lang:

    @Grab(group='commons-lang', module='commons-lang', version='2.4')\nimport org.apache.commons.lang.WordUtils\n\nnextflow_process {\n\n    name \"Test Process CAPITALIZER\"\n    script \"capitalizer.nf\"\n    process \"CAPITALIZER\"\n\n    test(\"Should run without failures\") {\n\n        when {\n            process {\n                \"\"\"\n                input[0] = \"world\"\n                \"\"\"\n            }\n        }\n\n        then {\n            assert process.success\n            assert process.stdout.contains(WordUtils.capitalize('world'))\n        }\n\n    }\n\n}\n
    "},{"location":"docs/assertions/regular-expressions/","title":"Regular Expressions","text":""},{"location":"docs/assertions/regular-expressions/#using-operator","title":"Using ==~ operator","text":"

    The operator ==~ can be used to check if a string matches a regular expression:

    assert \"/my/full/path/to/process/dir/example.vcf.pgen\" ==~ \".*/example.vcf.pgen\"\n
    "},{"location":"docs/assertions/snapshots/","title":"Snapshots","text":"

    0.7.0

    Snapshots are a very useful tool whenever you want to make sure your output channels or output files not change unexpectedly. This feature is highly inspired by Jest.

    A typical snapshot test case takes a snapshot of the output channels or any other object, then compares it to a reference snapshot file stored alongside the test (*.nf.test.snap). The test will fail, if the two snapshots do not match: either the change is unexpected, or the reference snapshot needs to be updated to the new output of a process, workflow, pipeline or function.

    "},{"location":"docs/assertions/snapshots/#using-snapshots","title":"Using Snapshots","text":"

    The snapshot keyword creates a snapshot of the object and its match method can then be used to check if its contains the expected data from the snap file. The following example shows how to create a snapshot of a workflow channel:

    assert snapshot(workflow.out.channel1).match()\n

    You can also create a snapshot of all output channels of a process:

    assert snapshot(process.out).match()\n

    Or a specific check on a file:

    assert snapshot(path(process.out.get(0))).match()\n

    Even the result of a function can be used:

    assert snapshot(function.result).match()\n

    The first time this test runs, nf-test creates a snapshot file. This is a json file that contains a serialized version of the provided object.

    The snapshot file should be committed alongside code changes, and reviewed as part of your code review process. nf-test uses pretty-format to make snapshots human-readable during code review. On subsequent test runs, nf-test will compare the data with the previous snapshot. If they match, the test will pass. If they don't match, either the test runner found a bug in your code that should be fixed, or the implementation has changed and the snapshot needs to be updated.

    "},{"location":"docs/assertions/snapshots/#updating-snapshots","title":"Updating Snapshots","text":"

    When a snapshot test is failing due to an intentional implementation change, you can use the --update-snapshot flag to re-generate snapshots for all failed tests.

    nf-test test tests/main.nf.test --update-snapshot\n
    "},{"location":"docs/assertions/snapshots/#cleaning-obsolete-snapshots","title":"Cleaning Obsolete Snapshots","text":"

    0.8.0

    Over time, snapshots can become outdated, leading to inconsistencies in your testing process. To help you manage obsolete snapshots, nf-test generates a list of these obsolete keys. This list provides transparency into which snapshots are no longer needed and can be safely removed.

    Running your tests with the --clean-snapshotor --wipe-snapshot option removes the obsolete snapshots from the snapshot file. This option is useful when you want to maintain the structure of your snapshot file but remove unused entries. It ensures that your snapshot file only contains the snapshots required for your current tests, reducing file bloat and improving test performance.

    nf-test test tests/main.nf.test --clean-snapshot\n

    Obsolete snapshots can only be detected when running all tests in a test file simultaneously, and when all tests pass. If you run a single test or if tests are skipped, nf-test cannot detect obsolete snapshots.

    "},{"location":"docs/assertions/snapshots/#constructing-complex-snapshots","title":"Constructing Complex Snapshots","text":"

    It is also possible to include multiple objects into one snapshot:

    assert snapshot(workflow.out.channel1, workflow.out.channel2).match()\n

    Every object that is serializable can be included into snapshots. Therefore you can even make a snapshot of the complete workflow or process object. This includes stdout, stderr, exist status, trace etc. and is the easiest way to create a test that checks for all of this properties:

    assert snapshot(workflow).match()\n

    You can also include output files to a snapshot (e.g. useful in pipeline tests where no channels are available):

    assert snapshot(\n    workflow,\n    path(\"${params.outdir}/file1.txt\"),\n    path(\"${params.outdir}/file2.txt\"),\n    path(\"${params.outdir}/file3.txt\")\n).match()\n

    By default the snapshot has the same name as the test. You can also store a snapshot under a user defined name. This enables you to use multiple snapshots in one single test and to separate them in a logical way. In the following example a workflow snapshot is created, stored under the name \"workflow\".

    assert snapshot(workflow).match(\"workflow\")\n

    The next example creates a snapshot of two files and saves it under \"files\".

    assert snapshot(path(\"${params.outdir}/file1.txt\"), path(\"${params.outdir}/file2.txt\")).match(\"files\")\n

    You can also use helper methods to add objects to snapshots. For example, you can use the list()method to add all files of a folder to a snapshot:

     assert snapshot(workflow, path(params.outdir).list()).match()\n
    "},{"location":"docs/assertions/snapshots/#compressed-snapshots","title":"Compressed Snapshots","text":"

    If you add complex objects to snapshots with large content, you could use the md5() function to store the hashsum instead of the content in the snapshot file:

     assert snapshot(hugeObject).md5().match()\n
    "},{"location":"docs/assertions/snapshots/#file-paths","title":"File Paths","text":"

    If nf-test detects a path in the snapshot it automatically replace it by a unique fingerprint of the file that ensures the file content is the same. The fingerprint is default the md5 sum.

    "},{"location":"docs/assertions/snapshots/#snapshot-differences","title":"Snapshot Differences","text":"

    0.8.0

    By default, nf-test uses the diff tool for comparing snapshots. It employs the following default arguments:

    • -y: Enables side-by-side comparison mode.
    • -W 200: Sets the maximum width for displaying the differences to 200 characters.

    These default arguments are applied when no custom settings are specified.

    If diffis not installed on the system, nf-test will print exepcted and found snapshots without highlighting differences.

    "},{"location":"docs/assertions/snapshots/#customizing-diff-tool-arguments","title":"Customizing Diff Tool Arguments","text":"

    Users have the flexibility to customize the arguments passed to the diff tool using an environment variable called NFT_DIFF_ARGS. This environment variable allows you to modify the way the diff tool behaves when comparing snapshots.

    To customize the arguments, follow these steps:

    1. Set the NFT_DIFF_ARGS environment variable with your desired arguments.

      export NFT_DIFF_ARGS=\"<your_custom_arguments>\"\n

    2. Run nf-test to perform snapshot comparison, and it will utilize the custom arguments specified in NFT_DIFF_ARGS.

    "},{"location":"docs/assertions/snapshots/#changing-the-diff-tool","title":"Changing the Diff Tool","text":"

    nf-test not only allows you to customize the arguments but also provides the flexibility to change the diff tool itself. This can be achieved by using the environment variable NFT_DIFF.

    "},{"location":"docs/assertions/snapshots/#example-using-icdiff","title":"Example: Using icdiff","text":"

    As an example, you can change the diff tool to icdiff, which supports features like colors. To switch to icdiff, follow these steps:

    1. Install icdiff

    2. Set the NFT_DIFF environment variable to icdiff to specify the new diff tool.

      export NFT_DIFF=\"icdiff\"\n

    3. If needed, customize the arguments for icdiff using NFT_DIFF_ARGS as explained in the previous section

      export NFT_DIFF_ARGS=\"-N --cols 200 -L expected -L observed -t\"\n

    4. Run nf-test, and it will use icdiff as the diff tool for comparing snapshots.

    "},{"location":"docs/cli/clean/","title":"clean command","text":""},{"location":"docs/cli/clean/#usage","title":"Usage","text":"
    nf-test clean\n

    The clean command removes the .nf-test directory.

    "},{"location":"docs/cli/generate/","title":"generate command","text":""},{"location":"docs/cli/generate/#usage","title":"Usage","text":"
    nf-test generate <TEST_CASE_TYPE> <NEXTFLOW_FILES>\n
    "},{"location":"docs/cli/generate/#supported-types","title":"Supported Types","text":""},{"location":"docs/cli/generate/#process","title":"process","text":""},{"location":"docs/cli/generate/#workflow","title":"workflow","text":""},{"location":"docs/cli/generate/#pipeline","title":"pipeline","text":""},{"location":"docs/cli/generate/#function","title":"function","text":""},{"location":"docs/cli/generate/#examples","title":"Examples","text":"

    Create a test case for a process:

    nf-test generate process modules/local/salmon_index.nf\n

    Create a test cases for all processes in folder modules:

    nf-test generate process modules/**/*.nf\n

    Create a test case for a sub workflow:

    nf-test generate workflow workflows/some_workflow.nf\n

    Create a test case for the whole pipeline:

    nf-test generate pipeline main.nf\n

    Create a test case for each function in file functions.nf:

    nf-test generate function functions.nf\n
    "},{"location":"docs/cli/init/","title":"init command","text":""},{"location":"docs/cli/init/#usage","title":"Usage","text":"
    nf-test init\n

    The init command set ups nf-test in the current directory.

    The init command creates the following files: nf-test.config and tests/nextflow.config. It also creates a folder tests which is the home directory of your test code.

    In the configuration section you can learn more about these files and how to customize the directory layout.

    "},{"location":"docs/cli/list/","title":"list command","text":""},{"location":"docs/cli/list/#usage","title":"Usage","text":"

    list command provides a convenient way to list all available test cases.

    nf-test list [<NEXTFLOW_FILES>|<SCRIPT_FOLDERS>]\n
    "},{"location":"docs/cli/list/#optional-arguments","title":"Optional Arguments","text":""},{"location":"docs/cli/list/#-tags","title":"--tags","text":"

    Print a list of all used tags.

    "},{"location":"docs/cli/list/#-format-json","title":"--format json","text":"

    Print the list of tests or tags as json object.

    "},{"location":"docs/cli/list/#-format-raw","title":"--format raw","text":"

    Print the list of tests or tags as simple list without formatting.

    "},{"location":"docs/cli/list/#-silent","title":"--silent","text":"

    Hide program version and header infos.

    "},{"location":"docs/cli/list/#-debug","title":"--debug","text":"

    Show debugging infos.

    "},{"location":"docs/cli/list/#examples","title":"Examples","text":"

    • List test cases that can be found in the testDir defined in the nf-test.config file in the current working directory:

      nf-test list\n

    • List test cases in specified test scripts and search specified directories for additional test scripts:

      nf-test list tests/modules/local/salmon_index.nf.test tests/modules/bwa_index.nf.test\n\nnf-test list tests/modules tests/modules/bwa_index.nf.test\n

    • List of all testcases as json:

    nf-test list --format json --silent\n[\"/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@69b98c67\",\"/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@fdb6c1cc\",\"/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@d1c219eb\",\"/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@3c54e3cb\",...]\n
    • List of all testcases as unformatted ist:
    nf-test list --format raw --silent\n/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@69b98c67\n/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@fdb6c1cc\n/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@d1c219eb\n/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@3c54e3cb\n...\n
    • List of all tags as json:
    nf-test list --tags --format json --silent\n[\"fastqc\",\"snakemake\"]\n
    • List of all tags as unformatted list:
    nf-test list --tags --format raw --silent\nfastqc\nsnakemake\n
    "},{"location":"docs/cli/test/","title":"test command","text":""},{"location":"docs/cli/test/#usage","title":"Usage","text":"
    nf-test test [<NEXTFLOW_FILES>|<SCRIPT_FOLDERS>]\n
    "},{"location":"docs/cli/test/#optional-arguments","title":"Optional Arguments","text":""},{"location":"docs/cli/test/#-profile-nextflow_profile","title":"--profile <NEXTFLOW_PROFILE>","text":"

    To run your test using a specific Nextflow profile, you can use the --profile argument. Learn more.

    "},{"location":"docs/cli/test/#-verbose","title":"--verbose","text":"

    Prints out the Nextflow output during test runs.

    "},{"location":"docs/cli/test/#-without-trace","title":"--without-trace","text":"

    The Linux tool procps is required to run Nextflow tracing. In case your container does not support this tool, you can also run nf-test without tracing. Please note that the workflow.trace are not available when running it with this flag.

    "},{"location":"docs/cli/test/#-tag-tag","title":"--tag <tag>","text":"

    Execute only tests with the provided tag. Multiple tags can be used and have to be separated by commas (e.g. tag1,tag2).

    "},{"location":"docs/cli/test/#-tap-filename","title":"--tap <filename>","text":"

    Writes test results in TAP format to file.

    "},{"location":"docs/cli/test/#-junitxml-filename","title":"--junitxml <filename>","text":"

    Writes test results in JUnit XML format to file, which conforms to the standard schema.

    "},{"location":"docs/cli/test/#-debug","title":"--debug","text":"

    The debug parameter prints out debugging messages and all available output channels which can be accessed in the then clause.

    "},{"location":"docs/cli/test/#examples","title":"Examples","text":"
    • Run all test scripts that can be found in the testDir defined in the nf-test.config file in the current working directory:
    nf-test test\n
    • Run all specified test scripts and search specified directories for additional test scripts:
    nf-test test tests/modules/local/salmon_index.nf.test tests/modules/bwa_index.nf.test\n\nnf-test test tests/modules tests/modules/bwa_index.nf.test\n
    • Run a specific test using its hash:
    nf-test test tests/main.nf.test@d41119e4\n
    • Run all tests and write results to report.tap:
    nf-test test --tap report.tap\n
    "},{"location":"docs/plugins/developing-plugins/","title":"Plugin Development","text":"

    0.7.0

    The following plugin can be used as a boilerplate: https://github.com/askimed/nft-fasta

    "},{"location":"docs/plugins/developing-plugins/#developing-plugins","title":"Developing Plugins","text":"

    A plugin has the possibility:

    1. Adding a new method to an existing class (e.g. the property fasta to class Path). It uses Groovy's ExtensionModule concept. Important: the method has to be static. One class can provide multiple methods.
    // com.askimed.nf.test.fasta.PathExtension\npublic class PathExtension {\n  //can be used as: path(filename).fasta\n    public static Object getFasta(Path self) {\n    return FastaUtil.readAsMap(self);\n  }\n\n}\n
    1. Providing new methods
    // com.askimed.nf.test.fasta.Methods\npublic class Methods {\n\n  //can be used as: helloFasta()\n  public static void helloFasta() {\n    System.out.println(\"Hello FASTA\");\n  }\n\n}\n
    "},{"location":"docs/plugins/developing-plugins/#manifest-file","title":"Manifest file","text":"

    You need to create a file META-INF/nf-test-plugin (in your resources). This file contains metadata about the plugin and both classes can now be registered by using the extensionClasses and extensionMethods properties.

    moduleName=nft-my-plugin\nmoduleVersion=1.0.0\nmoduleAuthors=Lukas Forer\nextensionClasses=com.askimed.nf.test.fasta.PathExtension\nextensionMethods=com.askimed.nf.test.fasta.Methods\n
    "},{"location":"docs/plugins/developing-plugins/#building-a-jar-file","title":"Building a jar file","text":"

    The plugin itself is a jar file that contains all classes and the META-INF/nf-test-plugin file. If you have dependencies then you have to create a uber-jar that includes all libraries, because nf-test doesn't support the classpath set in META-INF\\MANIFEST.

