From 1ef56edfed1cc098713ee68b9c636ad285a8ee8c Mon Sep 17 00:00:00 2001 From: Acribbs Date: Mon, 1 Apr 2024 10:33:10 +0100 Subject: [PATCH] have removed WrapperCodeML because I have no idea what it does so that we can reduce the amount of code to support --- cgat/WrapperCodeML.py | 2931 ----------------------------------------- 1 file changed, 2931 deletions(-) delete mode 100644 cgat/WrapperCodeML.py diff --git a/cgat/WrapperCodeML.py b/cgat/WrapperCodeML.py deleted file mode 100644 index c57322dd6..000000000 --- a/cgat/WrapperCodeML.py +++ /dev/null @@ -1,2931 +0,0 @@ -''' -WrapperCodeML.py - -====================================================== - -:Tags: Python - -Code ----- - -''' -import sys -import string -import re -import tempfile -import subprocess -import shutil -import random -import traceback -from types import * -from cgatcore import experiment as Experiment -from cgat import TreeTools as TreeTools -from cgatcore import iotools as iotools -from cgat import Tree as Tree -from cgat import Mali as Mali -from cgat import Genomics as Genomics -from cgat import RateEstimation as RateEstimation - - -class Error(Exception): - - """Base class for exceptions in this module.""" - - def __str__(self): - return str(self.message) - - def _get_message(self): - return self._message - - def _set_message(self, message): - self._message = message - message = property(_get_message, _set_message) - - -class ParsingError(Error): - - """Exception raised for errors while parsing - - Attributes: - message -- explanation of the error - """ - - def __init__(self, message, line=None): - if line: - self.message = message + " at line " + line - else: - self.message = message - - -class UsageError(Error): - - """Exception raised for errors while starting - - Attributes: - message -- explanation of the error - """ - - def __init__(self, message): - self.message = message - - -class CodeMLBranchInfo: - - """result with branch information.""" - - def __init__(self, branch1, branch2, kaks, ka, ks, ndn, sds, n, s): - - self.mBranch1 = branch1 - self.mBranch2 = branch2 - self.mKaks = kaks - self.mKa = ka - self.mKs = ks - self.mSds = sds - self.mNdn = ndn - self.mN = n - self.mS = s - - def __str__(self): - return "\t".join((self.mBranch1, self.mBranch2, - str(self.mKaks), str(self.mKa), str(self.mKs), - str(self.mNdn), str(self.mSds))) - - -class CodeMLResult: - - mMaxLineLength = 100 - - def __init__(self): - self.mWarnings = [] - self.mCheckConvergence = False - - def truncateLine(self, line): - if len(line) > self.mMaxLineLength: - return "%s..." % line[:self.mMaxLineLength] - else: - return line - - def mapNames(self, map_old2new): - """map all names.""" - - self.mTreeKs.relabel(map_old2new) - self.mTreeKa.relabel(map_old2new) - self.mTreeKaks.relabel(map_old2new) - self.mTreeSds.relabel(map_old2new) - self.mTreeNdn.relabel(map_old2new) - self.mTreeS.relabel(map_old2new) - self.mTreeN.relabel(map_old2new) - - def __str__(self): - - s = [] - members = self.__dict__ - keys = list(members.keys()) - keys.sort() - - for key in keys: - - if key[0] == 'm': - - m = members[key] - if type(m) in (ListType, TupleType): - for x in range(len(m)): - s.append( - ("%-40s: %s" % (key, - self.truncateLine(str(m[x]))))) - elif type(m) in (DictType,): - for x, y in list(m.items()): - s.append( - ("%-40s: %s: %s" % (key, str(x), - self.truncateLine(str(y))))) - else: - s.append(("%-40s: %s" % (key, self.truncateLine(str(m))))) - - return "\n".join(s) - - def buildTreesFromBranchInfo(self): - """build trees from branch info. - - assumes that codeml prints out parent -> child - """ - # t is a map of parent to children - self.mTreeKs = TreeTools.Graph2Tree( - [(x.mBranch1, x.mBranch2, x.mKs) for x in self.mBranchInfo]) - self.mTreeKa = TreeTools.Graph2Tree( - [(x.mBranch1, x.mBranch2, x.mKa) for x in self.mBranchInfo]) - self.mTreeKaks = TreeTools.Graph2Tree( - [(x.mBranch1, x.mBranch2, x.mKaks) for x in self.mBranchInfo]) - self.mTreeSds = TreeTools.Graph2Tree( - [(x.mBranch1, x.mBranch2, x.mSds) for x in self.mBranchInfo]) - self.mTreeNdn = TreeTools.Graph2Tree( - [(x.mBranch1, x.mBranch2, x.mNdn) for x in self.mBranchInfo]) - self.mTreeS = TreeTools.Graph2Tree( - [(x.mBranch1, x.mBranch2, x.mS) for x in self.mBranchInfo]) - self.mTreeN = TreeTools.Graph2Tree( - [(x.mBranch1, x.mBranch2, x.mN) for x in self.mBranchInfo]) - - -class BaseMLResult(CodeMLResult): - - """result object for BaseML.""" - - def __init__(self): - CodeMLResult.__init__(self) - self.mAlpha = "na" - self.mNumGammaBins = 0 - self.mKappa = "na" - - -class CodeMLResultSites(CodeMLResult): - - """result with site specific information.""" - - def __init__(self, num_sequences, model): - CodeMLResult.__init__(self) - self.mNumSequences = num_sequences - self.mModel = model - self.mNEB = CodeMLResultPositiveSites() - self.mBEB = CodeMLResultPositiveSites() - - -class CodeMLResultPositiveSites(CodeMLResult): - - def __init__(self): - CodeMLResult.