    "},{"location":"docs/plugins/developing-plugins/#publishing-plugins","title":"Publishing Plugins","text":"

    Available plugins are managed in this default repository: https://github.com/askimed/nf-test-plugins/blob/main/plugins.json

    Add your plugin or a new release to the plugin.json file and create a pull request to publish your plugin in the default repository. Or host you own repository:

    [{\n  \"id\": \"nft-fasta\",\n  \"releases\": [{\n    \"version\": \"1.0.0\",\n    \"url\": \"https://github.com/askimed/nft-fasta/releases/download/v1.0.0/nft-fasta-1.0.0.jar\",\n  },{\n    \"version\": \"2.0.0\",\n    \"url\": \"https://github.com/askimed/nft-fasta/releases/download/v2.0.0/nft-fasta-2.0.0.jar\",\n  }]\n},{\n  \"id\": \"nft-my-plugin\",\n  \"releases\": [{\n    \"version\": \"1.0.0\",\n    \"url\": \"https://github.com/lukfor/nft-my-plugin2/releases/download/v1.0.0/nft-my-plugin-1.0.0.jar\",\n  }]\n}]\n
    "},{"location":"docs/plugins/using-plugins/","title":"Plugins","text":"

    0.7.0

    Most assertions are usecase specific. Therefore, separating this functionality and helper classes from the nf-test codebase has several advantages:

    1. nf-test releases are independent from plugin releases
    2. it is easier for third-parties to develop and maintain plugins
    3. it is possible to use private repositories to integrate private/protected code in plugins without sharing them

    For this purpose, we integrated the following plugin system that provides (a) the possibility to extend existing classes with custom methods (e.g. path(filename).fasta) and (2) to extends nf-test with new methods.

    "},{"location":"docs/plugins/using-plugins/#using-plugins","title":"Using Plugins","text":"

    Available plugins are listed here.

    A plugin can be activated via the nf-test.config by adding the plugin section and by using load method to specify the plugin and its version:

    config {\n\n  plugins {\n\n    load \"nft-fasta@1.0.0\"\n\n  }\n\n}\n

    It is also possible to add one ore more additional repositories. (Example: repository with development/snapshot versions, in-house repository, ...)

    config {\n\n  plugins {\n\n    repository \"https://github.com/askimed/nf-test-plugins/blob/main/plugins-snapshots.json\"\n    repository \"https://github.com/seppinho/nf-test-plugin2/blob/main/plugins.json\"\n\n    load \"nft-fasta@1.1.0-snapshot\"\n    load \"nft-plugin2@1.1.0\"\n\n    // you can also load jar files directly without any repository\n    // loadFromFile \"path/to/my/nft-plugin.jar\"\n  }\n\n}\n

    All plugins are downloaded and cached in .nf-test\\plugins. This installation mechanism is yet not safe for parallel execution when multiple nf-test instances are resolving the same plugin. However, you can use nf-test update-plugins to download all plugins before you run your tests in parallel.

    To clear the cache and to force redownloading plugins and repositories you can execute the nf-test clean command.

    One or multiple plugins can be activated also via the --plugins parameter:

    nf-test test my-test.nf.test --plugins nft-fasta@1.0.0,plugin2@1.0.0\n

    or

    nf-test test my-test.nf.test --plugins path/to/my/nft-plugin.jar\n
    "},{"location":"docs/testcases/","title":"Documentation","text":""},{"location":"docs/testcases/global_variables/","title":"Global Variables","text":"

    The following variables are available and can be used in setup, when, then and cleanup closures.

    Name Description Example baseDir orprojectDir The directory where the nf-test.config script is located. mypipeline moduleDir The directory where the module script is located mypipeline/modules/mymodule moduleTestDir The directory where the test script is located mypipeline/tests/modules/mymodule launchDir The directory where the test is run. mypipeline/.nf-test/tests/<test_hash> metaDir The directory where all meta are located (e.g. mock.nf). mypipeline/.nf-test/tests/<test_hash>/meta workDir The directory where tasks temporary files are created. mypipeline/.nf-test/tests/<test_hash>/work outputDir An output directory in the $launchDir that can be used to store output files. The variable contains the absolute path. If you need a relative outpu directory see launchDir example. mypipeline/.nf-test/tests/<test_hash>/output params Dictionary like object holding all parameters."},{"location":"docs/testcases/global_variables/#examples","title":"Examples","text":""},{"location":"docs/testcases/global_variables/#outputdir","title":"outputDir","text":"

    This variable points to the directory within the temporary test directory (.nf-test/tests/<test-dir>/output/). The variable can be set under params:

    params {\n    outdir = \"$outputDir\"\n}\n
    "},{"location":"docs/testcases/global_variables/#basedir","title":"baseDir","text":"

    This variable points to the directory to locate the base directory of the main nf-test config. The variable can be used e.g. in the process definition to build absolute paths for input files:

    process {\n    \"\"\"\n    file1 = file(\"$baseDir/tests/input/file123.gz\")\n    \"\"\"\n}\n
    "},{"location":"docs/testcases/global_variables/#launchdir","title":"launchDir","text":"

    This variable points to the directory where the test is executed. This can be used get access to results that are created in an relative output directory:

    when {\n    params {\n        outdir = \"results\"\n    }\n}\n
    then {\n    assert path(\"$launchDir/results\").exists()\n}\n
    "},{"location":"docs/testcases/nextflow_function/","title":"Function Testing","text":"

    nf-test allows testing of functions that are defined in a Nextflow file or defined in lib. Please checkout the CLI to generate a function test.

    "},{"location":"docs/testcases/nextflow_function/#syntax","title":"Syntax","text":"
    nextflow_function {\n\n    name \"<NAME>\"\n    script \"<PATH/TO/NEXTFLOW_SCRIPT.nf>\"\n    function \"<FUNCTION_NAME>\"\n\n    test(\"<TEST_NAME>\") {\n\n    }\n}\n

    Script paths that start with ./ or ../ are considered relative paths. These paths are resolved based on the location of the test script. Relative paths are beneficial when you want to reference files or directories located within the same directory as your test script or in a parent directory. These paths provide a convenient way to access files without specifying the entire path.

    "},{"location":"docs/testcases/nextflow_function/#multiple-functions","title":"Multiple Functions","text":"

    If a Nextflow script contains multiple functions and you want to test them all in the same testsuite, you can override the function property in each test. For example:

    "},{"location":"docs/testcases/nextflow_function/#functionsnf","title":"functions.nf","text":"
    def function1() {\n  ...\n}\n\ndef function2() {\n  ...\n}\n
    "},{"location":"docs/testcases/nextflow_function/#functionsnftest","title":"functions.nf.test","text":"
    nextflow_function {\n\n    name \"Test functions\"\n    script \"functions.nf\"\n\n    test(\"Test function1\") {\n      function \"function1\"\n      ...\n    }\n\n    test(\"Test function2\") {\n      function \"function2\"\n      ...\n    }\n}\n
    "},{"location":"docs/testcases/nextflow_function/#functions-in-lib-folder","title":"Functions in lib folder","text":"

    If you want to test a function that is inside a groovy file in your lib folder, you can ignore the script property, because Nextflow adds them automatically to the classpath. For example:

    "},{"location":"docs/testcases/nextflow_function/#libutilsgroovy","title":"lib\\Utils.groovy","text":"
    class Utils {\n\n    public static void sayHello(name) {\n        if (name == null) {\n            error('Cannot greet a null person')\n        }\n\n        def greeting = \"Hello ${name}\"\n\n        println(greeting)\n    }\n\n}\n
    "},{"location":"docs/testcases/nextflow_function/#testslibutilsgroovytest","title":"tests\\lib\\Utils.groovy.test","text":"
    nextflow_function {\n\n    name \"Test Utils.groovy\"\n\n    test(\"Test function1\") {\n      function \"Utils.sayHello\"\n      ...\n    }\n}\n

    Note: the generate function command works only with Nextflow functions.

    "},{"location":"docs/testcases/nextflow_function/#assertions","title":"Assertions","text":"

    The function object can be used in asserts to check its status, result value or error messages.

    // function status\nassert function.success\nassert function.failed\n\n// return value\nassert function.result == 27\n\n//returns a list containing all lines from stdout\nassert function.stdout.contains(\"Hello World\") == 3\n
    "},{"location":"docs/testcases/nextflow_function/#example","title":"Example","text":""},{"location":"docs/testcases/nextflow_function/#nextflow-script","title":"Nextflow script","text":"

    Create a new file and name it functions.nf.

    def say_hello(name) {\n    if (name == null) {\n        error('Cannot greet a null person')\n    }\n\n    def greeting = \"Hello ${name}\"\n\n    println(greeting)\n    return greeting\n}\n
    "},{"location":"docs/testcases/nextflow_function/#nf-test-script","title":"nf-test script","text":"

    Create a new file and name it functions.nf.test.

    nextflow_function {\n\n  name \"Test Function Say Hello\"\n\n  script \"functions.nf\"\n  function \"say_hello\"\n\n  test(\"Passing case\") {\n\n    when {\n      function {\n        \"\"\"\n        input[0] = \"aaron\"\n        \"\"\"\n      }\n    }\n\n    then {\n      assert function.success\n      assert function.result == \"Hello aaron\"\n      assert function.stdout.contains(\"Hello aaron\")\n      assert function.stderr.isEmpty()\n    }\n\n  }\n\n  test(\"Failure Case\") {\n\n    when {\n      function {\n        \"\"\"\n        input[0] = null\n        \"\"\"\n      }\n    }\n\n    then {\n      assert function.failed\n      //It seems to me that error(..) writes message to stdout\n      assert function.stdout.contains(\"Cannot greet a null person\")\n    }\n  }\n}\n
    "},{"location":"docs/testcases/nextflow_function/#execute-test","title":"Execute test","text":"
    nf-test test functions.nf.test\n
    "},{"location":"docs/testcases/nextflow_pipeline/","title":"Pipeline Testing","text":"

    nf-test also allows to test the complete pipeline end-to-end. Please checkout the CLI to generate a pipeline test.

    "},{"location":"docs/testcases/nextflow_pipeline/#syntax","title":"Syntax","text":"
    nextflow_pipeline {\n\n    name \"<NAME>\"\n    script \"<PATH/TO/NEXTFLOW_SCRIPT.nf>\"\n\n    test(\"<TEST_NAME>\") {\n\n    }\n}\n
    "},{"location":"docs/testcases/nextflow_pipeline/#assertions","title":"Assertions","text":"

    The workflow object can be used in asserts to check its status, error messages or traces.

    // workflow status\nassert workflow.success\nassert workflow.failed\nassert workflow.exitStatus == 0\n\n// workflow error message\nassert workflow.errorReport.contains(\"....\")\n\n// trace\n//returns a list containing succeeded tasks\nassert workflow.trace.succeeded().size() == 3\n\n//returns a list containing failed tasks\nassert workflow.trace.failed().size() == 0\n\n//returns a list containing all tasks\nassert workflow.trace.tasks().size() == 3\n
    "},{"location":"docs/testcases/nextflow_pipeline/#example","title":"Example","text":""},{"location":"docs/testcases/nextflow_pipeline/#nextflow-script","title":"Nextflow script","text":"

    Create a new file and name it pipeline.nf.

    #!/usr/bin/env nextflow\nnextflow.enable.dsl=2\n\nprocess SAY_HELLO {\n    input:\n        val cheers\n\n    output:\n        stdout emit: verbiage_ch\n        path '*.txt', emit: verbiage_ch2\n\n    script:\n    \"\"\"\n    echo -n $cheers\n    echo -n $cheers > ${cheers}.txt\n    \"\"\"\n}\n\nworkflow {\n    input = params.input_text.trim().split(',')\n    Channel.from(input) | SAY_HELLO\n}\n
    "},{"location":"docs/testcases/nextflow_pipeline/#nf-test-script","title":"nf-test script","text":"

    Create a new file and name it pipeline.nf.test.

    nextflow_pipeline {\n\n    name \"Test Pipeline with 1 process\"\n    script \"pipeline.nf\"\n\n    test(\"Should run without failures\") {\n\n        when {\n            params {\n              input_text = \"hello,nf-test\"\n            }\n        }\n\n        then {\n            assert workflow.success\n            assert workflow.trace.tasks().size() == 2\n        }\n\n    }\n\n}\n
    "},{"location":"docs/testcases/nextflow_pipeline/#execute-test","title":"Execute test","text":"
    nf-test init\nnf-test test pipeline.nf.test\n
    "},{"location":"docs/testcases/nextflow_process/","title":"Process Testing","text":"

    nf-test allows to test each process defined in a module file. Please checkout the CLI to generate a process test.

    "},{"location":"docs/testcases/nextflow_process/#syntax","title":"Syntax","text":"
    nextflow_process {\n\n    name \"<NAME>\"\n    script \"<PATH/TO/NEXTFLOW_SCRIPT.nf>\"\n    process \"<PROCESS_NAME>\"\n\n    test(\"<TEST_NAME>\") {\n\n    }\n}\n

    Script paths that start with ./ or ../ are considered relative paths. These paths are resolved based on the location of the test script. Relative paths are beneficial when you want to reference files or directories located within the same directory as your test script or in a parent directory. These paths provide a convenient way to access files without specifying the entire path.

    "},{"location":"docs/testcases/nextflow_process/#assertions","title":"Assertions","text":"

    The process object can be used in asserts to check its status or error messages.

    // process status\nassert process.success\nassert process.failed\nassert process.exitStatus == 0\n\n// Analyze Nextflow trace file\nassert process.trace.tasks().size() == 1\n\n// process error message\nassert process.errorReport.contains(\"....\")\n\n//returns a list containing all lines from stdout\nassert process.stdout.contains(\"Hello World\") == 3\n
    "},{"location":"docs/testcases/nextflow_process/#output-channels","title":"Output Channels","text":"

    The process.out object provides access to the content of all named output Channels (see Nextflow emit):

    // channel exists\nassert process.out.my_channel != null\n\n// channel contains 3 elements\nassert process.out.my_channel.size() == 3\n\n// first element is \"hello\"\nassert process.out.my_channel.get(0) == \"hello\"\n

    Channels that lack explicit names can be addressed using square brackets and the corresponding index. This indexing method provides a straightforward way to interact with channels without the need for predefined names. To access the first output channel, you can use the index [0] as demonstrated below:

    // channel exists\nassert process.out[0] != null\n\n// channel contains 3 elements\nassert process.out[0].size() == 3\n\n// first element is \"hello\"\nassert process.out[0].get(0) == \"hello\"\n
    "},{"location":"docs/testcases/nextflow_process/#example","title":"Example","text":""},{"location":"docs/testcases/nextflow_process/#nextflow-script","title":"Nextflow script","text":"

    Create a new file and name it say_hello.nf.

    #!/usr/bin/env nextflow\nnextflow.enable.dsl=2\n\nprocess SAY_HELLO {\n    input:\n        val cheers\n\n    output:\n        stdout emit: verbiage_ch\n        path '*.txt', emit: verbiage_ch2\n\n    script:\n    \"\"\"\n    echo -n $cheers\n    echo -n $cheers > ${cheers}.txt\n    \"\"\"\n}\n
    "},{"location":"docs/testcases/nextflow_process/#nf-test-script","title":"nf-test script","text":"

    Create a new file and name it say_hello.nf.test.

    nextflow_process {\n\n    name \"Test Process SAY_HELLO\"\n    script \"say_hello.nf\"\n    process \"SAY_HELLO\"\n\n    test(\"Should run without failures\") {\n\n        when {\n            process {\n                \"\"\"\n                input[0] = Channel.from('hello','nf-test')\n                \"\"\"\n            }\n        }\n\n        then {\n\n            assert process.success\n            assert process.trace.tasks().size() == 2\n\n            with(process.out.verbiage_ch2) {\n                assert size() == 2\n                assert path(get(0)).readLines().size() == 1\n                assert path(get(1)).readLines().size() == 1\n                assert path(get(1)).md5 == \"4a17df7a54b41a84df492da3f1bab1e3\"\n            }\n\n        }\n\n    }\n}\n
    "},{"location":"docs/testcases/nextflow_process/#execute-test","title":"Execute test","text":"
    nf-test init\nnf-test test say_hello.nf.test\n
    "},{"location":"docs/testcases/nextflow_workflow/","title":"Workflow Testing","text":"

    nf-test also allows to test a specific workflow. Please checkout the CLI to generate a workflow test.

    "},{"location":"docs/testcases/nextflow_workflow/#syntax","title":"Syntax","text":"
    nextflow_workflow {\n\n    name \"<NAME>\"\n    script \"<PATH/TO/NEXTFLOW_SCRIPT.nf>\"\n    workflow \"<WORKFLOW_NAME>\"\n\n    test(\"<TEST_NAME>\") {\n\n    }\n}\n

    Script paths that start with ./ or ../ are considered relative paths. These paths are resolved based on the location of the test script. Relative paths are beneficial when you want to reference files or directories located within the same directory as your test script or in a parent directory. These paths provide a convenient way to access files without specifying the entire path.

    "},{"location":"docs/testcases/nextflow_workflow/#assertions","title":"Assertions","text":"

    The workflow object can be used in asserts to check its status, error messages or traces.

    // workflow status\nassert workflow.success\nassert workflow.failed\nassert workflow.exitStatus == 0\n\n// workflow error message\nassert workflow.errorReport.contains(\"....\")\n\n// trace\n//returns a list containing succeeded tasks\nassert workflow.trace.succeeded().size() == 3\n\n//returns a list containing failed tasks\nassert workflow.trace.failed().size() == 0\n\n//returns a list containing all tasks\nassert workflow.trace.tasks().size() == 3\n\n//returns a list containing all lines from stdout\nassert workflow.stdout.contains(\"Hello World\") == 3\n
    "},{"location":"docs/testcases/nextflow_workflow/#output-channels","title":"Output Channels","text":"

    The workflow.out object provides access to the content of all named output Channels (see Nextflow emit):

    // channel exists\nassert workflow.out.my_channel != null\n\n// channel contains 3 elements\nassert workflow.out.my_channel.size() == 3\n\n// first element is \"hello\"\nassert workflow.out.my_channel.get(0) == \"hello\"\n
    "},{"location":"docs/testcases/nextflow_workflow/#example","title":"Example","text":""},{"location":"docs/testcases/nextflow_workflow/#nextflow-script","title":"Nextflow script","text":"

    Create a new file and name it trial.nf.

    #!/usr/bin/env nextflow\nnextflow.enable.dsl=2\n\nprocess sayHello {\n    input:\n        val cheers\n\n    output:\n        stdout emit: verbiage_ch\n        path '*.txt', emit: verbiage_ch2\n\n    script:\n    \"\"\"\n    echo -n $cheers\n    echo -n $cheers > ${cheers}.txt\n    \"\"\"\n}\n\nworkflow trial {\n    take: things\n    main:\n        sayHello(things)\n        sayHello.out.verbiage_ch.view()\n    emit:\n        trial_out_ch = sayHello.out.verbiage_ch2\n}\n\nworkflow {\n    Channel.from('hello','nf-test') | trial\n}\n
    "},{"location":"docs/testcases/nextflow_workflow/#nf-test-script","title":"nf-test script","text":"

    Create a new file and name it trial.nf.test.

    nextflow_workflow {\n\n    name \"Test Workflow Trial\"\n    script \"trial.nf\"\n    workflow \"trial\"\n\n    test(\"Should run without failures\") {\n\n        when {\n            workflow {\n                \"\"\"\n                input[0] = Channel.from('hello','nf-test')\n                \"\"\"\n            }\n        }\n\n        then {\n\n            assert workflow.success\n\n            with(workflow.out.trial_out_ch) {\n                assert size() == 2\n                assert path(get(0)).readLines().size() == 1\n                assert path(get(1)).readLines().size() == 1\n                assert path(get(1)).md5 == \"4a17df7a54b41a84df492da3f1bab1e3\"\n            }\n\n        }\n\n    }\n\n}\n
    "},{"location":"docs/testcases/nextflow_workflow/#execute-test","title":"Execute test","text":"
    nf-test init\nnf-test test trial.nf.test\n
    "},{"location":"docs/testcases/params/","title":"Params Dictionary","text":"

    The params block is optional and is a simple map that can be used to overwrite Nextflow's input params. The params block is located in the when block of a testcase. You can set params manually:

    when {\n    params {\n        outdir = \"output\"\n    }\n}\n

    It is also possible to set nested params using the same syntax as in your Nextflow script:

    when {\n    params {\n        output {\n          dir = \"output\"\n        }\n    }\n}\n

    The params map can also be used in the then block:

    then {\n    assert params.output == \"output\"    \n}\n
    "},{"location":"docs/testcases/params/#load-params-from-files","title":"Load params from files","text":"

    In addition, you can load the params from a JSON file:

    when {\n    params {\n        load(\"$baseDir/tests/params.json\")\n    }\n}\n

    or from a YAML file:

    when {\n    params {\n        load(\"$baseDir/tests/params.yaml\")\n    }\n}\n

    nf-test allows to combine both techniques and therefor it is possible to overwrite one or more params from the json file:

    when {\n    params {\n        load(\"$baseDir/tests/params.json\")\n        outputDir = \"new/output/path\"\n    }\n}\n
    "},{"location":"docs/testcases/setup/","title":"Setup Method","text":"

    The setup method allows you to specify processes or workflows that need to be executed before the primary when block. It serves as a mechanism to prepare the required input data or set up essential steps prior to the primary processing block.

    "},{"location":"docs/testcases/setup/#syntax","title":"Syntax","text":"

    The setup method is typically used within the context of a test case. The basic syntax for the setup method is as follows:

    test(\"my test\"){\n    setup {\n        // Define and execute dependent processes or workflows here\n    }\n}\n

    Within the setup block, you can use the run method to define and execute dependent processes or workflows.

    The run method syntax for a process is as follows:

    run(\"ProcessName\") {\n    script \"path/to/process/script.nf\"\n    process {\n        // Define the process inputs here\n    }\n}\n

    The run method syntax for a workflow is as follows:

    run(\"WorkflowName\") {\n    script \"path/to/workflow/script.nf\"\n    workflow {\n        // Define the workflow inputs here\n    }\n}\n

    If you need to run the same process multiple times, you can set the alias of the process:

    run(\"GENERATE_DATA\", alias: \"MY_PROCESS\") {\n    script \"./generate_data.nf\"\n    process {\n       ...\n    }\n}\n

    Warning

    Please keep in mind that changes in procsses or workflows, which are executed in the setup method, can result in a failed test run.

    "},{"location":"docs/testcases/setup/#example-usage","title":"Example Usage","text":""},{"location":"docs/testcases/setup/#1-local-setup-method","title":"1. Local Setup Method","text":"

    In this example, we create a setup method within a Nextflow process definition to execute a dependent process named \"ABRICATE_RUN.\" This process generates input data that is required for the primary process \"ABRICATE_SUMMARY.\" The setup block specifies the execution of \"ABRICATE_RUN,\" and the when block defines the processing logic for \"ABRICATE_SUMMARY.\"

    nextflow_process {\n\n    name \"Test process data\"\n\n    script \"../main.nf\"\n    process \"ABRICATE_SUMMARY\"\n    config \"./nextflow.config\"\n\n    test(\"Should use process ABRICATE_RUN to generate input data\") {\n\n        setup {\n\n            run(\"ABRICATE_RUN\") {\n                script \"../../run/main.nf\"\n                process {\n                    \"\"\"\n                    input[0] =  Channel.fromList([\n                        tuple([ id:'test1', single_end:false ], // meta map\n                            file(params.test_data['bacteroides_fragilis']['genome']['genome_fna_gz'], checkIfExists: true)),\n                        tuple([ id:'test2', single_end:false ],\n                            file(params.test_data['haemophilus_influenzae']['genome']['genome_fna_gz'], checkIfExists: true))\n                    ])\n                    \"\"\"\n                }\n            }\n\n        }\n\n        when {\n            process {\n                \"\"\"\n                input[0] = ABRICATE_RUN.out.report.collect{ meta, report -> report }.map{ report -> [[ id: 'test_summary'], report]}\n                \"\"\"\n            }\n        }\n\n        then {\n            assert process.success\n            assert snapshot(process.out).match()\n        }\n    }\n\n}\n
    "},{"location":"docs/testcases/setup/#2-global-setup-method","title":"2. Global Setup Method","text":"

    In this example, a global setup method is defined for all tests within a Nextflow process definition. The setup method is applied to multiple test cases, ensuring consistent setup for each test. This approach is useful when multiple tests share the same setup requirements.

    nextflow_process {\n\n    name \"Test process data\"\n\n    script \"../main.nf\"\n    process \"ABRICATE_SUMMARY\"\n    config \"./nextflow.config\"\n\n    setup {\n        run(\"ABRICATE_RUN\") {\n            script \"../../run/main.nf\"\n            process {\n                \"\"\"\n                input[0] =  Channel.fromList([\n                    tuple([ id:'test1', single_end:false ], // meta map\n                        file(params.test_data['bacteroides_fragilis']['genome']['genome_fna_gz'], checkIfExists: true)),\n                    tuple([ id:'test2', single_end:false ],\n                        file(params.test_data['haemophilus_influenzae']['genome']['genome_fna_gz'], checkIfExists: true))\n                ])\n                \"\"\"\n            }\n        }\n    }\n\n    test(\"first test\") {\n        when {\n            process {\n                \"\"\"\n                input[0] = ABRICATE_RUN.out.report.collect{ meta, report -> report }.map{ report -> [[ id: 'test_summary'], report]}\n                \"\"\"\n            }\n        }\n        then {\n            assert process.success\n            assert snapshot(process.out).match()\n        }\n    }\n\n    test(\"second test\") {\n        when {\n            process {\n                \"\"\"\n                input[0] = ABRICATE_RUN.out.report.collect{ meta, report -> report }.map{ report -> [[ id: 'test_summary'], report]}\n                \"\"\"\n            }\n        }\n        then {\n            assert process.success\n            assert snapshot(process.out).match()\n        }\n    }\n\n}\n
    "},{"location":"docs/testcases/setup/#3-aliasing-of-dependencies","title":"3. Aliasing of Dependencies","text":"

    In this example, the process UNTAR is used multiple times in the setup method:

    nextflow_process {\n\n    ...\n\n    setup {\n\n        run(\"UNTAR\", alias: \"UNTAR1\") {\n            script \"modules/nf-core/untar/main.nf\"\n            process {\n            \"\"\"\n            input[0] = Channel.fromList(...)\n            \"\"\"\n            }\n        }\n\n        run(\"UNTAR\", alias: \"UNTAR2\") {\n            script \"modules/nf-core/untar/main.nf\"\n            process {\n            \"\"\"\n            input[0] = Channel.fromList(...)\n            \"\"\"\n            }\n        }\n\n        run(\"UNTAR\", alias: \"UNTAR3\") {\n            script \"modules/nf-core/untar/main.nf\"\n            process {\n            \"\"\"\n            input[0] = Channel.fromList(...)\n            \"\"\"\n            }\n        }\n    }\n\n    test(\"Test with three different inputs\") {\n        when {\n            process {\n                \"\"\"\n                input[0] = UNTAR1.out.untar.map{ it[1] }\n                input[1] = UNTAR2.out.untar.map{ it[1] }\n                input[2] = UNTAR3.out.untar.map{ it[1] }\n                \"\"\"\n            }\n        }\n\n        then {\n            ...\n        }\n\n }\n\n}\n
    "}]} \ No newline at end of file +{"config":{"lang":["en"],"separator":"[\\s\\-]+","pipeline":["stopWordFilter"]},"docs":[{"location":"","title":"Home","text":""},{"location":"#nf-test-a-simple-testing-framework-for-nextflow-pipelines","title":"nf-test: A simple testing framework for Nextflow pipelines","text":"

    Test your production ready\u00a0Nextflow\u00a0pipelines in an efficient and automated way. \ud83d\ude80

    Getting Started Installation Source

    A DSL language similar to Nextflow Describes expected behavior using 'when' and 'then' blocks Abundance of functions for writing elegant and readable assertions Utilizes snapshots to write tests for complex data structures Provides commands for generating boilerplate code Includes a test-runner that executes these scripts Easy installation on CI systems

    "},{"location":"#unit-testing","title":"Unit testing","text":"

    nf-test enables you to test all components of your data science pipeline: from end-to-end testing of the entire pipeline to specific tests of processes or even custom functions. This ensures that all testing is conducted consistently across your project.

    Pipeline Process Functions 
    nextflow_pipeline {\n\n  name \"Test Hello World\"\n  script \"nextflow-io/hello\"\n\n  test(\"hello world example should start 4 processes\") {\n    expect {\n      with(workflow) {\n        assert success\n        assert trace.tasks().size() == 4\n        assert \"Ciao world!\" in stdout\n        assert \"Bonjour world!\" in stdout\n        assert \"Hello world!\" in stdout\n        assert \"Hola world!\" in stdout\n      }\n    }\n  }\n\n}\n
    nextflow_process {\n\n    name \"Test Process SALMON_INDEX\"\n    script \"modules/local/salmon_index.nf\"\n    process \"SALMON_INDEX\"\n\n    test(\"Should create channel index files\") {\n\n        when {\n            process {\n                \"\"\"\n                input[0] = file(\"test_data/transcriptome.fa\")\n                \"\"\"\n            }\n        }\n\n        then {\n            //check if test case succeeded\n            assert process.success\n            //analyze trace file\n            assert process.trace.tasks().size() == 1\n            with(process.out) {\n                // check if emitted output has been created\n                assert index.size() == 1\n                // count amount of created files\n                assert path(index.get(0)).list().size() == 16\n                // parse info.json file\n                def info = path(index.get(0)+'/info.json').json\n                assert info.num_kmers == 375730\n                assert info.seq_length == 443050\n                //verify md5 checksum\n                assert path(index.get(0)+'/info.json').md5 == \"80831602e2ac825e3e63ba9df5d23505\"\n            }\n        }\n\n    }\n\n}\n
    nextflow_function {\n\n    name \"Test functions\"\n    script \"functions.nf\"\n\n    test(\"Test function1\") {\n      function \"function1\"\n      ...\n    }\n\n    test(\"Test function2\") {\n      function \"function2\"\n      ...\n    }\n}\n

    Learn more about pipeline tests, workflow tests, process tests and function tests in the documentation.

    "},{"location":"#snapshot-testing","title":"Snapshot testing","text":"

    nf-test supports snapshot testing and automatically generates a baseline set of unit tests to safeguard against regressions caused by changes.nf-test captures a snapshot of output channels or any other objects and subsequently compares them to reference snapshot files stored alongside the tests. If the two snapshots do not match, the test will fail

    Learn more

    "},{"location":"#highly-extendable","title":"Highly extendable","text":"

    nf-test supports the inclusion of third-party libraries (e.g., jar files) or functions from Groovy files. This can be done to either extend its functionality or to prevent code duplication, thus maintaining simplicity in the logic of test cases. Given that many assertions are specific to use cases, nf-test incorporates a plugin system that allows for the extension of existing classes with custom methods. For example FASTA file support.

    Learn more

    "},{"location":"#support-us","title":"Support us","text":"

    We love stars as much as we love rockets! So make sure you star us on GitHub.

    Star

    Show the world your Nextflow pipeline is using nf-test and add the following badge to your README.md:

    [![nf-test](https://img.shields.io/badge/tested_with-nf--test-337ab7.svg)](https://code.askimed.com/nf-test)\n
    "},{"location":"#about","title":"About","text":"

    nf-test has been created by Lukas Forer and Sebastian Sch\u00f6nherr and is MIT Licensed.

    Thanks to all the contributors to help us maintaining and improving nf-test!

    "},{"location":"about/","title":"About","text":"

    nf-test has been created by Lukas Forer and Sebastian Sch\u00f6nherr and is MIT Licensed.

    "},{"location":"about/#contributors","title":"Contributors","text":""},{"location":"about/#statistics","title":"Statistics","text":"

    GitHub:

    Bioconda:

    "},{"location":"installation/","title":"Installation","text":"

    nf-test has the same requirements as Nextflow and can be used on POSIX compatible systems like Linux or OS X. You can install nf-test using the following command:

    curl -fsSL https://code.askimed.com/install/nf-test | bash\n

    If you don't have curl installed, you could use wget:

    wget -qO- https://code.askimed.com/install/nf-test | bash\n

    It will create the nf-test executable file in the current directory. Optionally, move the nf-test file to a directory accessible by your $PATH variable.

    "},{"location":"installation/#verify-installation","title":"Verify installation","text":"

    Test the installation with the following command:

    nf-test version\n

    You should see something like this:

    \ud83d\ude80 nf-test 0.5.0\nhttps://code.askimed.com/nf-test\n(c) 2021 -2022 Lukas Forer and Sebastian Schoenherr\n\nNextflow Runtime:\n\n      N E X T F L O W\n      version 21.10.6 build 5660\n      created 21-12-2021 16:55 UTC (17:55 CEST)\n      cite doi:10.1038/nbt.3820\n      http://nextflow.io\n

    Now you are ready to write your first testcase.

    "},{"location":"installation/#install-a-specific-version","title":"Install a specific version","text":"

    If you want to install a specific version pass it to the install script as so

    curl -fsSL https://code.askimed.com/install/nf-test | bash -s 0.7.0\n
    "},{"location":"installation/#manual-installation","title":"Manual installation","text":"

    All releases are also available on Github.