__init__(self) - self.mPositiveSites = [] - - -class CodeMLResultPositiveSite: - - def __init__(self, residue, aa, p, w, stderr): - - self.mResidue = residue - self.mAA = aa - self.mProbability = p - self.mOmega = w - self.mStdErr = stderr - - def __str__(self): - return "\t".join(("%i" % self.mResidue, - self.mAA, - "%5.2f" % self.mProbability, - "%5.2f" % self.mOmega, - "%5.2f" % self.mStdErr)) - - -class CodeMLResultPairs(CodeMLResult): - - """results for a pairwise codeml run.""" - - def __init__(self): - CodeMLResult.__init__(self) - self.mPairs = [] - - def fromResult(self, result): - """build pairwise results from tree.""" - - self.mPairs = [] - - nodes = result.mTreeKs.get_terminals() - ids = [result.mTreeKs.node(x).get_data().taxon for x in nodes] - for n1 in range(0, len(nodes)): - for n2 in range(0, n1): - - name1, name2 = nodes[n1], nodes[n2] - pair = CodeMLResultPair() - pair.mName1, pair.mName2 = ids[n1], ids[n2] - pair.mLogLikelihood = result.mLogLikelihood - - pair.mTau, pair.mS, pair.mN, pair.mKa, pair.mKs = \ - (0, - result.mTreeSds.distance(name1, name2), - result.mTreeNdn.distance(name1, name2), - result.mTreeKa.distance(name1, name2), - result.mTreeKs.distance(name1, name2)) - - pair.mKaks = pair.mKa / pair.mKs - pair.mKappa = result.mKappa - - pair.mRn, pair.mRs, pair.mRn0, pair.mRs0, pair.mBranchLength = None, None, None, None, None - self.mPairs.append(pair) - - -class CodeMLResultPair(CodeMLResult): - - """results for a pairwise comparison.""" - - def __init__(self): - CodeMLResult.__init__(self) - self.mError = "" - - -class CodeMLAncestralSequence: - - """an ancestral sequence.""" - - def __init__(self, sequence, accuracy_per_site, accuracy_per_sequence): - self.mSequence = sequence - self.mAccuracyPerSite = accuracy_per_site - self.mAccuracyPerSequence = accuracy_per_sequence - - def __str__(self): - return "\t".join(("%f" % self.mAccuracyPerSite, - "%f" % self.mAccuracyPerSequence, - self.mSequence)) - - -class CodeML: - - """ - """ - - def __init__(self): - - self.mFilenameControl = "codeml.ctl" - - self.mWarnings = [] - - self.mDefaults = {"noisy": "9", - "verbose": "1", - "runmode": "0", - "seqtype": "2", - "CodonFreq": "2", - "clock": "0", - "model": "0", - "NSsites": "0", - "icode": "0", - "fix_kappa": "0", - "kappa": "2", - "fix_omega": "0", - "omega": "0.4", - "fix_alpha": "1", - "alpha": "0", - "fix_rho": "1", - "rho": "0", - "RateAncestor": "0", - "Small_Diff": ".5e-6", - } - - self.mOptions = { - "noisy": {"0": "how much rubbish on screen", - "1": "how much rubbish on screen", - "2": "how much rubbish on screen", - "3": "how much rubbish on screen", - "9": "how much rubbish on screen" - }, - "verbose": {"0": "concise output", - "1": "detailed output", - "2": "too much output" - }, - "runmode": {"0": "user tree", - "1": "semi automatic", - "2": "automatic", - "3": "stepwise addition", - "4": "PerturbationNNI", - "5": "PerturbationNNI", - "-2": "pairwise" - }, - "seqtype": {"1": "Sequence type is codons", - "2": "Sequence type is AAs", - "3": "Sequence type is codons translated to AAs", - }, - "CodonFreq": {"0": "Uniform codon frequencies: 1/61 each", - "1": "Codon frequencies given by F1X4", - "2": "Codon frequencies given by F3X4", - "3": "Codon frequencies given by codon table", - }, - "ndata": {"#": "number of data sets to analyse", - }, - "clock": {"0": "no clock", - "1": "clock", - "2": "local clock", - "3": "Combined Analysis", - }, - "aaDist": {"0": "equal", - "+": "geometric", - "-": "linear", - "1": "G1974", - "2": "Miyata", - "3": "c", - "4": "p", - "5": "v", - "6": "a", - }, - "aaRatefile": {"jones.dat": "Jones", - "dayhoff.data": "Dayhoff", - "wag.dat": "Wag", - "mtmam.dat": "mtmam", - }, - "model": {"0": "Codon: one omega per branch - AA: poisson ", - "1": "Codon: branch specific omega - AA: proportional", - "2": "Codon: 2 or more omega - AA: Empirical", - "3": "Empirical+F", - "6": "FromCodon", - "7": "AAClasses", - "8": "REVaa_0", - "9": "REVaa(nr=189)", - }, - "NSsites": {"0": "no site-specific variation of omega", - "1": "neutral", - "2": "selection", - "3": "discrete", - "4": "freqs", - "5": "gamma", - "6": "2gamma", - "7": "beta", - "8": "beta&w", - "9": "beta&gamma", - "10": "beta&gamma+1", - "11": "beta&normal>1", - "12": "0&2normal>1", - "13": "3normal>0", - }, - "icode": {"0": "Genetic code: universal", - "1": "mammalian mt", - "2": "yeast mt.", - "3": "mold mt.", - "4": "invertebrate mt.", - "5": "ciliate nuclear", - "6": "echinoderm mt.", - "7": "euplotid mt.", - "8": "alternative yeast nu.", - "9": "ascidian mt.", - "10": "blepharisma nu."