    "},{"location":"installation/#nextflow-binary-not-found","title":"Nextflow Binary not found?","text":"

    If you get an error message like this, then nf-test was not able to detect your Nextflow installation.

    \ud83d\ude80 nf-test 0.5.0\nhttps://code.askimed.com/nf-test\n(c) 2021 -2022 Lukas Forer and Sebastian Schoenherr\n\nNextflow Runtime:\nError: Nextflow Binary not found. Please check if Nextflow is in a directory accessible by your $PATH variable or set $NEXTFLOW_HOME.\n

    To solve this issue you have two possibilites:

    • Move your Nextflow binary to a directory accessible by your $PATH variable.
    • Set the environment variable NEXTFLOW_HOME to the directory that contains the Nextflow binary.
    "},{"location":"installation/#updating","title":"Updating","text":"

    To update an existing nf-test installtion to the latest version, run the following command:

    nf-test update\n
    "},{"location":"installation/#compiling-from-source","title":"Compiling from source","text":"

    To compile nf-test from source you shall have maven installed. This will produce a nf-test/target/nf-test.jar file.

    git clone git@github.com:askimed/nf-test.git\ncd nf-test\nmvn install\n
    To use the newly compiled nf-test.jar, update the nf-test bash script that is on your PATH to point to the new .jar file. First locate it with which nf-test, and then modify APP_HOME and APP_JAR vars at the top: 
    #!/bin/bash\nAPP_HOME=\"/PATH/TO/nf-test/target/\"\nAPP_JAR=\"nf-test.jar\"\nAPP_UPDATE_URL=\"https://code.askimed.com/install/nf-test\"\n...\n

    "},{"location":"resources/","title":"Resources","text":"

    This page collects videos and blog posts about nf-test created by the community. Have you authored a blog post or given a talk about nf-test? Feel free to contact us, and we will be delighted to feature it here.

    "},{"location":"resources/#blog-post-leveraging-nf-test-for-enhanced-quality-control-in-nf-core","title":"Blog post: Leveraging nf-test for enhanced quality control in nf-core","text":"

    Reproducibility is an important attribute of all good science. This is specially true in the realm of bioinformatics, where software is hopefully being constantly updated, and pipelines are ideally being maintained. This blog post covers nf-test in the nf-core context.

    Read blog post

    "},{"location":"resources/#nf-corebytesize-converting-pytest-modules-to-nf-test","title":"nf-core/bytesize: Converting pytest modules to nf-test","text":"

    Adam Talbot & Sateesh Peri do a live demo of converting nf-core DSL2 modules pytests to nf-test

    The presentation was recored as part of the nf-core/bytesize series.

    "},{"location":"resources/#nf-test-a-simple-but-powerful-testing-framework-for-nextflow-pipelines","title":"nf-test: a simple but powerful testing framework for Nextflow pipelines","text":"

    Lukas Forer provides an overview of nf-test, its evolution over time and up-coming features.

    The presentation was recorded as part of the 2023 Nextflow Summit in Barcelona.

    "},{"location":"resources/#nf-test-a-simple-test-framework-specifically-tailored-for-nextflow-pipelines","title":"nf-test, a simple test framework specifically tailored for Nextflow pipelines","text":"

    Sateesh Peri does a hands-on exploration of nf-test, a simple test framework specifically tailored for Nextflow pipelines.

    Slides to follow along can be found here.

    The presentation was recorded as part of the Workflows Community Meetup - All Things Groovy at the Wellcome Genome Campus.

    "},{"location":"resources/#nf-corebytesize-nf-test","title":"nf-core/bytesize: nf-test","text":"

    Edmund Miller shares with us his impressions about nf-test from a user perspective. nf-test is a simple test framework for Nextflow pipelines.

    The presentation was recored as part of the nf-core/bytesize

    "},{"location":"resources/#episode-8-nf-test-mentorships-and-debugging-resume","title":"Episode 8: nf-test, mentorships and debugging resume","text":"

    Phil Ewels, Chris Hakkaart and Marcel Ribeiro-Dantas chat about the nf-test framework for testing Nextflow pipelines.

    The presentation was part of the \"News & Views\" episode of Channels (Nextflow Podcast).

    "},{"location":"resources/#blog-post-a-simple-test-framework-for-nextflow-pipelines","title":"Blog post: A simple test framework for Nextflow pipelines","text":"

    Discover how nf-test originated from the need to efficiently and automatically test production-ready Nextflow pipelines.

    Read blog post

    "},{"location":"docs/configuration/","title":"Configuration","text":""},{"location":"docs/configuration/#nf-testconfig","title":"nf-test.config","text":"

    The nf-test.config file is a configuration file used to customize settings and behavior for nf-test. This file must be located in the root of your project, and it is automatically loaded when you run nf-test test. Below are the parameters that can be adapted:

    Parameter Description Default Value testsDir Location for storing all nf-test cases (test scripts). If you want all test files to be in the same directory as the script itself, you can set the testDir to . \"tests\" workDir Directory for storing temporary files and working directories for each test. This directory should be added to .gitignore. \".nf-test\" configFile Location of an optional nextflow.config file specifically used for executing tests. Learn more. \"tests/nextflow.config\" libDir Location of a library folder that is automatically added to the classpath during testing to include additional libraries or resources needed for test cases. \"tests/lib\" profile Default profile to use for running tests defined in the Nextflow configuration. See Learn more. \"docker\" withTrace Enable or disable tracing options during testing. Disable tracing if your containers don't include the procps tool. true autoSort Enable or disable sorted channels by default when running tests. true options Custom Nextflow command-line options to be applied when running tests. For example \"-dump-channels -stub-run\"

    Here's an example of what an nf-test.config file could look like:

    config {\n    testsDir \"tests\"\n    workDir \".nf-test\"\n    configFile \"tests/nextflow.config\"\n    libDir \"tests/lib\"\n    profile \"docker\"\n    withTrace false\n    autoSort false\n    options \"-dump-channels -stub-run\"\n}\n
    "},{"location":"docs/configuration/#testsnextflowconfig","title":"tests/nextflow.config","text":"

    This optional nextflow.config file is used to execute tests. This is a good place to set default params for all your tests. Example number of threads:

    params {\n    // run all tests with 1 threads\n    threads = 1\n}\n
    "},{"location":"docs/configuration/#configuration-for-tests","title":"Configuration for tests","text":"

    nf-test allows to set and overwrite the config, autoSort and options properties for a specific testsuite:

    nextflow_process {\n\n    name \"Test Process...\"\n    script \"main.nf\"\n    process \"my_process\"\n    config \"path/to/test/nextflow.config\"\n    autoSort false\n    options \"-dump-channels\"\n    ...\n\n}\n

    It is also possible to overwrite these properties for specific test. Depending on the used Nextflow option, also add the --debug nf-test option on the command-line to see the addtional output.

    nextflow_process {\n\n   test(\"my test\") {\n\n      config \"path/to/test/nextflow.config\"\n      autoSort false\n      options \"-dump-channels\"\n      ...\n\n    }\n\n}\n
    "},{"location":"docs/configuration/#managing-profiles","title":"Managing Profiles","text":"

    Profiles in nf-test provide a convenient way to configure and customize Nextflow executions for your test cases. To run your test using a specific Nextflow profile, you can use the --profile argument on the command line or define a default profile in nf-test.config.

    "},{"location":"docs/configuration/#basic-profile-usage","title":"Basic Profile Usage","text":"

    By default, nf-test reads the profile configuration from nf-test.config. If you've defined a profile called A in nf-test.config, running nf-test --profile B will start Nextflow with only the B profile. It replaces any existing profiles.

    "},{"location":"docs/configuration/#combining-profiles-with","title":"Combining Profiles with \"+\"","text":"

    To combine profiles, you can use the + prefix. For example, running nf-test --profile +B will start Nextflow with both A and B profiles, resulting in -profile A,B. This allows you to extend the existing configuration with additional profiles.

    "},{"location":"docs/configuration/#profile-priority-order","title":"Profile Priority Order","text":"

    Profiles are evaluated in a specific order, ensuring predictable behavior:

    1. Profile in nf-test.config: The first profile considered is the one defined in nf-test.config.

    2. Profile Defined in Testcase: If you specify a profile within a testcase, it takes precedence over the one in nf-test.config.

    3. Profile Defined on the Command Line (CLI): Finally, any profiles provided directly through the CLI have the highest priority and override/extends previously defined profiles.

    By understanding this profile evaluation order, you can effectively configure Nextflow executions for your test cases in a flexible and organized manner.

    "},{"location":"docs/configuration/#file-staging","title":"File Staging","text":"

    The stage section of the nf-test.config file is used to define files that are needed by Nextflow in the test environment (meta directory). Additionally, the directories lib, bin, and assets are automatically staged.

    "},{"location":"docs/configuration/#supported-directives","title":"Supported Directives","text":""},{"location":"docs/configuration/#symlink","title":"symlink","text":"

    This directive is used to create symbolic links (symlinks) in the test environment. Symlinks are pointers to files or directories and can be useful for creating references to data files or directories required for the test. The syntax for the symlink directive is as follows:

    symlink \"source_path\"\n

    source_path: The path to the source file or directory that you want to symlink.

    "},{"location":"docs/configuration/#copy","title":"copy","text":"

    This directive is used to copy files or directories into the test environment. It allows you to duplicate files from a specified source to a location within the test environment. The syntax for the copy directive is as follows:

    copy \"source_path\"\n

    source_path: The path to the source file or directory that you want to copy.

    "},{"location":"docs/configuration/#example-usage","title":"Example Usage","text":"

    Here's an example of how to use the stage section in an nf-test.config file:

    config {\n    ...\n    stage {\n        symlink \"data/original_data.txt\"\n        copy \"resources/config.yml\"\n    }\n    ...\n}\n

    In this example:

    • The symlink directive creates a symlink named \"original_data.txt\" in the meta directory pointing to the file located at \"data/original_data.txt.\"
    • The copy directive copies the \"config.yml\" file from the \"resources\" directory to the meta directory.
    "},{"location":"docs/configuration/#testsuite","title":"Testsuite","text":"

    Furthermore, it is also possible to stage files that are specific to a single testsuite:

    nextflow_workflow {\n\n    name \"Test workflow HELLO_WORKFLOW\"\n\n    script \"./hello.nf\"\n    workflow \"HELLO_WORKFLOW\"\n\n    stage {\n        symlink \"test-assets/test.txt\"\n    }\n\n    test(\"Should print out test file\") {\n        expect {\n            assert workflow.success\n        }\n    }\n\n}\n
    "},{"location":"docs/getting-started/","title":"Getting started","text":"

    This guide helps you to understand the concepts of nf-test and to write your first test cases. Before you start, please check if you have installed nf-test properly on your computer. Also, this guide assumes that you have a basic knowledge of Groovy and unit testing. The Groovy documentation is the best place to learn its syntax.

    "},{"location":"docs/getting-started/#lets-get-started","title":"Let's get started","text":"

    To show the power of nf-test, we adapted a recently published proof of concept Nextflow pipeline. We adapted the pipeline to the new DSL2 syntax using modules. First, open the terminal and clone our test pipeline:

    # clone nextflow pipeline\ngit clone https://github.com/askimed/nf-test-examples\n\n# enter project directory\ncd nf-test-examples\n

    The pipeline consists of three modules (salmon.index.nf, salmon_align_quant.nf,fastqc.nf). Here, we use the salmon.index.nf process to create a test case from scratch. This process takes a reference as an input and creates an index using salmon.

    "},{"location":"docs/getting-started/#init-new-project","title":"Init new project","text":"

    Before creating test cases, we use the init command to setup nf-test.

    //Init command has already been executed for our repository\nnf-test init\n

    The init command creates the following files: nf-test.config and the .nf-test/tests folder.

    In the configuration section you can learn more about these files and how to customize the directory layout.

    "},{"location":"docs/getting-started/#create-your-first-test","title":"Create your first test","text":"

    The generate command helps you to create a skeleton test code for a Nextflow process or the complete pipeline/workflow.

    Here we generate a test case for the process salmon.index.nf:

    # delete already existing test case\nrm tests/modules/local/salmon_index.nf.test\nnf-test generate process modules/local/salmon_index.nf\n

    This command creates a new file tests/modules/local/salmon_index.nf with the following content:

    nextflow_process {\n\n    name \"Test Process SALMON_INDEX\"\n    script \"modules/local/salmon_index.nf\"\n    process \"SALMON_INDEX\"\n\n    test(\"Should run without failures\") {\n\n        when {\n            params {\n                // define parameters here. Example:\n                // outdir = \"tests/results\"\n            }\n            process {\n                \"\"\"\n                // define inputs of the process here. Example:\n                // input[0] = file(\"test-file.txt\")\n                \"\"\"\n            }\n        }\n\n        then {\n            assert process.success\n            with(process.out) {\n              // Make assertions about the content and elements of output channels here. Example:\n              // assert out_channel != null\n            }\n        }\n\n    }\n\n}\n

    The generate command filled automatically the name, script and process of our test case as well as created a skeleton for your first test method. Typically you create one file per process and use different test methods to describe the expected behaviour of the process.

    This test has a name, a when and a then closure (when/then closures are required here, since inputs need to be defined). The when block describes the input parameters of the workflow or the process. nf-test executes the process with exactly these parameters and parses the content of the output channels. Then, it evaluates the assertions defined in the then block to check if content of the output channels matches your expectations.

    "},{"location":"docs/getting-started/#the-when-block","title":"The when block","text":"

    The when block describes the input of the process and/or the Nextflow params.

    The params block is optional and is a simple map that can be used to override Nextflow's input params.

    The process block is a multi-line string. The input array can be used to set the different inputs arguments of the process. In our example, we only have one input that expects a file. Let us update the process block by setting the first element of the input array to the path of our reference file:

    when {\n    params {\n        outdir = \"output\"\n    }\n    process {\n        \"\"\"\n        // Use transcriptome.fa as a first input paramter for our process\n        input[0] = file(\"${projectDir}/test_data/transcriptome.fa\")\n        \"\"\"\n    }\n}\n

    Everything which is defined in the process block is later executed in a Nextflow script (created automatically to test your process). Therefore, you can use every Nextflow specific function or command to define the values of the input array (e.g. Channels, files, paths, etc.).

    "},{"location":"docs/getting-started/#the-then-block","title":"The then block","text":"

    The then block describes the expected output channels of the process when we execute it with the input parameters defined in the when block.

    The then block typically contains mainly assertions to check assumptions (e.g. the size and the content of an output channel). However, this block accepts every Groovy script. This means you can also import third party libraries to define very specific assertions.

    nf-test automatically loads all output channels of the process and all their items into a map named process.out. You can then use this map to formulate your assertions.

    For example, in the salmon_index process we expect to get one process executed and 16 files created. But we also want to check the md5 sum and want to look into the actual JSON file. Let us update the then section with some assertions that describe our expectations:

    then {\n    //check if test case succeeded\n    assert process.success\n    //analyze trace file\n    assert process.trace.tasks().size() == 1\n    with(process.out) {\n      // check if emitted output has been created\n      assert index.size() == 1\n      // count amount of created files\n      assert path(index.get(0)).list().size() == 16\n      // parse info.json file using a json parser provided by nf-test\n      def info = path(index.get(0)+'/info.json').json\n      assert info.num_kmers == 375730\n      assert info.seq_length == 443050\n      assert path(index.get(0)+'/info.json').md5 == \"80831602e2ac825e3e63ba9df5d23505\"\n    }\n}\n

    The items of a channel are always sorted by nf-test. This provides a deterministic order inside the channel and enables you to write reproducible tests.

    "},{"location":"docs/getting-started/#your-first-test-specification","title":"Your first test specification","text":"

    You can update the name of the test method to something that gives us later a good description of our specification. When we put everything together, we get the following full working test specification:

    nextflow_process {\n\n    name \"Test Process SALMON_INDEX\"\n    script \"modules/local/salmon_index.nf\"\n    process \"SALMON_INDEX\"\n\n    test(\"Should create channel index files\") {\n\n        when {\n            process {\n                \"\"\"\n                input[0] = file(\"${projectDir}/test_data/transcriptome.fa\")\n                \"\"\"\n            }\n        }\n\n        then {\n            //check if test case succeeded\n            assert process.success\n            //analyze trace file\n            assert process.trace.tasks().size() == 1\n            with(process.out) {\n              // check if emitted output has been created\n              assert index.size() == 1\n              // count amount of created files\n              assert path(index.get(0)).list().size() == 16\n              // parse info.json file\n              def info = path(index.get(0)+'/info.json').json\n              assert info.num_kmers == 375730\n              assert info.seq_length == 443050\n              assert path(index.get(0)+'/info.json').md5 == \"80831602e2ac825e3e63ba9df5d23505\"\n            }\n        }\n    }\n}\n
    "},{"location":"docs/getting-started/#run-your-first-test","title":"Run your first test","text":"

    Now, the test command can be used to run your test:

    nf-test test tests/modules/local/salmon_index.nf.test --profile docker\n
    "},{"location":"docs/getting-started/#specifying-profiles","title":"Specifying profiles","text":"

    In this case, the docker profile defined in the Nextflow pipeline is used to execute the test. The profile is set using the --profile parameter, but you can also define a default profile in the configuration file.

    Congratulations! You created you first nf-test specification.

    "},{"location":"docs/getting-started/#nextflow-options","title":"Nextflow options","text":"

    nf-test also allows to specify Nextflow options (e.g. -dump-channels, -stub-run) globally in the nf-test.config file or by adding an option to the test suite or the actual test. Read more about this in the configuration documentation. 

    nextflow_process {\n\n    options \"-dump-channels\"\n\n}\n
    "},{"location":"docs/getting-started/#whats-next","title":"What's next?","text":"
    • Learn how to write assertions
    • Learn how to write workflow tests (integration test or e2e)
    • Learn how to config nf-test
    "},{"location":"docs/nftest_pipelines/","title":"Pipelines using nf-test","text":""},{"location":"docs/nftest_pipelines/#nf-test-examples","title":"nf-test-examples","text":"

    All test cases described in this documentation can be found in the nf-test-examples repository.

    "},{"location":"docs/nftest_pipelines/#gwas-regenie-pipeline","title":"GWAS-Regenie Pipeline","text":"

    To show the power of nf-test, we applied nf-test to a Nextflow pipeline that performs whole genome regression modelling using regenie. Please click here to learn more about this pipeline and checkout different kind of test cases.

    "},{"location":"docs/running-tests/","title":"Running tests","text":""},{"location":"docs/running-tests/#basic-usage","title":"Basic usage","text":"

    The easiest way to use nf-test is to run the following command. This command will run all tests under the tests directory. The testDir can be changed in the nf-test.config.

    nf-test test\n
    "},{"location":"docs/running-tests/#execute-specific-tests","title":"Execute specific tests","text":"

    You can also specify a list of tests, which should be executed. 

    nf-test test tests/modules/local/salmon_index.nf.test tests/modules/bwa_index.nf.test\n\nnf-test test tests/modules tests/modules/bwa_index.nf.test\n
    "},{"location":"docs/running-tests/#tag-tests","title":"Tag tests","text":"

    nf-test provides a simple tagging mechanism that allows to execute tests by name or by tag.

    Tags can be defined for each testsuite or for each testcase using the new tag directive:

    nextflow_process {\n\n    name \"suite 1\"\n    tag \"tag1\"\n\n    test(\"test 1\") {\n        tag \"tag2\"\n        tag \"tag3\"   \n        ...\n    }\n\n    test(\"test 2\") {\n\n        tag \"tag4\"\n        tag \"tag5\"   \n        ...\n\n    }\n}\n

    For example, to execute all tests with tag2 use the following command.

    nf-test test --tag tag2  # collects test1\n

    Names are automatically added to tags. This enables to execute suits or tests directly. 

    nf-test test --tag \"suite 1\"  # collects test1 and test2\n

    When more tags are provided,\u00a0all tests that match at least one tag will be executed. Tags are also not case-sensitive, both lines will result the same tests.

    nf-test test --tag tag3,tag4  # collects test1 and test2\nnf-test test --tag TAG3,TAG4  # collects test1 and test2\n
    "},{"location":"docs/running-tests/#create-a-tap-output","title":"Create a TAP output","text":"

    To run all tests and create a report.tap file, use the following command.

    nf-test test --tap report.tap\n
    "},{"location":"docs/running-tests/#run-test-by-its-hash-value","title":"Run test by its hash value","text":"

    To run a specific test using its hash, the following command can be used. The hash value is generated during its first execution. 

    nf-test test tests/main.nf.test@d41119e4\n
    "},{"location":"docs/assertions/assertions/","title":"Assertions","text":"

    Writing test cases means formulating assumptions by using assertions. Groovy\u2019s power assert provides a detailed output when the boolean expression validates to false. nf-test provides several extensions and commands to simplify the work with Nextflow channels. Here we summarise how nextflow and nf-test handles channels and provide examples for the tools that nf-test provides:

    • with: assert the contents of an item in a channel by index
    • contains: assert the contents of an item in the channel is present anywhere in the channel
    • assertContainsInAnyOrder: order-agnostic assertion of the contents of a channel
    "},{"location":"docs/assertions/assertions/#nextflow-channels-and-nf-test-channel-sorting","title":"Nextflow channels and nf-test channel sorting","text":"

    Nextflow channels emit (in a random order) a single value or a tuple of values.

    Channels that emit a single item produce an unordered list of objects, List<Object>, for example: 

    process.out.outputCh = ['Hola', 'Hello', 'Bonjour']\n

    Channels that contain Nextflow file values have a unique path each run. For Example: 

    process.out.outputCh = ['/.nf-test/tests/c563c/work/65/85d0/Hola.json', '/.nf-test/tests/c563c/work/65/fa20/Hello.json', '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json']\n

    Channels that emit tuples produce an unordered list of ordered objects, List<List<Object>>: 

    process.out.outputCh = [\n  ['Hola', '/.nf-test/tests/c563c/work/65/85d0/Hola.json'], \n  ['Hello', '/.nf-test/tests/c563c/work/65/fa20/Hello.json'], \n  ['Bonjour', '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json']\n]\n

    Assertions by channel index are made possible through sorting of the nextflow channel. The sorting is performed automatically by nf-test prior to launch of the then closure via integer, string and path comparisons. For example, the above would be sorted by nf-test: 

    process.out.outputCh = [\n  ['Bonjour', '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json'],\n  ['Hello', '/.nf-test/tests/c563c/work/65/fa20/Hello.json'],\n  ['Hola', '/.nf-test/tests/c563c/work/65/85d0/Hola.json']\n]\n

    "},{"location":"docs/assertions/assertions/#using-with","title":"Using with","text":"

    This assertions...

    assert process.out.imputed_plink2\nassert process.out.imputed_plink2.size() == 1\nassert process.out.imputed_plink2.get(0).get(0) == \"example.vcf\"\nassert process.out.imputed_plink2.get(0).get(1) ==~ \".*/example.vcf.pgen\"\nassert process.out.imputed_plink2.get(0).get(2) ==~ \".*/example.vcf.psam\"\nassert process.out.imputed_plink2.get(0).get(3) ==~ \".*/example.vcf.pvar\"\n

    ... can be written by using with(){} to improve readability:

    assert process.out.imputed_plink2\nwith(process.out.imputed_plink2) {\n    assert size() == 1\n    with(get(0)) {\n        assert get(0) == \"example.vcf\"\n        assert get(1) ==~ \".*/example.vcf.pgen\"\n        assert get(2) ==~ \".*/example.vcf.psam\"\n        assert get(3) ==~ \".*/example.vcf.pvar\"\n    }\n}\n
    "},{"location":"docs/assertions/assertions/#using-contains-to-assert-an-item-in-the-channel-is-present","title":"Using contains to assert an item in the channel is present","text":"

    Groovy's contains and collect methods can be used to flexibly assert an item exists in the channel output.

    For example, the below represents a channel that emits a two-element tuple, a string and a json file: 

    /*\ndef process.out.outputCh = [\n  ['Bonjour', '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json'],\n  ['Hello', '/.nf-test/tests/c563c/work/65/fa20/Hello.json'],\n  ['Hola', '/.nf-test/tests/c563c/work/65/85d0/Hola.json']\n]\n*/\n

    To assert the channel contains one of the tuples, parse the json and assert: 

    testData = process.out.outputCh.collect { greeting, jsonPath -> [greeting, path(jsonPath).json] } \nassert testData.contains(['Hello', path('./myTestData/Hello.json').json])\n

    To assert a subset of the tuple data, filter the channel using collect. For example, to assert the greeting only: 

    testData = process.out.outputCh.collect { greeting, jsonPath -> greeting } \nassert testData.contains('Hello')\n

    See the files page for more information on parsing and asserting various file types.

    "},{"location":"docs/assertions/assertions/#using-assertcontainsinanyorder-for-order-agnostic-assertion-of-the-contents-of-a-channel","title":"Using assertContainsInAnyOrder for order-agnostic assertion of the contents of a channel","text":"

    assertContainsInAnyOrder(List<object> list1, List<object> list2) performs an order agnostic assertion on channels contents and is available in every nf-test closure. It is a binding for Hamcrest's assertContainsInAnyOrder.

    Some example use-cases are provided below.

    "},{"location":"docs/assertions/assertions/#channel-that-emits-strings","title":"Channel that emits strings","text":"
    // process.out.outputCh = ['Bonjour', 'Hello', 'Hola'] \n\ndef expected = ['Hola', 'Hello', 'Bonjour']\nassertContainsInAnyOrder(process.out.outputCh, expected)\n
    "},{"location":"docs/assertions/assertions/#channel-that-emits-a-single-maps-eg-valmymap","title":"Channel that emits a single maps, e.g. val(myMap)","text":"
    /*\nprocess.out.outputCh = [\n  [\n    'D': [10,11,12],\n    'C': [7,8,9]\n  ],\n  [\n    'B': [4,5,6],\n    'A': [1,2,3]\n  ]\n]\n*/\n\ndef expected = [\n  [\n    'A': [1,2,3],\n    'B': [4,5,6]\n  ],\n  [\n    'C': [7,8,9],\n    'D': [10,11,12]\n  ]\n]\n\nassertContainsInAnyOrder(process.out.outputCh, expected)\n
    "},{"location":"docs/assertions/assertions/#channel-that-emits-json-files","title":"Channel that emits json files","text":"

    See the files page for more information on parsing and asserting various file types.

    Since the outputCh filepaths are different between consecutive runs, the files need to be read/parsed prior to comparison

    /*\nprocess.out.outputCh = [\n  '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json',\n  '/.nf-test/tests/c563c/work/65/fa20/Hello.json',\n  '/.nf-test/tests/c563c/work/65/85d0/Hola.json'\n]\n*/\n\ndef actual = process.out.outputCh.collect { filepath -> path(filepath).json }\ndef expected = [\n  path('./myTestData/Hello.json').json,\n  path('./myTestData/Hola.json').json,\n  path('./myTestData/Bonjour.json').json,\n]\n\nassertContainsInAnyOrder(actual, expected)\n
    "},{"location":"docs/assertions/assertions/#channel-that-emits-a-tuple-of-strings-and-json-files","title":"Channel that emits a tuple of strings and json files","text":"

    See the files page for more information on parsing and asserting various file types.

    Since the ordering of items within the tuples are consistent, we can assert this case:

    /*\nprocess.out.outputCh = [\n  ['Bonjour', '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json'],\n  ['Hello', '/.nf-test/tests/c563c/work/65/fa20/Hello.json'],\n  ['Hola', '/.nf-test/tests/c563c/work/65/85d0/Hola.json']\n]\n*/\n\ndef actual = process.out.outputCh.collect { greeting, filepath -> [greeting, path(filepath).json] }\ndef expected = [\n  ['Hola', path('./myTestData/Hola.json').json], \n  ['Hello', path('./myTestData/Hello.json').json],\n  ['Bonjour', path('./myTestData/Bonjour.json').json],\n]\n\nassertContainsInAnyOrder(actual, expected)\n

    To assert the json only and ignore the strings: 

    /*\nprocess.out.outputCh = [\n  ['Bonjour', '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json'],\n  ['Hello', '/.nf-test/tests/c563c/work/65/fa20/Hello.json'],\n  ['Hola', '/.nf-test/tests/c563c/work/65/85d0/Hola.json']\n]\n*/\n\ndef actual = process.out.outputCh.collect { greeting, filepath -> path(filepath).json }\ndef expected = [\n  path('./myTestData/Hello.json').json, \n  path('./myTestData/Hola.json').json,\n  path('./myTestData/Bonjour.json').json\n]\n\nassertContainsInAnyOrder(actual, expected)\n

    To assert the strings only and not the json files: 

    /*\nprocess.out.outputCh = [\n  ['Bonjour', '/.nf-test/tests/c563c/work/65/b62f/Bonjour.json'],\n  ['Hello', '/.nf-test/tests/c563c/work/65/fa20/Hello.json'],\n  ['Hola', '/.nf-test/tests/c563c/work/65/85d0/Hola.json']\n]\n*/\n\ndef actual = process.out.outputCh.collect { greeting, filepath -> greeting }\ndef expected = ['Hello', 'Hola', 'Bonjour]\n\nassertContainsInAnyOrder(actual, expected)\n

    "},{"location":"docs/assertions/assertions/#using-assertall","title":"Using assertAll","text":"

    assertAll(Closure... closures) ensures that all supplied closures do no throw exceptions. The number of failed closures is reported in the Exception message. This useful for efficient debugging of a set of test assertions from a single test run.

    def a = 2\n\nassertAll(\n    { assert a==1 },\n    { a = 1/0 },\n    { assert a==2 },\n    { assert a==3 }\n)\n
    The output will look like this: 
    assert a==1\n       ||\n       |false\n       2\n\njava.lang.ArithmeticException: Division by zero\nAssertion failed:\n\nassert a==3\n       ||\n       |false\n       2\n\nFAILED (7.106s)\n\n  java.lang.Exception: 3 of 4 assertions failed\n

    "},{"location":"docs/assertions/fasta/","title":"FASTA Files","text":"

    0.7.0

    The nft-fasta plugin extends path by a fasta property that can be used to read FASTA files into maps. nft-fasta supports also gzipped FASTA files.

    "},{"location":"docs/assertions/fasta/#setup","title":"Setup","text":"

    To use the fasta property you need to activate the nft-fasta plugin in your nf-test.config file:

    config {\n  plugins {\n    load \"nft-fasta@1.0.0\"\n  }\n}\n

    More about plugins can be fond here.

    "},{"location":"docs/assertions/fasta/#comparing-files","title":"Comparing files","text":"
    assert path('path/to/fasta1.fasta').fasta == path(\"path/to/fasta2.fasta'\").fasta\n
    "},{"location":"docs/assertions/fasta/#work-with-individual-samples","title":"Work with individual samples","text":"
    def sequences = path('path/to/fasta1.fasta.gz').fasta\nassert \"seq1\" in sequences\nassert !(\"seq8\" in sequences)\nassert sequences.seq1 == \"AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC\"\n
    "},{"location":"docs/assertions/files/","title":"Files","text":""},{"location":"docs/assertions/files/#md5-checksum","title":"md5 Checksum","text":"

    nf-test extends path by a md5 property that can be used to compare the file content with an expected checksum:

    assert path(process.out.out_ch.get(0)).md5 == \"64debea5017a035ddc67c0b51fa84b16\"\n
    Note that for gzip compressed files, the md5 property is calculated after gunzipping the file contents, whereas for other filetypes the md5 property is directly calculated on the file itself.