}, - "Mgene": {"0": "All rates equal between genes (if G option in sequence file: different, but proportional branch lengths)", - "1": "separate", - "2": "different pi", - "3": "different kappa", - "4": "all different", - }, - "fix_kappa": {"0": "kappa is to be estimated", - "1": "kappa is fixed", - }, - "kappa": {"2": "default initial or fixed kappa value.", - "#": "fixed or initial kappa", - }, - "fix_omega": {"0": "omega is to be estimated", - "1": "omega is fixed", - }, - "omega": {"0.4": "default initial of fixed omega value", - "#": "initial or fixed omega", - }, - "fix_alpha": {"0": "alpha is to be estimated", - "1": "alpha is fixed", - }, - "alpha": {"0": "inifinity: fixed alpha", - "#": "discrete gamma model with shape parameter alpha" - }, - "fix_rho": {"0": "rho is to be estimated", - "1": "rho is fixed", - }, - - "fix_blength": {"0": "ignore branch lengths on given tree", - "-1": "use random branch lengths for given tree", - "1": "use branch lengths on given tree as initial values", - "2": "assume branch lengths on given tree to be fixed"}, - - "rho": {"0": "no correlation between sites", - "#": "initial or fixed rho." - }, - "Malpha": {"0": "same alpha for genes", - "1": "different alpha for genes", - }, - "ncatG": {"#": "number of categories for discrete gamma model in site-specific models", - }, - "getSE": {"0": "do not output standard errors of estimates", - "1": "output standard errors of estimates", - }, - "RateAncestor": {"0": "do not calculate ancestral states", - "1": "calculate ancestral states (only works with runmode 0)", - "2": "?"}, - "Small_Diff": {".5e-6": "default value for small difference", - "#": "small difference", - }, - "cleandata": {"0": "do not remove sites with ambiguity characters (default)", - "1": "remove sites with ambiguity characters", - }, - "method": {"0": "simultaneous calculation of parameters", - "1": "one branch at a time calculation of parameters", - }, - } - - self.mExecutable = "codeml" - - self.mFilenameTree = None - self.mFilenameSequences = None - - def GetOptions(self): - """return options in pretty format""" - result = ["# Options for CodeML"] - for var in list(self.mOptions.keys()): - result.append("# %-40s: %s" % (var, self.mOptions[var])) - return string.join(result, "\n") - - # ------------------------------------------------------------------------ - def SetOption(self, option, value): - self.mDefaults[option] = value - - # ------------------------------------------------------------------------ - def AddOptions(self, parser): - """add options to an OptionParser object.""" - parser.add_option("--paml-set-alpha", dest="paml_alpha", type="float", - help="initial alpha value [default=%default].") - - parser.add_option("--paml-fix-alpha", dest="paml_fix_alpha", action="store_true", - help="do not estimate alpha [default=%default].") - - parser.add_option("--paml-set-kappa", dest="paml_kappa", type="float", - help="initial kappa value [default=%default].") - - parser.add_option("--paml-fix-kappa", dest="paml_fix_kappa", action="store_true", - help="do not estimate kappa [default=%default].") - - parser.add_option("--paml-set-clean-data", dest="paml_clean_data", type="choice", - choices=("0", "1"), - help="PAML should cleanup data: 0=only gaps within pair are removed, 1=columns in the mali with gaps are removed [default=%default].") - - parser.set_defaults( - paml_kappa=None, - paml_fix_kappa=False, - paml_alpha=None, - paml_fix_alpha=False, - paml_clean_data=None) - - # ------------------------------------------------------------------------ - def SetOptions(self, options): - """set options from the command line.""" - - if options.paml_kappa is not None: - self.SetOption("kappa", str(options.paml_kappa)) - - if options.paml_fix_kappa: - self.SetOption("fix_kappa", "1") - - if options.paml_alpha is not None: - self.SetOption("alpha", str(options.paml_alpha)) - - if options.paml_fix_alpha: - self.SetOption("fix_alpha", "1") - - if options.paml_clean_data: - self.SetOption("cleandata", options.paml_clean_data) - - # ------------------------------------------------------------------------ - def WriteAlignment(self, mali): - """write alignment in Phylip format.""" - - outfile = open(self.mTempdir + "/" + self.mFilenameSequences, "w") - - mali.writeToFile(outfile, format="phylip") - - outfile.close() - - # ------------------------------------------------------------------------ - def WriteTree(self, tree): - """write tree to file. The root of the tree is removed. - """ - - TreeTools.Unroot(tree) - - outfile = open(self.mTempdir + "/" + self.mFilenameTree, "w") - outfile.write("%s\n" % TreeTools.Tree2Newick(tree)) - outfile.close() - - # ------------------------------------------------------------------------ - def writeControlFile(self, - outfile, - filename_sequences="input", - filename_output="output", - filename_tree=None, - options={}, - ): - """write a codeml.ctl file into outfile. - """ - - outfile.write("seqfile = %s\n" % (filename_sequences)) - - if filename_tree: - outfile.write("treefile = %s\n" % (filename_tree)) - - outfile.write("outfile = %s\n\n" % (filename_output)) - - written_options = {} - - # write set options - for key, vv in list(options.items()): - - if key not in self.mOptions: - raise IndexError("illegal option %s" % key) - - values = vv.strip().split(" ") - - descriptions = [] - for value in values: - if value in self.mOptions[key]: - descriptions.append(self.mOptions[key][value]) - elif "#" in self.mOptions[key]: - try: - v = float(value) - except ValueError: - raise ValueError("not a number: %s for option %s" % - (value, key)) - descriptions.append(self.mOptions[key]["#"]) - else: - raise ValueError( - "illegal value %s for option %s: possible values are: %s" % - (value, key, " ".join(list(self.mOptions[key].keys())))) - - written_options[key] = 1 - description = ";".join(descriptions) - outfile.write("* %s\n %s = %s\n\n" % (description, key, vv)) - - # write default options - for key, vv in list(self.mDefaults.items()): - - if key in written_options: - continue - - if key not in self.mOptions: - raise IndexError("illegal option %s" % key) - - values = vv.strip().split(" ") - - descriptions = [] - for value in values: - if value in self.mOptions[key]: - descriptions.append(self.mOptions[key][value]) - elif "#" in self.mOptions[key]: - try: - v = float(value) - except ValueError: - raise ValueError( - "not a number: %s for option %s" % - (value, key)) - descriptions.append(self.mOptions[key]["#"]) - else: - raise ValueError( - "illegal value %s for option %s: possible values are: %s" % - (value, key, " ".join(list(self.mOptions[key].keys())))) - - written_options[key] = 1 - description = ";".join(descriptions) - outfile.write("* %s\n %s = %s\n\n" % (description, key, vv)) - - # ------------------------------------------------------------------------ - def Run(self, alignment, - tree=None, - dump=0, - test=False, - options={}): - - self.mTempdir = tempfile.mkdtemp() - self.mFilenameSequences = "input" - self.mWarnings = [] - - self.mFilenameOutput = "output" - - if test: - print("# temporary directory is %s" % self.mTempdir) - - if tree: - - # check what kind of tree is given. - if type(tree) == StringType: - t = tree.strip() - if t[0] == "(" and t[-1] in ");": - nexus = TreeTools.Newick2Nexus(tree) - else: - nexus = TreeTools.Newick2Nexus(open(tree, "r")) - t = nexus.trees[0] - else: - t = tree - - # check if identifiers in tree and alignment are the same - identifiers_mali = set(alignment.getIdentifiers()) - identifiers_tree = set(TreeTools.GetTaxa(t)) - - not_in_tree = identifiers_mali.difference(identifiers_tree) - - for x in not_in_tree: - self.mWarnings.append( - "sequence %s not in tree - removed from multiple alignment." % x) - alignment.deleteEntry(x) - - self.mFilenameTree = "tree" - self.WriteTree(t) - else: - self.mFilenameTree = None - - self.mNumSequences = len(alignment) - self.WriteAlignment(alignment) - self.mRunOptions = options - - self.writeControlFile(open(self.mTempdir + "/" + self.mFilenameControl, "w"), - filename_tree=self.mFilenameTree, - options=options) - - s = subprocess.Popen("%s" % (self.mExecutable), - shell=True, - stdout=subprocess.PIPE, - stderr=subprocess.PIPE, - cwd=self.mTempdir, - close_fds=True) - - (out, err) = s.communicate() - - if s.returncode != 0: - raise UsageError("Error in running %s \n%s\n%s\nTemporary directory in %s" % - (self.mExecutable, err, out, self.mTempdir)) - - lines = open("%s/%s" % - (self.mTempdir, self.mFilenameOutput), "r").readlines() - - try: - rst_lines = open("%s/rst", "r").readlines() - except IOError: - rst_lines = None - - if len(lines) == 0: - raise UsageError("Empty result from %s \n%s\n%s\nTemporary directory in %s" % - (self.mExecutable, err, out, self.mTempdir)) - - if dump: - print( - "############################### CONTROL FILE ############################") - print("".join(open(self.mTempdir + "/" + - self.mFilenameControl, "r").readlines())) - print("# result output of %s:\n%s\n######################################" % ( - self.mExecutable, "".join(lines))) - print( - "############################### LOG OUTPUT ############################") - print("# stdout output of %s:\n%s\n######################################" % ( - self.mExecutable, out)) - - if not test: - shutil.rmtree(self.mTempdir) - - return self.parseOutput(lines, out.split("\n"), rst_lines) - - def parseRst(self, inlines, result): - """parse lines from rst file.""" - - lines = self.getSection( - inlines, "List of extant and reconstructed sequences") - - # for PAML 4 use :4 instead of :2 - del lines[:4] - - # for aborted runs or ancestral reconstruction not performed: return - # empty - if len(lines) == 0: - return - - result.mAncestralSequences = {} - ancestral_sequences = [] - - while lines[0] != "\n": - id, sequence = lines[0][:18], lines[0][18:-1] - id = id.strip() - sequence = re.sub("\s", "", sequence) - - del lines[0] - # do not save terminal sequences - if id not in result.mSequences: - if id[:6] != "node #": - raise ParsingError( - "expected ancestral node names to start with 'node #', instead got %s" % id) - else: - id = id[6:] - ancestral_sequences.append((id, sequence)) - else: - result.mAncestralSequences[ - id] = CodeMLAncestralSequence(sequence, 1.0, 1.0) - - while lines and lines[0] == "\n": - del lines[0] - - if not re.match("Overall accuracy", lines[0]): - raise ParsingError( - "expected 'Overall accuracy', instead got %s" % lines[0]) - - del lines[0] - accuracy_per_site = list( - map(float, re.split("\s+", lines[0][:-1].strip()))) - del lines[:3] - accuracy_per_sequence = list(map( - float, re.split("\s+", lines[0][:-1].strip()))) - - for x in range(len(ancestral_sequences)): - id, sequence = ancestral_sequences[x] - result.mAncestralSequences[id] = CodeMLAncestralSequence( - sequence, - accuracy_per_site[x], - accuracy_per_sequence[x]) - - result.mAncestralTree = TreeTools.Graph2Tree( - [(x.mBranch1, x.mBranch2, 1.0) for x in result.mBranchInfo], - label_ancestral_nodes=True) - - def parseSequences(self, lines, result): - - # read sequences - # start from the top and read until line start not with - # "seed used" - while len(lines) and (lines[0] == "" or lines[0] == " " or lines[0].startswith("seed used")): - del lines[0] - - self.mNumSequences, nchar = re.match( - "(\d+)\s+(\d+)", lines[0]).groups() - del lines[0] - del lines[0] - result.mSequences = {} - self.mMapIdentifier2Position = {} - self.mMapPosition2Identifier = [] - while lines[0]: - try: - identifier, sequence = re.match( - "(\S+)\s+(.+)", lines[0]).groups() - except AttributeError: - raise ParsingError("parsing error", lines[0]) - - result.mSequences[identifier] = sequence - self.mMapIdentifier2Position[identifier] = len( - self.mMapIdentifier2Position) - self.mMapPosition2Identifier.append(identifier) - del lines[0] - - def parseVersion(self, lines, result): - - lines = self.getSection(lines, "CODONML", "BASEML") - - # read version information - if lines[0].startswith("CODONML"): - x = re.search( - "CODONML \(in (.+)\)\s+\S+\s+Model:\s+(\S.+)", lines[0].strip()) - if x: - result.mVersion, result.mModel = x.groups() - del lines[0] - - else: - # paml version 4.4c - x = re.search("CODONML \(in (.+)\)\s+input", lines[0].strip()) - if x: - result.mVersion = x.groups()[0] - del lines[0] - try: - result.mModel = re.search( - "Model: (.*)$", lines[0].strip()).groups()[0] - except AttributeError: - raise ParsingError("pattern error", lines[0]) - else: - raise ParsingError("pattern error", lines[0]) - del lines[0] - - # read codon information - try: - result.mFrequencies = re.match( - "Codon frequenc.*: (\S+)", lines[0]).groups()[0] - del lines[0] - except AttributeError: - pass - - # read sequence info - try: - result.mNumSequences, result.mLength = list(map( - int, re.match("ns\s*=\s+(\d+)\s+ls\s*=\s*(\d+)", lines[0]).groups())) - del lines[0] - except AttributeError: - raise ParsingError( - "parsing error: expected ns = 123 ls = 123", lines[0]) - - elif lines[0].startswith("BASEML"): - try: - result.mVersion, result.mModel = re.search( - "BASEML \(in (.+)\)\s+\S+\s+(\S.+)", lines[0].strip()).groups() - del lines[0] - except AttributeError: - raise ParsingError("pattern error", lines[0]) - else: - raise ParsingError("unknown PAML program", lines[0]) - - known_versions = ("paml 3.14b, May 2005", - "paml 3.15, November 2005", - "paml version 4, June 2007", - "paml version 4.4c, August 2010", - "paml version 4.8a, August 2014") - - if result.mVersion not in known_versions: - raise ValueError("unknown paml version '%s'" % result.mVersion) - - def parseSitePatterns(self, inlines, result): - # read site patterns - # todo: reading of site patterns - - lines = self.getSection(inlines, "Printing out site pattern counts") - del lines[0] - self.nextSection(lines) - - del lines[0] - # result.mNumSitePatterns = int( re.match("# site patterns = (\d+)", - # lines[0]).group(1) ) - result.mNumSitePatterns = 0 - del lines[0] - - def parseSequenceDifferences(self, lines, result): - pass - - def parseCodonUsage(self, inlines, result): - - lines = self.getSection(inlines, "Codon usage in sequences") - - def checkSection(self, lines, section_start): - """check if section starts with string section_start.""" - - if not lines: - raise ParsingError("section error - ran out of lines") - - if not lines[0].startswith(section_start): - raise ParsingError("section error - expected '%s'" % section_start, - "\n".join(lines[:3])) - - def getSection(self, lines, *args): - """check if section starts with string section_start.""" - - for x in range(len(lines)): - for a in args: - if lines[x].startswith(a): - return lines[x:] - else: - raise ParsingError( - "section error - can't find section starting with '%s'" % - str(args)) - - def parseNeiGojobori(self, inlines, result): - - lines = self.getSection(inlines, - "Nei & Gojobori 1986. dN/dS (dN, dS)") - - def parseResultsKaks(self, inlines, result): - - lines = self.getSection(inlines, "TREE") - del lines[0] - - if re.match("check convergence..", lines[0]): - del lines[0] - result.mCheckConvergence = True - else: - result.mCheckConvergence = False - - if re.match("This is a rooted tree.", lines[0]): - result.mCheckRootedTree = False - del lines[0] - self.nextSection(lines) - else: - result.mCheckRootedTree = True - - try: - a, b, c = re.match( - "lnL\(ntime:\s*(\d+)\s*np:\s*(\d+)\):\s*(\S+)\s+\S+", lines[0]).groups() - except AttributeError: - raise