    "},{"location":"docs/assertions/files/#json-files","title":"JSON Files","text":"

    nf-test supports comparison of JSON files and keys within JSON files. To assert that two JSON files contain the same keys and values: 

    assert path(process.out.out_ch.get(0)).json == path('./some.json').json\n
    Individual keys can also be asserted:

    assert path(process.out.out_ch.get(0)).json.key == \"value\"\n
    "},{"location":"docs/assertions/files/#yaml-files","title":"YAML Files","text":"

    nf-test supports comparison of YAML files and keys within YAML files. To assert that two YAML files contain the same keys and values: 

    assert path(process.out.out_ch.get(0)).yaml == path('./some.yaml').yaml\n
    Individual keys can also be asserted:

    assert path(process.out.out_ch.get(0)).yaml.key == \"value\"\n
    "},{"location":"docs/assertions/files/#gzip-files","title":"GZip Files","text":"

    nf-test extends path by a linesGzip property that can be used to read gzip compressed files.

    assert path(process.out.out_ch.get(0)).linesGzip.size() == 5\nassert path(process.out.out_ch.get(0)).linesGzip.contains(\"Line Content\")\n
    "},{"location":"docs/assertions/files/#filter-lines","title":"Filter lines","text":"

    The returned array can also be filtered by lines.

    def lines = path(process.out.gzip.get(0)).linesGzip[0..5]\nassert lines.size() == 6\ndef lines = path(process.out.gzip.get(0)).linesGzip[0]\nassert lines.equals(\"MY_HEADER\")\n
    "},{"location":"docs/assertions/files/#grep-lines","title":"Grep lines","text":"

    nf-test also provides the possibility to grep only specific lines with the advantage that only a subset of lines need to be read (especially helpful for larger files).

    def lines = path(process.out.gzip.get(0)).grepLinesGzip(0,5)\nassert lines.size() == 6\ndef lines = path(process.out.gzip.get(0)).grepLineGzip(0)\nassert lines.equals(\"MY_HEADER\")\n
    "},{"location":"docs/assertions/files/#snapshot-support","title":"Snapshot Support","text":"

    The possibility of filter lines from a *.gz file can also be combined with the snapshot functionality. 

    assert snapshot(\npath(process.out.gzip.get(0)).linesGzip[0]\n).match()\n
    "},{"location":"docs/assertions/libraries/","title":"Using Third-Party Libraries","text":"

    nf-test supports including third party libraries (e.g. jar files ) or functions from groovy files to either extend it functionality or to avoid duplicate code and to keep the logic in test cases simple.

    "},{"location":"docs/assertions/libraries/#using-local-groovy-files","title":"Using Local Groovy Files","text":"

    0.7.0 \u00b7

    If nf-test detects a lib folder in the directory of a tescase, then it adds it automatically to the classpath.

    "},{"location":"docs/assertions/libraries/#examples","title":"Examples","text":"

    We have a Groovy script MyWordUtils.groovy that contains the following class:

    class MyWordUtils {\n\n    def static capitalize(String word){\n      return word.toUpperCase();\n    }\n\n}\n

    We can put this file in a subfolder called lib:

    testcase_1\n\u251c\u2500\u2500 capitalizer.nf\n\u251c\u2500\u2500 capitalizer.test\n\u2514\u2500\u2500 lib\n    \u2514\u2500\u2500 MyWordUtils.groovy\n

    The file capitalizer.nf contains the CAPITALIZER process:

    #!/usr/bin/env nextflow\nnextflow.enable.dsl=2\n\nprocess CAPITALIZER {\n    input:\n        val cheers\n    output:\n        stdout emit: output\n    script:\n       println \"$cheers\".toUpperCase()\n    \"\"\"\n    \"\"\"\n\n}\n

    Next, we can use this class in the capitalizer.nf.test like every other class that is provided by nf-test or Groovy itself:

    nextflow_process {\n\n    name \"Test Process CAPITALIZER\"\n    script \"capitalizer.nf\"\n    process \"CAPITALIZER\"\n\n    test(\"Should run without failures\") {\n\n        when {\n            process {\n                \"\"\"\n                input[0] = \"world\"\n                \"\"\"\n            }\n        }\n\n        then {\n            assert process.success\n            assert process.stdout.contains(MyWordUtils.capitalize('world'))\n        }\n\n    }\n\n}\n

    If we have a project and we want to reuse libraries in multiple test cases, then we can store the class in the shared lib folder. Both test cases are now able to use MyWordUtils:

    tests\n\u251c\u2500\u2500 testcase_1\n    \u251c\u2500\u2500 hello_1.nf\n    \u251c\u2500\u2500 hello_1.nf.test\n\u251c\u2500\u2500 testcase_2\n    \u251c\u2500\u2500 hello_2.nf\n    \u251c\u2500\u2500 hello_2.nf.test\n\u2514\u2500\u2500 lib\n    \u2514\u2500\u2500 MyWordUtils.groovy\n

    The default location is tests/lib. This folder location can be changed in nf-test config file.

    It is also possible to use the --lib parameter to add an additional folder to the classpath:

    nf-test test tests/testcase_1/hello_1.nf.test --lib tests/mylibs\n

    If multiple folders are used, the they need to be separate with a colon (like in Java or Groovy).

    "},{"location":"docs/assertions/libraries/#using-local-jar-files","title":"Using Local Jar Files","text":"

    To integrate local jar files, you can either specify the path to the jar within the nf-test --lib option 

    nf-test test test.nf.test --lib tests/lib/groovy-ngs-utils/groovy-ngs-utils.jar\n

    or add it as follows to the nf-test.config file:

    libDir \"tests/lib:tests/lib/groovy-ngs-utils/groovy-ngs-utils.jar\"\n

    You could then import the class and use it in the then statement:

    import gngs.VCF;\n\nnextflow_process {\n\n    name \"Test Process VARIANT_CALLER\"\n    script \"variant_caller.nf\"\n    process \"VARIANT_CALLER\"\n\n    test(\"Should run without failures\") {\n\n        when {\n           ...\n        }\n\n        then {\n            assert process.success             \n            def vcf = VCF.parse(\"$baseDir/tests/test_data/NA12879.vcf.gz\")\n            assert vcf.samples.size() == 10\n            assert vcf.variants.size() == 20\n        }\n\n    }\n\n}\n
    "},{"location":"docs/assertions/libraries/#using-maven-artifcats-with-grab","title":"Using Maven Artifcats with @Grab","text":"

    nf-test supports the @Grab annotation to include third-party libraries that are available in a maven repository. As the dependency is defined as a maven artifact, there is no local copy of the jar file needed and maven enables to include an exact version as well as provides an easy update process.

    "},{"location":"docs/assertions/libraries/#example","title":"Example","text":"

    The following example uses the WordUtil class from commons-lang:

    @Grab(group='commons-lang', module='commons-lang', version='2.4')\nimport org.apache.commons.lang.WordUtils\n\nnextflow_process {\n\n    name \"Test Process CAPITALIZER\"\n    script \"capitalizer.nf\"\n    process \"CAPITALIZER\"\n\n    test(\"Should run without failures\") {\n\n        when {\n            process {\n                \"\"\"\n                input[0] = \"world\"\n                \"\"\"\n            }\n        }\n\n        then {\n            assert process.success\n            assert process.stdout.contains(WordUtils.capitalize('world'))\n        }\n\n    }\n\n}\n
    "},{"location":"docs/assertions/regular-expressions/","title":"Regular Expressions","text":""},{"location":"docs/assertions/regular-expressions/#using-operator","title":"Using ==~ operator","text":"

    The operator ==~ can be used to check if a string matches a regular expression:

    assert \"/my/full/path/to/process/dir/example.vcf.pgen\" ==~ \".*/example.vcf.pgen\"\n
    "},{"location":"docs/assertions/snapshots/","title":"Snapshots","text":"

    0.7.0

    Snapshots are a very useful tool whenever you want to make sure your output channels or output files not change unexpectedly. This feature is highly inspired by Jest.

    A typical snapshot test case takes a snapshot of the output channels or any other object, then compares it to a reference snapshot file stored alongside the test (*.nf.test.snap). The test will fail, if the two snapshots do not match: either the change is unexpected, or the reference snapshot needs to be updated to the new output of a process, workflow, pipeline or function.

    "},{"location":"docs/assertions/snapshots/#using-snapshots","title":"Using Snapshots","text":"

    The snapshot keyword creates a snapshot of the object and its match method can then be used to check if its contains the expected data from the snap file. The following example shows how to create a snapshot of a workflow channel:

    assert snapshot(workflow.out.channel1).match()\n

    You can also create a snapshot of all output channels of a process:

    assert snapshot(process.out).match()\n

    Or a specific check on a file:

    assert snapshot(path(process.out.get(0))).match()\n

    Even the result of a function can be used:

    assert snapshot(function.result).match()\n

    The first time this test runs, nf-test creates a snapshot file. This is a json file that contains a serialized version of the provided object.

    The snapshot file should be committed alongside code changes, and reviewed as part of your code review process. nf-test uses pretty-format to make snapshots human-readable during code review. On subsequent test runs, nf-test will compare the data with the previous snapshot. If they match, the test will pass. If they don't match, either the test runner found a bug in your code that should be fixed, or the implementation has changed and the snapshot needs to be updated.

    "},{"location":"docs/assertions/snapshots/#updating-snapshots","title":"Updating Snapshots","text":"

    When a snapshot test is failing due to an intentional implementation change, you can use the --update-snapshot flag to re-generate snapshots for all failed tests.

    nf-test test tests/main.nf.test --update-snapshot\n
    "},{"location":"docs/assertions/snapshots/#cleaning-obsolete-snapshots","title":"Cleaning Obsolete Snapshots","text":"

    0.8.0

    Over time, snapshots can become outdated, leading to inconsistencies in your testing process. To help you manage obsolete snapshots, nf-test generates a list of these obsolete keys. This list provides transparency into which snapshots are no longer needed and can be safely removed.

    Running your tests with the --clean-snapshotor --wipe-snapshot option removes the obsolete snapshots from the snapshot file. This option is useful when you want to maintain the structure of your snapshot file but remove unused entries. It ensures that your snapshot file only contains the snapshots required for your current tests, reducing file bloat and improving test performance.

    nf-test test tests/main.nf.test --clean-snapshot\n

    Obsolete snapshots can only be detected when running all tests in a test file simultaneously, and when all tests pass. If you run a single test or if tests are skipped, nf-test cannot detect obsolete snapshots.

    "},{"location":"docs/assertions/snapshots/#constructing-complex-snapshots","title":"Constructing Complex Snapshots","text":"

    It is also possible to include multiple objects into one snapshot:

    assert snapshot(workflow.out.channel1, workflow.out.channel2).match()\n

    Every object that is serializable can be included into snapshots. Therefore you can even make a snapshot of the complete workflow or process object. This includes stdout, stderr, exist status, trace etc. and is the easiest way to create a test that checks for all of this properties:

    assert snapshot(workflow).match()\n

    You can also include output files to a snapshot (e.g. useful in pipeline tests where no channels are available):

    assert snapshot(\n    workflow,\n    path(\"${params.outdir}/file1.txt\"),\n    path(\"${params.outdir}/file2.txt\"),\n    path(\"${params.outdir}/file3.txt\")\n).match()\n

    By default the snapshot has the same name as the test. You can also store a snapshot under a user defined name. This enables you to use multiple snapshots in one single test and to separate them in a logical way. In the following example a workflow snapshot is created, stored under the name \"workflow\".

    assert snapshot(workflow).match(\"workflow\")\n

    The next example creates a snapshot of two files and saves it under \"files\".

    assert snapshot(path(\"${params.outdir}/file1.txt\"), path(\"${params.outdir}/file2.txt\")).match(\"files\")\n

    You can also use helper methods to add objects to snapshots. For example, you can use the list()method to add all files of a folder to a snapshot:

     assert snapshot(workflow, path(params.outdir).list()).match()\n
    "},{"location":"docs/assertions/snapshots/#compressed-snapshots","title":"Compressed Snapshots","text":"

    If you add complex objects to snapshots with large content, you could use the md5() function to store the hashsum instead of the content in the snapshot file:

     assert snapshot(hugeObject).md5().match()\n
    "},{"location":"docs/assertions/snapshots/#file-paths","title":"File Paths","text":"

    If nf-test detects a path in the snapshot it automatically replace it by a unique fingerprint of the file that ensures the file content is the same. The fingerprint is default the md5 sum.

    "},{"location":"docs/assertions/snapshots/#snapshot-differences","title":"Snapshot Differences","text":"

    0.8.0

    By default, nf-test uses the diff tool for comparing snapshots. It employs the following default arguments:

    • -y: Enables side-by-side comparison mode.
    • -W 200: Sets the maximum width for displaying the differences to 200 characters.

    These default arguments are applied when no custom settings are specified.

    If diffis not installed on the system, nf-test will print exepcted and found snapshots without highlighting differences.

    "},{"location":"docs/assertions/snapshots/#customizing-diff-tool-arguments","title":"Customizing Diff Tool Arguments","text":"

    Users have the flexibility to customize the arguments passed to the diff tool using an environment variable called NFT_DIFF_ARGS. This environment variable allows you to modify the way the diff tool behaves when comparing snapshots.

    To customize the arguments, follow these steps:

    1. Set the NFT_DIFF_ARGS environment variable with your desired arguments.

      export NFT_DIFF_ARGS=\"<your_custom_arguments>\"\n

    2. Run nf-test to perform snapshot comparison, and it will utilize the custom arguments specified in NFT_DIFF_ARGS.

    "},{"location":"docs/assertions/snapshots/#changing-the-diff-tool","title":"Changing the Diff Tool","text":"

    nf-test not only allows you to customize the arguments but also provides the flexibility to change the diff tool itself. This can be achieved by using the environment variable NFT_DIFF.

    "},{"location":"docs/assertions/snapshots/#example-using-icdiff","title":"Example: Using icdiff","text":"

    As an example, you can change the diff tool to icdiff, which supports features like colors. To switch to icdiff, follow these steps:

    1. Install icdiff

    2. Set the NFT_DIFF environment variable to icdiff to specify the new diff tool.

      export NFT_DIFF=\"icdiff\"\n

    3. If needed, customize the arguments for icdiff using NFT_DIFF_ARGS as explained in the previous section

      export NFT_DIFF_ARGS=\"-N --cols 200 -L expected -L observed -t\"\n

    4. Run nf-test, and it will use icdiff as the diff tool for comparing snapshots.

    "},{"location":"docs/cli/clean/","title":"clean command","text":""},{"location":"docs/cli/clean/#usage","title":"Usage","text":"
    nf-test clean\n

    The clean command removes the .nf-test directory.

    "},{"location":"docs/cli/generate/","title":"generate command","text":""},{"location":"docs/cli/generate/#usage","title":"Usage","text":"
    nf-test generate <TEST_CASE_TYPE> <NEXTFLOW_FILES>\n
    "},{"location":"docs/cli/generate/#supported-types","title":"Supported Types","text":""},{"location":"docs/cli/generate/#process","title":"process","text":""},{"location":"docs/cli/generate/#workflow","title":"workflow","text":""},{"location":"docs/cli/generate/#pipeline","title":"pipeline","text":""},{"location":"docs/cli/generate/#function","title":"function","text":""},{"location":"docs/cli/generate/#examples","title":"Examples","text":"

    Create a test case for a process:

    nf-test generate process modules/local/salmon_index.nf\n

    Create a test cases for all processes in folder modules:

    nf-test generate process modules/**/*.nf\n

    Create a test case for a sub workflow:

    nf-test generate workflow workflows/some_workflow.nf\n

    Create a test case for the whole pipeline:

    nf-test generate pipeline main.nf\n

    Create a test case for each function in file functions.nf:

    nf-test generate function functions.nf\n
    "},{"location":"docs/cli/init/","title":"init command","text":""},{"location":"docs/cli/init/#usage","title":"Usage","text":"
    nf-test init\n

    The init command set ups nf-test in the current directory.

    The init command creates the following files: nf-test.config and tests/nextflow.config. It also creates a folder tests which is the home directory of your test code.

    In the configuration section you can learn more about these files and how to customize the directory layout.

    "},{"location":"docs/cli/list/","title":"list command","text":""},{"location":"docs/cli/list/#usage","title":"Usage","text":"

    list command provides a convenient way to list all available test cases.

    nf-test list [<NEXTFLOW_FILES>|<SCRIPT_FOLDERS>]\n
    "},{"location":"docs/cli/list/#optional-arguments","title":"Optional Arguments","text":""},{"location":"docs/cli/list/#-tags","title":"--tags","text":"

    Print a list of all used tags.

    "},{"location":"docs/cli/list/#-format-json","title":"--format json","text":"

    Print the list of tests or tags as json object.

    "},{"location":"docs/cli/list/#-format-raw","title":"--format raw","text":"

    Print the list of tests or tags as simple list without formatting.

    "},{"location":"docs/cli/list/#-silent","title":"--silent","text":"

    Hide program version and header infos.

    "},{"location":"docs/cli/list/#-debug","title":"--debug","text":"

    Show debugging infos.