ParsingError("parsing error", lines[0]) - - result.mNTime, result.mNumParameters, result.mLogLikelihood = int( - a), int(b), float(c) - del lines[0] - - ################################################################# - while not lines[0] == "Detailed output identifying parameters": - del lines[0] - del lines[0] - while not lines[0]: - del lines[0] - - ################################################################# - if re.match("kappa", lines[0]): - result.mKappa = float( - re.match("kappa \(ts/tv\)\s*=\s*(\S+)", lines[0]).groups()[0]) - del lines[0] - self.nextSection(lines) - - if re.match("Parameters in beta", lines[0]): - del lines[0] - result.mBeta = {} - while lines[0]: - - data = re.split("[\s=]+", re.sub("[()]", "", lines[0])) - del lines[0] - for k, val in [(data[x], data[x + 1]) for x in range(0, len(data), 2)]: - result.mBeta[k] = float(val) - - self.nextSection(lines) - ################################################################# - if re.match("dN/dS for site classes", lines[0]): - result.mSiteClassesNumSites = re.search( - "dN/dS for site classes \(K=(\d+)\)", lines[0]).groups()[0] - self.skipSection(lines) - - # note: spaces might be missing, because it seems to a fixed with format. - # This is ok for probabilities (allways less than 1) but a problem for - # w, if it gets larger than 100. Field width seems to be 9. - self.mSiteClassesProbabilities = list(map( - float, re.split("\s+", lines[0])[1:])) - del lines[0] - - ncats = len(self.mSiteClassesProbabilities) - s = lines[0][3:] - self.mSiteClassesOmega = [float(s[x:x + 9]) - for x in range(0, len(s), 9)] - - del lines[0] - self.nextSection(lines) - - ################################################################# - if lines[0][:len("omega (dN/dS)")] == "omega (dN/dS)": - result.mOmega = float( - re.match("omega \(dN/dS\)\s+=\s+(\S+)", lines[0]).groups()[0]) - self.skipSection(lines) - - if lines[0] != "dN & dS for each branch": - raise ParsingError("section error", lines[0]) - del lines[0] - while not lines[0]: - del lines[0] - del lines[0] - del lines[0] - - result.mBranchInfo = [] - - while lines[0]: - - branch, t, S, N, dnds, dn, ds, sds, ndn = re.split("\s+", lines[0]) - - # start counting from 0, correct below to for ancestral nodes - # to use PAML 1-based numbering. - a, b = [int(x) - 1 for x in branch.split("..")] - - if a < result.mNumSequences: - branch1 = self.mMapPosition2Identifier[a] - else: - branch1 = str(a + 1) - - if b < result.mNumSequences: - branch2 = self.mMapPosition2Identifier[b] - else: - branch2 = str(b + 1) - - result.mBranchInfo.append( - CodeMLBranchInfo(branch1, branch2, - float(dnds), float(dn), float(ds), - float(ndn), float(sds), - int(float(S)), int(float(N)))) - del lines[0] - - result.buildTreesFromBranchInfo() - - while not lines[0]: - del lines[0] - - ################################################################# - # the following is optional (only when site specific model = 0) - if re.match("tree length for dN", lines[0]): - result.mTreeLengthKa = float( - re.match("tree length for dN:\s+(\S+)", lines[0]).groups()[0]) - del lines[0] - result.mTreeLengthKs = float( - re.match("tree length for dS:\s+(\S+)", lines[0]).groups()[0]) - del lines[0] - - ################################################################# - if result.mModel in ("free dN/dS Ratios for branches",): - while not lines[0]: - del lines[0] - del lines[0] - result.mPamlTreeKs = lines[0] - del lines[0] - del lines[0] - result.mPamlTreeKa = lines[0] - del lines[0] - - self.nextSection(lines) - - def nextSection(self, lines): - while len(lines) and not lines[0]: - del lines[0] - - def skipSection(self, lines): - - while len(lines) and lines[0]: - del lines[0] - while len(lines) and not lines[0]: - del lines[0] - - def saveSummary(self, result, lines, lines_log=None): - - # save summary - result.mResult = "".join(lines) - - if lines_log: - if lines_log[0] and lines_log[0][-1] == "\n": - lines_log = [x[:-1].strip() for x in lines_log] - result.mLog = "\n".join(lines_log) - self.parseLog(lines_log, result) - - def parseLog(self, lines_log, result): - """parse log output.""" - - rx = re.compile( - "\s+rN\s*=\s*(\S+)\s+rS\s*=\s*(\S+)\s+rN\*\s*=\s*(\S+)\s+rS\*\s*=\s*(\S+)\s+blength\s*=\s*(\S+)") - - result.mRn, result.mRs, result.mRn0, result.mRs0, result.mBranchLength = None, None, None, None, None - - for line in lines_log: - - x = rx.match(line) - if x: - result.mRn, result.mRs, result.mRn0, result.mRs0, result.mBranchLength = list(map( - float, x.groups())) - - def parseOutput(self, lines, lines_log=None, rst_lines=None): - """parse CodeML output. This is rather tricky, as paml output is as - freeformat as it can get. Also, there is a log file and an - output file. Proceed sequentially through file. - - """ - - result = CodeMLResult() - - self.saveSummary(result, lines, lines_log) - - # chop, strip and remove comments - lines = [x[:-1].strip() for x in lines] - - if len(lines) == 0: - raise ParsingError("empty input") - - # parse by sections - self.parseVersion(lines, result) - - self.parseSequences(lines, result) - - self.parseSitePatterns(lines, result) - - self.parseSequenceDifferences(lines, result) - - self.parseCodonUsage(lines, result) - - self.parseResultsKaks(lines, result) - - if rst_lines: - self.parseRst(rst_lines, result) - - return result - - -class CodeMLSites (CodeML): - - def __init__(self): - CodeML.__init__(self) - - def parseOutput(self, lines, lines_log=None, rst_lines=None): - """parse codeml output for site-specific analysis.""" - - result = CodeMLResult() - self.saveSummary(result, lines, lines_log) - - # chop and strip - lines = [x[:-1].strip() for x in [x for x in lines if x[0] != "#"]] - - self.parseSequences(lines, result) - - self.parseSitePatterns(lines, result) - - self.parseVersion(lines, result) - - self.parseSequenceDifferences(lines, result) - - self.parseCodonUsage(lines, result) - - self.parseNeiGojobori(lines, result) - - result.mSites = {} - - # todo: fix parser - while 1: - if not lines: - break - - if not re.match("Model", lines[0]): - raise ParsingError("section error", lines[0]) - - id, name = re.match("Model (\d+): (.+)", lines[0]).groups() - self.skipSection(lines) - - if id not in result.mSites: - result.mSites[id] = CodeMLResultSites( - num_sequences=result.mNumSequences, - model=result.mModel) - - r = result.mSites[id] - r.mSiteModelId, r.mSiteModelName = id, name - - # parse model info - self.parseResultsKaks(lines, r) - - self.parseSites(lines, r) - - if rst_lines: - self.parseRst(rst_lines, result) - - return result - - def parseSitesBayes(self, lines, result): - - if re.match("Naive Empirical Bayes \(NEB\) analysis", lines[0]): - naive = True - elif re.match("Bayes Empirical Bayes \(BEB\) analysis", lines[0]): - naive = False - else: - raise ParsingError("section error", lines[0]) - - del lines[0] - - if re.match("Time used:", lines[0]): - return - - if re.match("Bayes Empirical Bayes \(BEB\) analysis", lines[0]): - return - - del lines[:4] - while 1: - if not lines[0]: - break - - if naive: - residue, aa, p, w = re.match( - "(\d+)\s+(\S)\s+([0-9.]+)[*]{0,2}\s+([0-9.]+)", lines[0]).groups() - stderr = 0 - else: - residue, aa, p, w, stderr = re.match( - "(\d+)\s+(\S)\s+([0-9.]+)[*]{0,2}\s+([0-9.]+) \+\- ([0-9.]+)", lines[0]).groups() - del lines[0] - result.mPositiveSites.append( - CodeMLResultPositiveSite(int(residue), aa, float(p), - float(w), float(stderr))) - - self.nextSection(lines) - - def parseGrids(self, lines, result): - """parse grid information.""" - - if re.match("The grid", lines[0]): - del lines[:2] - - result.mGrid = {} - while lines[0]: - k, vals = lines[0].split(":") - data = re.split("\s+", vals.strip()) - result.mGrid[k.strip()] = list(map(float, data)) - del lines[0] - - self.nextSection(lines) - - if re.match("Posterior on the grid", lines[0]): - del lines[:2] - - result.mGridPosterior = {} - while lines[0]: - k, vals = lines[0].split(":") - data = re.split("\s+", vals.strip()) - result.mGridPosterior[k.strip()] = list(map(float, data)) - del lines[0] - - self.nextSection(lines) - - if re.match("Posterior for p0-p1", lines[0]): - del lines[:2] - - result.mPosteriorP0P1 = [] - while lines[0]: - result.mPosteriorP0P1.append(lines[0]) - del lines[0] - - del lines[0] - - result.PosteriorP0P1Sum = re.match( - "sum of density on p0-p1\s+=\s+([0-9.]+)", lines[0]).groups()[0] - del lines[0] - - self.nextSection(lines) - - def parseSites(self, lines, result): - """parse site specific model results.""" - - while 1: - - if not lines: - break - - if re.match("Time used:", lines[0]): - del lines[0] - break - - if re.match("Naive Empirical Bayes \(NEB\) analysis", lines[0]): - self.parseSitesBayes(lines, result.mNEB) - - elif re.match("Bayes Empirical Bayes \(BEB\) analysis", lines[0]): - self.parseSitesBayes(lines, result.mBEB) - - elif re.match("The grid", lines[0]): - self.parseGrids(lines, result) - - elif re.match("Note:", lines[0]): - result.mWarnings.append(lines[0]) - self.skipSection(lines) - - else: - raise ParsingError("section error", lines[0]) - - self.nextSection(lines) - - -class CodeMLPairwise (CodeML): - - def __init__(self): - CodeML.__init__(self) - - self.mDefaults["runmode"] = "-2" - - def parseLog(self, lines_log, result): - """parse log output. - - This routine collects the rho values for each pair. - """ - self.mRhos = [] - - rx = re.compile( - "\s+rN\s*=\s*(\S+)\s+rS\s*=\s*(\S+)\s+rN\*\s*=\s*(\S+)\s+rS\*\s*=\s*(\S+)\s+blength\s*=\s*(\S+)") - - for line in lines_log: - - x = rx.match(line) - if x: - self.mRhos.append(list(map(float, x.groups()))) - - def parseOutput(self, lines, lines_log=None, rst_lines=None): - """parse codeml output for pairwise rate calculation.""" - - result = CodeMLResultPairs() - - self.saveSummary(result, lines, lines_log) - - # chop and strip - lines = [x[:-1].strip() for x in [x for x in lines if x[0] != "#"]] - - self.parseVersion(lines, result) - - # skip over the next parts, we are not interested - while lines and lines[0][:19] != "pairwise comparison": - del lines[0] - - del lines[0] - - self.nextSection(lines) - - self.parsePairs(lines, result) - - return result - - def parsePairs(self, lines, result): - """parse pairwise results.""" - - while lines: - pair = CodeMLResultPair() - - n1, name1, n2, name2 = re.match( - "(\d+)\s*\((\S+)\)\s*\.