    "},{"location":"docs/cli/list/#examples","title":"Examples","text":"

    • List test cases that can be found in the testDir defined in the nf-test.config file in the current working directory:

      nf-test list\n

    • List test cases in specified test scripts and search specified directories for additional test scripts:

      nf-test list tests/modules/local/salmon_index.nf.test tests/modules/bwa_index.nf.test\n\nnf-test list tests/modules tests/modules/bwa_index.nf.test\n

    • List of all testcases as json:

    nf-test list --format json --silent\n[\"/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@69b98c67\",\"/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@fdb6c1cc\",\"/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@d1c219eb\",\"/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@3c54e3cb\",...]\n
    • List of all testcases as unformatted ist:
    nf-test list --format raw --silent\n/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@69b98c67\n/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@fdb6c1cc\n/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@d1c219eb\n/Users/lukfor/Development/git/nf-gwas/tests/main.nf.test@3c54e3cb\n...\n
    • List of all tags as json:
    nf-test list --tags --format json --silent\n[\"fastqc\",\"snakemake\"]\n
    • List of all tags as unformatted list:
    nf-test list --tags --format raw --silent\nfastqc\nsnakemake\n
    "},{"location":"docs/cli/test/","title":"test command","text":""},{"location":"docs/cli/test/#usage","title":"Usage","text":"
    nf-test test [<NEXTFLOW_FILES>|<SCRIPT_FOLDERS>]\n
    "},{"location":"docs/cli/test/#optional-arguments","title":"Optional Arguments","text":""},{"location":"docs/cli/test/#-profile-nextflow_profile","title":"--profile <NEXTFLOW_PROFILE>","text":"

    To run your test using a specific Nextflow profile, you can use the --profile argument. Learn more.

    "},{"location":"docs/cli/test/#-verbose","title":"--verbose","text":"

    Prints out the Nextflow output during test runs.

    "},{"location":"docs/cli/test/#-without-trace","title":"--without-trace","text":"

    The Linux tool procps is required to run Nextflow tracing. In case your container does not support this tool, you can also run nf-test without tracing. Please note that the workflow.trace are not available when running it with this flag.

    "},{"location":"docs/cli/test/#-tag-tag","title":"--tag <tag>","text":"

    Execute only tests with the provided tag. Multiple tags can be used and have to be separated by commas (e.g. tag1,tag2).

    "},{"location":"docs/cli/test/#-tap-filename","title":"--tap <filename>","text":"

    Writes test results in TAP format to file.

    "},{"location":"docs/cli/test/#-junitxml-filename","title":"--junitxml <filename>","text":"

    Writes test results in JUnit XML format to file, which conforms to the standard schema.

    "},{"location":"docs/cli/test/#-debug","title":"--debug","text":"

    The debug parameter prints out debugging messages and all available output channels which can be accessed in the then clause.

    "},{"location":"docs/cli/test/#examples","title":"Examples","text":"
    • Run all test scripts that can be found in the testDir defined in the nf-test.config file in the current working directory:
    nf-test test\n
    • Run all specified test scripts and search specified directories for additional test scripts:
    nf-test test tests/modules/local/salmon_index.nf.test tests/modules/bwa_index.nf.test\n\nnf-test test tests/modules tests/modules/bwa_index.nf.test\n
    • Run a specific test using its hash:
    nf-test test tests/main.nf.test@d41119e4\n
    • Run all tests and write results to report.tap:
    nf-test test --tap report.tap\n
    "},{"location":"docs/plugins/developing-plugins/","title":"Plugin Development","text":"

    0.7.0

    The following plugin can be used as a boilerplate: https://github.com/askimed/nft-fasta

    "},{"location":"docs/plugins/developing-plugins/#developing-plugins","title":"Developing Plugins","text":"

    A plugin has the possibility:

    1. Adding a new method to an existing class (e.g. the property fasta to class Path). It uses Groovy's ExtensionModule concept. Important: the method has to be static. One class can provide multiple methods.
    // com.askimed.nf.test.fasta.PathExtension\npublic class PathExtension {\n  //can be used as: path(filename).fasta\n    public static Object getFasta(Path self) {\n    return FastaUtil.readAsMap(self);\n  }\n\n}\n
    1. Providing new methods
    // com.askimed.nf.test.fasta.Methods\npublic class Methods {\n\n  //can be used as: helloFasta()\n  public static void helloFasta() {\n    System.out.println(\"Hello FASTA\");\n  }\n\n}\n
    "},{"location":"docs/plugins/developing-plugins/#manifest-file","title":"Manifest file","text":"

    You need to create a file META-INF/nf-test-plugin (in your resources). This file contains metadata about the plugin and both classes can now be registered by using the extensionClasses and extensionMethods properties.

    moduleName=nft-my-plugin\nmoduleVersion=1.0.0\nmoduleAuthors=Lukas Forer\nextensionClasses=com.askimed.nf.test.fasta.PathExtension\nextensionMethods=com.askimed.nf.test.fasta.Methods\n
    "},{"location":"docs/plugins/developing-plugins/#building-a-jar-file","title":"Building a jar file","text":"

    The plugin itself is a jar file that contains all classes and the META-INF/nf-test-plugin file. If you have dependencies then you have to create a uber-jar that includes all libraries, because nf-test doesn't support the classpath set in META-INF\\MANIFEST.

    "},{"location":"docs/plugins/developing-plugins/#publishing-plugins","title":"Publishing Plugins","text":"

    Available plugins are managed in this default repository: https://github.com/askimed/nf-test-plugins/blob/main/plugins.json

    Add your plugin or a new release to the plugin.json file and create a pull request to publish your plugin in the default repository. Or host you own repository:

    [{\n  \"id\": \"nft-fasta\",\n  \"releases\": [{\n    \"version\": \"1.0.0\",\n    \"url\": \"https://github.com/askimed/nft-fasta/releases/download/v1.0.0/nft-fasta-1.0.0.jar\",\n  },{\n    \"version\": \"2.0.0\",\n    \"url\": \"https://github.com/askimed/nft-fasta/releases/download/v2.0.0/nft-fasta-2.0.0.jar\",\n  }]\n},{\n  \"id\": \"nft-my-plugin\",\n  \"releases\": [{\n    \"version\": \"1.0.0\",\n    \"url\": \"https://github.com/lukfor/nft-my-plugin2/releases/download/v1.0.0/nft-my-plugin-1.0.0.jar\",\n  }]\n}]\n
    "},{"location":"docs/plugins/using-plugins/","title":"Plugins","text":"

    0.7.0

    Most assertions are usecase specific. Therefore, separating this functionality and helper classes from the nf-test codebase has several advantages:

    1. nf-test releases are independent from plugin releases
    2. it is easier for third-parties to develop and maintain plugins
    3. it is possible to use private repositories to integrate private/protected code in plugins without sharing them

    For this purpose, we integrated the following plugin system that provides (a) the possibility to extend existing classes with custom methods (e.g. path(filename).fasta) and (2) to extends nf-test with new methods.

    "},{"location":"docs/plugins/using-plugins/#using-plugins","title":"Using Plugins","text":"

    Available plugins are listed here.

    A plugin can be activated via the nf-test.config by adding the plugin section and by using load method to specify the plugin and its version:

    config {\n\n  plugins {\n\n    load \"nft-fasta@1.0.0\"\n\n  }\n\n}\n

    It is also possible to add one ore more additional repositories. (Example: repository with development/snapshot versions, in-house repository, ...)

    config {\n\n  plugins {\n\n    repository \"https://github.com/askimed/nf-test-plugins/blob/main/plugins-snapshots.json\"\n    repository \"https://github.com/seppinho/nf-test-plugin2/blob/main/plugins.json\"\n\n    load \"nft-fasta@1.1.0-snapshot\"\n    load \"nft-plugin2@1.1.0\"\n\n    // you can also load jar files directly without any repository\n    // loadFromFile \"path/to/my/nft-plugin.jar\"\n  }\n\n}\n

    All plugins are downloaded and cached in .nf-test\\plugins. This installation mechanism is yet not safe for parallel execution when multiple nf-test instances are resolving the same plugin. However, you can use nf-test update-plugins to download all plugins before you run your tests in parallel.

    To clear the cache and to force redownloading plugins and repositories you can execute the nf-test clean command.

    One or multiple plugins can be activated also via the --plugins parameter:

    nf-test test my-test.nf.test --plugins nft-fasta@1.0.0,plugin2@1.0.0\n

    or

    nf-test test my-test.nf.test --plugins path/to/my/nft-plugin.jar\n
    "},{"location":"docs/testcases/","title":"Documentation","text":""},{"location":"docs/testcases/global_variables/","title":"Global Variables","text":"

    The following variables are available and can be used in setup, when, then and cleanup closures.

    Name Description Example baseDir orprojectDir The directory where the nf-test.config script is located. mypipeline moduleDir The directory where the module script is located mypipeline/modules/mymodule moduleTestDir The directory where the test script is located mypipeline/tests/modules/mymodule launchDir The directory where the test is run. mypipeline/.nf-test/tests/<test_hash> metaDir The directory where all meta are located (e.g. mock.nf). mypipeline/.nf-test/tests/<test_hash>/meta workDir The directory where tasks temporary files are created. mypipeline/.nf-test/tests/<test_hash>/work outputDir An output directory in the $launchDir that can be used to store output files. The variable contains the absolute path. If you need a relative outpu directory see launchDir example. mypipeline/.nf-test/tests/<test_hash>/output params Dictionary like object holding all parameters."},{"location":"docs/testcases/global_variables/#examples","title":"Examples","text":""},{"location":"docs/testcases/global_variables/#outputdir","title":"outputDir","text":"

    This variable points to the directory within the temporary test directory (.nf-test/tests/<test-dir>/output/). The variable can be set under params:

    params {\n    outdir = \"$outputDir\"\n}\n
    "},{"location":"docs/testcases/global_variables/#basedir","title":"baseDir","text":"

    This variable points to the directory to locate the base directory of the main nf-test config. The variable can be used e.g. in the process definition to build absolute paths for input files:

    process {\n    \"\"\"\n    file1 = file(\"$baseDir/tests/input/file123.gz\")\n    \"\"\"\n}\n
    "},{"location":"docs/testcases/global_variables/#launchdir","title":"launchDir","text":"

    This variable points to the directory where the test is executed. This can be used get access to results that are created in an relative output directory:

    when {\n    params {\n        outdir = \"results\"\n    }\n}\n
    then {\n    assert path(\"$launchDir/results\").exists()\n}\n
    "},{"location":"docs/testcases/nextflow_function/","title":"Function Testing","text":"

    nf-test allows testing of functions that are defined in a Nextflow file or defined in lib. Please checkout the CLI to generate a function test.

    "},{"location":"docs/testcases/nextflow_function/#syntax","title":"Syntax","text":"
    nextflow_function {\n\n    name \"<NAME>\"\n    script \"<PATH/TO/NEXTFLOW_SCRIPT.nf>\"\n    function \"<FUNCTION_NAME>\"\n\n    test(\"<TEST_NAME>\") {\n\n    }\n}\n

    Script paths that start with ./ or ../ are considered relative paths. These paths are resolved based on the location of the test script. Relative paths are beneficial when you want to reference files or directories located within the same directory as your test script or in a parent directory. These paths provide a convenient way to access files without specifying the entire path.

    "},{"location":"docs/testcases/nextflow_function/#multiple-functions","title":"Multiple Functions","text":"

    If a Nextflow script contains multiple functions and you want to test them all in the same testsuite, you can override the function property in each test. For example:

    "},{"location":"docs/testcases/nextflow_function/#functionsnf","title":"functions.nf","text":"
    def function1() {\n  ...\n}\n\ndef function2() {\n  ...\n}\n
    "},{"location":"docs/testcases/nextflow_function/#functionsnftest","title":"functions.nf.test","text":"
    nextflow_function {\n\n    name \"Test functions\"\n    script \"functions.nf\"\n\n    test(\"Test function1\") {\n      function \"function1\"\n      ...\n    }\n\n    test(\"Test function2\") {\n      function \"function2\"\n      ...\n    }\n}\n
    "},{"location":"docs/testcases/nextflow_function/#functions-in-lib-folder","title":"Functions in lib folder","text":"

    If you want to test a function that is inside a groovy file in your lib folder, you can ignore the script property, because Nextflow adds them automatically to the classpath. For example:

    "},{"location":"docs/testcases/nextflow_function/#libutilsgroovy","title":"lib\\Utils.groovy","text":"
    class Utils {\n\n    public static void sayHello(name) {\n        if (name == null) {\n            error('Cannot greet a null person')\n        }\n\n        def greeting = \"Hello ${name}\"\n\n        println(greeting)\n    }\n\n}\n
    "},{"location":"docs/testcases/nextflow_function/#testslibutilsgroovytest","title":"tests\\lib\\Utils.groovy.test","text":"
    nextflow_function {\n\n    name \"Test Utils.groovy\"\n\n    test(\"Test function1\") {\n      function \"Utils.sayHello\"\n      ...\n    }\n}\n

    Note: the generate function command works only with Nextflow functions.

    "},{"location":"docs/testcases/nextflow_function/#assertions","title":"Assertions","text":"

    The function object can be used in asserts to check its status, result value or error messages.

    // function status\nassert function.success\nassert function.failed\n\n// return value\nassert function.result == 27\n\n//returns a list containing all lines from stdout\nassert function.stdout.contains(\"Hello World\") == 3\n
    "},{"location":"docs/testcases/nextflow_function/#example","title":"Example","text":""},{"location":"docs/testcases/nextflow_function/#nextflow-script","title":"Nextflow script","text":"

    Create a new file and name it functions.nf.

    def say_hello(name) {\n    if (name == null) {\n        error('Cannot greet a null person')\n    }\n\n    def greeting = \"Hello ${name}\"\n\n    println(greeting)\n    return greeting\n}\n
    "},{"location":"docs/testcases/nextflow_function/#nf-test-script","title":"nf-test script","text":"

    Create a new file and name it functions.nf.test.

    nextflow_function {\n\n  name \"Test Function Say Hello\"\n\n  script \"functions.nf\"\n  function \"say_hello\"\n\n  test(\"Passing case\") {\n\n    when {\n      function {\n        \"\"\"\n        input[0] = \"aaron\"\n        \"\"\"\n      }\n    }\n\n    then {\n      assert function.success\n      assert function.result == \"Hello aaron\"\n      assert function.stdout.contains(\"Hello aaron\")\n      assert function.stderr.isEmpty()\n    }\n\n  }\n\n  test(\"Failure Case\") {\n\n    when {\n      function {\n        \"\"\"\n        input[0] = null\n        \"\"\"\n      }\n    }\n\n    then {\n      assert function.failed\n      //It seems to me that error(..) writes message to stdout\n      assert function.stdout.contains(\"Cannot greet a null person\")\n    }\n  }\n}\n
    "},{"location":"docs/testcases/nextflow_function/#execute-test","title":"Execute test","text":"
    nf-test test functions.nf.test\n
    "},{"location":"docs/testcases/nextflow_pipeline/","title":"Pipeline Testing","text":"

    nf-test also allows to test the complete pipeline end-to-end. Please checkout the CLI to generate a pipeline test.

    "},{"location":"docs/testcases/nextflow_pipeline/#syntax","title":"Syntax","text":"
    nextflow_pipeline {\n\n    name \"<NAME>\"\n    script \"<PATH/TO/NEXTFLOW_SCRIPT.nf>\"\n\n    test(\"<TEST_NAME>\") {\n\n    }\n}\n
    "},{"location":"docs/testcases/nextflow_pipeline/#assertions","title":"Assertions","text":"

    The workflow object can be used in asserts to check its status, error messages or traces.

    // workflow status\nassert workflow.success\nassert workflow.failed\nassert workflow.exitStatus == 0\n\n// workflow error message\nassert workflow.errorReport.contains(\"....\")\n\n// trace\n//returns a list containing succeeded tasks\nassert workflow.trace.succeeded().size() == 3\n\n//returns a list containing failed tasks\nassert workflow.trace.failed().size() == 0\n\n//returns a list containing all tasks\nassert workflow.trace.tasks().size() == 3\n
    "},{"location":"docs/testcases/nextflow_pipeline/#example","title":"Example","text":""},{"location":"docs/testcases/nextflow_pipeline/#nextflow-script","title":"Nextflow script","text":"

    Create a new file and name it pipeline.nf.

    #!/usr/bin/env nextflow\nnextflow.enable.dsl=2\n\nprocess SAY_HELLO {\n    input:\n        val cheers\n\n    output:\n        stdout emit: verbiage_ch\n        path '*.txt', emit: verbiage_ch2\n\n    script:\n    \"\"\"\n    echo -n $cheers\n    echo -n $cheers > ${cheers}.txt\n    \"\"\"\n}\n\nworkflow {\n    input = params.input_text.trim().split(',')\n    Channel.from(input) | SAY_HELLO\n}\n
    "},{"location":"docs/testcases/nextflow_pipeline/#nf-test-script","title":"nf-test script","text":"

    Create a new file and name it pipeline.nf.test.

    nextflow_pipeline {\n\n    name \"Test Pipeline with 1 process\"\n    script \"pipeline.nf\"\n\n    test(\"Should run without failures\") {\n\n        when {\n            params {\n              input_text = \"hello,nf-test\"\n            }\n        }\n\n        then {\n            assert workflow.success\n            assert workflow.trace.tasks().size() == 2\n        }\n\n    }\n\n}\n
    "},{"location":"docs/testcases/nextflow_pipeline/#execute-test","title":"Execute test","text":"
    nf-test init\nnf-test test pipeline.nf.test\n
    "},{"location":"docs/testcases/nextflow_process/","title":"Process Testing","text":"

    nf-test allows to test each process defined in a module file. Please checkout the CLI to generate a process test.

    "},{"location":"docs/testcases/nextflow_process/#syntax","title":"Syntax","text":"
    nextflow_process {\n\n    name \"<NAME>\"\n    script \"<PATH/TO/NEXTFLOW_SCRIPT.nf>\"\n    process \"<PROCESS_NAME>\"\n\n    test(\"<TEST_NAME>\") {\n\n    }\n}\n

    Script paths that start with ./ or ../ are considered relative paths. These paths are resolved based on the location of the test script. Relative paths are beneficial when you want to reference files or directories located within the same directory as your test script or in a parent directory. These paths provide a convenient way to access files without specifying the entire path.

    "},{"location":"docs/testcases/nextflow_process/#assertions","title":"Assertions","text":"

    The process object can be used in asserts to check its status or error messages.

    // process status\nassert process.success\nassert process.failed\nassert process.exitStatus == 0\n\n// Analyze Nextflow trace file\nassert process.trace.tasks().size() == 1\n\n// process error message\nassert process.errorReport.contains(\"....\")\n\n//returns a list containing all lines from stdout\nassert process.stdout.contains(\"Hello World\") == 3\n
    "},{"location":"docs/testcases/nextflow_process/#output-channels","title":"Output Channels","text":"

    The process.out object provides access to the content of all named output Channels (see Nextflow emit):

    // channel exists\nassert process.out.my_channel != null\n\n// channel contains 3 elements\nassert process.out.my_channel.size() == 3\n\n// first element is \"hello\"\nassert process.out.my_channel.get(0) == \"hello\"\n

    Channels that lack explicit names can be addressed using square brackets and the corresponding index. This indexing method provides a straightforward way to interact with channels without the need for predefined names. To access the first output channel, you can use the index [0] as demonstrated below:

    // channel exists\nassert process.out[0] != null\n\n// channel contains 3 elements\nassert process.out[0].size() == 3\n\n// first element is \"hello\"\nassert process.out[0].get(0) == \"hello\"\n
    "},{"location":"docs/testcases/nextflow_process/#example","title":"Example","text":""},{"location":"docs/testcases/nextflow_process/#nextflow-script","title":"Nextflow script","text":"

    Create a new file and name it say_hello.nf.

    #!/usr/bin/env nextflow\nnextflow.enable.dsl=2\n\nprocess SAY_HELLO {\n    input:\n        val cheers\n\n    output:\n        stdout emit: verbiage_ch\n        path '*.txt', emit: verbiage_ch2\n\n    script:\n    \"\"\"\n    echo -n $cheers\n    echo -n $cheers > ${cheers}.txt\n    \"\"\"\n}\n
    "},{"location":"docs/testcases/nextflow_process/#nf-test-script","title":"nf-test script","text":"

    Create a new file and name it say_hello.nf.test.

    nextflow_process {\n\n    name \"Test Process SAY_HELLO\"\n    script \"say_hello.nf\"\n    process \"SAY_HELLO\"\n\n    test(\"Should run without failures\") {\n\n        when {\n            process {\n                \"\"\"\n                input[0] = Channel.from('hello','nf-test')\n                \"\"\"\n            }\n        }\n\n        then {\n\n            assert process.success\n            assert process.trace.tasks().size() == 2\n\n            with(process.out.verbiage_ch2) {\n                assert size() == 2\n                assert path(get(0)).readLines().size() == 1\n                assert path(get(1)).readLines().size() == 1\n                assert path(get(1)).md5 == \"4a17df7a54b41a84df492da3f1bab1e3\"\n            }\n\n        }\n\n    }\n}\n
    "},{"location":"docs/testcases/nextflow_process/#execute-test","title":"Execute test","text":"
    nf-test init\nnf-test test say_hello.nf.test\n
    "},{"location":"docs/testcases/nextflow_workflow/","title":"Workflow Testing","text":"

    nf-test also allows to test a specific workflow. Please checkout the CLI to generate a workflow test.

    "},{"location":"docs/testcases/nextflow_workflow/#syntax","title":"Syntax","text":"
    nextflow_workflow {\n\n    name \"<NAME>\"\n    script \"<PATH/TO/NEXTFLOW_SCRIPT.nf>\"\n    workflow \"<WORKFLOW_NAME>\"\n\n    test(\"<TEST_NAME>\") {\n\n    }\n}\n

    Script paths that start with ./ or ../ are considered relative paths. These paths are resolved based on the location of the test script. Relative paths are beneficial when you want to reference files or directories located within the same directory as your test script or in a parent directory. These paths provide a convenient way to access files without specifying the entire path.

    "},{"location":"docs/testcases/nextflow_workflow/#assertions","title":"Assertions","text":"

    The workflow object can be used in asserts to check its status, error messages or traces.

    // workflow status\nassert workflow.success\nassert workflow.failed\nassert workflow.exitStatus == 0\n\n// workflow error message\nassert workflow.errorReport.contains(\"....\")\n\n// trace\n//returns a list containing succeeded tasks\nassert workflow.trace.succeeded().size() == 3\n\n//returns a list containing failed tasks\nassert workflow.trace.failed().size() == 0\n\n//returns a list containing all tasks\nassert workflow.trace.tasks().size() == 3\n\n//returns a list containing all lines from stdout\nassert workflow.stdout.contains(\"Hello World\") == 3\n
    "},{"location":"docs/testcases/nextflow_workflow/#output-channels","title":"Output Channels","text":"

    The workflow.out object provides access to the content of all named output Channels (see Nextflow emit):

    // channel exists\nassert workflow.out.my_channel != null\n\n// channel contains 3 elements\nassert workflow.out.my_channel.size() == 3\n\n// first element is \"hello\"\nassert workflow.out.my_channel.get(0) == \"hello\"\n
    "},{"location":"docs/testcases/nextflow_workflow/#example","title":"Example","text":""},{"location":"docs/testcases/nextflow_workflow/#nextflow-script","title":"Nextflow script","text":"

    Create a new file and name it trial.nf.

    #!/usr/bin/env nextflow\nnextflow.enable.dsl=2\n\nprocess sayHello {\n    input:\n        val cheers\n\n    output:\n        stdout emit: verbiage_ch\n        path '*.txt', emit: verbiage_ch2\n\n    script:\n    \"\"\"\n    echo -n $cheers\n    echo -n $cheers > ${cheers}.txt\n    \"\"\"\n}\n\nworkflow trial {\n    take: things\n    main:\n        sayHello(things)\n        sayHello.out.verbiage_ch.view()\n    emit:\n        trial_out_ch = sayHello.out.verbiage_ch2\n}\n\nworkflow {\n    Channel.from('hello','nf-test') | trial\n}\n
    "},{"location":"docs/testcases/nextflow_workflow/#nf-test-script","title":"nf-test script","text":"

    Create a new file and name it trial.nf.test.

    nextflow_workflow {\n\n    name \"Test Workflow Trial\"\n    script \"trial.nf\"\n    workflow \"trial\"\n\n    test(\"Should run without failures\") {\n\n        when {\n            workflow {\n                \"\"\"\n                input[0] = Channel.from('hello','nf-test')\n                \"\"\"\n            }\n        }\n\n        then {\n\n            assert workflow.success\n\n            with(workflow.out.trial_out_ch) {\n                assert size() == 2\n                assert path(get(0)).readLines().size() == 1\n                assert path(get(1)).readLines().size() == 1\n                assert path(get(1)).md5 == \"4a17df7a54b41a84df492da3f1bab1e3\"\n            }\n\n        }\n\n    }\n\n}\n
    "},{"location":"docs/testcases/nextflow_workflow/#execute-test","title":"Execute test","text":"
    nf-test init\nnf-test test trial.nf.test\n
    "},{"location":"docs/testcases/params/","title":"Params Dictionary","text":"

    The params block is optional and is a simple map that can be used to overwrite Nextflow's input params. The params block is located in the when block of a testcase. You can set params manually:

    when {\n    params {\n        outdir = \"output\"\n    }\n}\n

    It is also possible to set nested params using the same syntax as in your Nextflow script:

    when {\n    params {\n        output {\n          dir = \"output\"\n        }\n    }\n}\n

    The params map can also be used in the then block:

    then {\n    assert params.output == \"output\"    \n}\n
    "},{"location":"docs/testcases/params/#load-params-from-files","title":"Load params from files","text":"

    In addition, you can load the params from a JSON file:

    when {\n    params {\n        load(\"$baseDir/tests/params.json\")\n    }\n}\n

    or from a YAML file:

    when {\n    params {\n        load(\"$baseDir/tests/params.yaml\")\n    }\n}\n

    nf-test allows to combine both techniques and therefor it is possible to overwrite one or more params from the json file:

    when {\n    params {\n        load(\"$baseDir/tests/params.json\")\n        outputDir = \"new/output/path\"\n    }\n}\n
    "},{"location":"docs/testcases/setup/","title":"Setup Method","text":"

    The setup method allows you to specify processes or workflows that need to be executed before the primary when block. It serves as a mechanism to prepare the required input data or set up essential steps prior to the primary processing block.

    "},{"location":"docs/testcases/setup/#syntax","title":"Syntax","text":"

    The setup method is typically used within the context of a test case. The basic syntax for the setup method is as follows:

    test(\"my test\"){\n    setup {\n        // Define and execute dependent processes or workflows here\n    }\n}\n

    Within the setup block, you can use the run method to define and execute dependent processes or workflows.

    The run method syntax for a process is as follows:

    run(\"ProcessName\") {\n    script \"path/to/process/script.nf\"\n    process {\n        // Define the process inputs here\n    }\n}\n

    The run method syntax for a workflow is as follows:

    run(\"WorkflowName\") {\n    script \"path/to/workflow/script.nf\"\n    workflow {\n        // Define the workflow inputs here\n    }\n}\n

    If you need to run the same process multiple times, you can set the alias of the process:

    run(\"GENERATE_DATA\", alias: \"MY_PROCESS\") {\n    script \"./generate_data.nf\"\n    process {\n       ...\n    }\n}\n

    Warning

    Please keep in mind that changes in procsses or workflows, which are executed in the setup method, can result in a failed test run.

    "},{"location":"docs/testcases/setup/#example-usage","title":"Example Usage","text":""},{"location":"docs/testcases/setup/#1-local-setup-method","title":"1. Local Setup Method","text":"

    In this example, we create a setup method within a Nextflow process definition to execute a dependent process named \"ABRICATE_RUN.\" This process generates input data that is required for the primary process \"ABRICATE_SUMMARY.\" The setup block specifies the execution of \"ABRICATE_RUN,\" and the when block defines the processing logic for \"ABRICATE_SUMMARY.\"

    nextflow_process {\n\n    name \"Test process data\"\n\n    script \"../main.nf\"\n    process \"ABRICATE_SUMMARY\"\n    config \"./nextflow.config\"\n\n    test(\"Should use process ABRICATE_RUN to generate input data\") {\n\n        setup {\n\n            run(\"ABRICATE_RUN\") {\n                script \"../../run/main.nf\"\n                process {\n                    \"\"\"\n                    input[0] =  Channel.fromList([\n                        tuple([ id:'test1', single_end:false ], // meta map\n                            file(params.test_data['bacteroides_fragilis']['genome']['genome_fna_gz'], checkIfExists: true)),\n                        tuple([ id:'test2', single_end:false ],\n                            file(params.test_data['haemophilus_influenzae']['genome']['genome_fna_gz'], checkIfExists: true))\n                    ])\n                    \"\"\"\n                }\n            }\n\n        }\n\n        when {\n            process {\n                \"\"\"\n                input[0] = ABRICATE_RUN.out.report.collect{ meta, report -> report }.map{ report -> [[ id: 'test_summary'], report]}\n                \"\"\"\n            }\n        }\n\n        then {\n            assert process.success\n            assert snapshot(process.out).match()\n        }\n    }\n\n}\n
    "},{"location":"docs/testcases/setup/#2-global-setup-method","title":"2. Global Setup Method","text":"

    In this example, a global setup method is defined for all tests within a Nextflow process definition. The setup method is applied to multiple test cases, ensuring consistent setup for each test. This approach is useful when multiple tests share the same setup requirements.

    nextflow_process {\n\n    name \"Test process data\"\n\n    script \"../main.nf\"\n    process \"ABRICATE_SUMMARY\"\n    config \"./nextflow.config\"\n\n    setup {\n        run(\"ABRICATE_RUN\") {\n            script \"../../run/main.nf\"\n            process {\n                \"\"\"\n                input[0] =  Channel.fromList([\n                    tuple([ id:'test1', single_end:false ], // meta map\n                        file(params.test_data['bacteroides_fragilis']['genome']['genome_fna_gz'], checkIfExists: true)),\n                    tuple([ id:'test2', single_end:false ],\n                        file(params.test_data['haemophilus_influenzae']['genome']['genome_fna_gz'], checkIfExists: true))\n                ])\n                \"\"\"\n            }\n        }\n    }\n\n    test(\"first test\") {\n        when {\n            process {\n                \"\"\"\n                input[0] = ABRICATE_RUN.out.report.collect{ meta, report -> report }.map{ report -> [[ id: 'test_summary'], report]}\n                \"\"\"\n            }\n        }\n        then {\n            assert process.success\n            assert snapshot(process.out).match()\n        }\n    }\n\n    test(\"second test\") {\n        when {\n            process {\n                \"\"\"\n                input[0] = ABRICATE_RUN.out.report.collect{ meta, report -> report }.map{ report -> [[ id: 'test_summary'], report]}\n                \"\"\"\n            }\n        }\n        then {\n            assert process.success\n            assert snapshot(process.out).match()\n        }\n    }\n\n}\n
    "},{"location":"docs/testcases/setup/#3-aliasing-of-dependencies","title":"3. Aliasing of Dependencies","text":"

    In this example, the process UNTAR is used multiple times in the setup method:

    nextflow_process {\n\n    ...\n\n    setup {\n\n        run(\"UNTAR\", alias: \"UNTAR1\") {\n            script \"modules/nf-core/untar/main.nf\"\n            process {\n            \"\"\"\n            input[0] = Channel.fromList(...)\n            \"\"\"\n            }\n        }\n\n        run(\"UNTAR\", alias: \"UNTAR2\") {\n            script \"modules/nf-core/untar/main.nf\"\n            process {\n            \"\"\"\n            input[0] = Channel.fromList(...)\n            \"\"\"\n            }\n        }\n\n        run(\"UNTAR\", alias: \"UNTAR3\") {\n            script \"modules/nf-core/untar/main.nf\"\n            process {\n            \"\"\"\n            input[0] = Channel.fromList(...)\n            \"\"\"\n            }\n        }\n    }\n\n    test(\"Test with three different inputs\") {\n        when {\n            process {\n                \"\"\"\n                input[0] = UNTAR1.out.untar.map{ it[1] }\n                input[1] = UNTAR2.out.untar.map{ it[1] }\n                input[2] = UNTAR3.out.untar.map{ it[1] }\n                \"\"\"\n            }\n        }\n\n        then {\n            ...\n        }\n\n }\n\n}\n
    "}]} \ No newline at end of file diff --git a/sitemap.xml.gz b/sitemap.xml.gz index 436d4546..d6785d01 100644 Binary files a/sitemap.xml.gz and b/sitemap.xml.gz differ