\.\.\s*(\d+)\s*\((\S+)\)", lines[0]).groups() - del lines[0] - - pair.mName1, pair.mName2 = name1, name2 - - pair.mLogLikelihood = float( - re.match("lnL =\s*(\S+)", lines[0]).groups()[0]) - del lines[0] - - # the next values are tau, kappa and omega (this might - # change, if some of these are fixed?) - values = list(map(float, re.split("\s+", lines[0].strip()))) - del lines[0] - - if len(values) == 3: - pair.mTau, pair.mKappa, pair.mOmega = values - elif "fix_omega" in self.mRunOptions and self.mRunOptions["fix_omega"] == "1": - pair.mTau, pair.mKappa = values - pair.mOmega = "na" - elif "fix_kappa" in self.mRunOptions and self.mRunOptions["fix_kappa"] == "1": - pair.mTau, pair.mOmega = values - pair.mKappa = "na" - else: - raise ParsingError("can't parse omega and kappa", lines[0]) - - del lines[0] - - tokens = re.split("[\s=]+", lines[0].strip()) - pair.mTau, pair.mS, pair.mN, pair.mKaks, pair.mKa, pair.mKs = list(map( - float, [tokens[x] for x in range(1, len(tokens), 2)])) - del lines[0] - - if self.mRhos: - pair.mRn, pair.mRs, pair.mRn0, pair.mRs0, pair.mBranchLength = self.mRhos[ - len(result.mPairs)] - else: - pair.mRn, pair.mRs, pair.mRn0, pair.mRs0, pair.mBranchLength = None, None, None, None, None - - result.mPairs.append(pair) - - self.nextSection(lines) - - -class BaseML(CodeML): - - def __init__(self): - - CodeML.__init__(self) - - self.mFilenameControl = "baseml.ctl" - self.mDefaults = { - "noisy": "9", - "verbose": "0", - "runmode": "0", - "model": "4", - "Mgene": "0", - "clock": "0", - "fix_kappa": "0", - "kappa": "5", - "fix_alpha": "1", - "alpha": "0", - "Malpha": "0", - "ncatG": "5", - "nparK": "0", - "nhomo": "0", - "getSE": "0", - "RateAncestor": "0", - "Small_Diff": "7e-6", - "cleandata": "1", - "method": "0", - } - - self.mOptions = { - "nhomo": {"0": "homogeneous", - "1": "homogeneous", - "2": "kappa for branches", - "3": "N1", - "3": "N2", - }, - - "nparK": {"0": "no rate classes", - "1": "rate class model - rK", - "2": "rate class model - rK & fK", - "3": "rate class model - rK & MK(1/K)", - "4": "rate class model - rK & MK", - }, - - "noisy": {"0": "how much rubbish on screen", - "1": "how much rubbish on screen", - "2": "how much rubbish on screen", - "3": "how much rubbish on screen", - "9": "how much rubbish on screen" - }, - "verbose": {"0": "concise output", - "1": "detailed output", - "2": "too much output" - }, - "runmode": {"0": "user tree", - "1": "semi automatic", - "2": "automatic", - "3": "stepwise addition", - "4": "PerturbationNNI", - "5": "PerturbationNNI", - "-2": "pairwise" - }, - "seqtype": {"1": "Sequence type is codons", - "2": "Sequence type is AAs", - "3": "Sequence type is codons translated to AAs", - }, - "CodonFreq": {"0": "Uniform codon frequencies: 1/61 each", - "1": "Codon frequencies given by F1X4", - "2": "Codon frequencies given by F3X4", - "3": "Codon frequencies given by codon table", - }, - "ndata": {"#": "number of data sets to analyse", - }, - "clock": {"0": "no clock", - "1": "clock", - "2": "local clock", - "3": "Combined Analysis", - }, - "aaDist": {"0": "equal", - "+": "geometric", - "-": "linear", - "1": "G1974", - "2": "Miyata", - "3": "c", - "4": "p", - "5": "v", - "6": "a", - }, - "aaRatefile": {"jones.dat": "Jones", - "dayhoff.data": "Dayhoff", - "wag.dat": "Wag", - "mtmam.dat": "mtmam", - }, - "model": {"0": "JC69", - "1": "K80", - "2": "F81", - "3": "F84", - "4": "HKY85", - "5": "T92", - "6": "TN93", - "7": "REV", - "8": "UNREST", - "9": "REVu", - "10": "UNRESTu", - }, - - "NSsites": {"0": "no site-specific variation of omega", - "1": "neutral", - "2": "selection", - "3": "discrete", - "4": "freqs", - "5": "gamma", - "6": "2gamma", - "7": "beta", - "8": "beta&w", - "9": "beta&gamma", - "10": "beta&gamma+1", - "11": "beta&normal>1", - "12": "0&2normal>1", - "13": "3normal>0", - }, - "icode": {"0": "Genetic code: universal", - "1": "mammalian mt", - "2": "yeast mt.", - "3": "mold mt.", - "4": "invertebrate mt.", - "5": "ciliate nuclear", - "6": "echinoderm mt.", - "7": "euplotid mt.", - "8": "alternative yeast nu.", - "9": "ascidian mt.", - "10": "blepharisma nu."}, - "Mgene": {"0": "All rates equal between genes (if G option in sequence file: different, but proportional branch lengths)", - "1": "separate", - "2": "different pi", - "3": "different kappa", - "4": "all different", - }, - - "fix_kappa": {"0": "kappa is to be estimated", - "1": "kappa is fixed", - }, - "kappa": {"2": "default initial or fixed kappa value.", - "#": "fixed or initial kappa", - }, - "fix_omega": {"0": "omega is to be estimated", - "1": "omega is fixed", - }, - "omega": {"0.4": "default initial of fixed omega value", - "#": "initial or fixed omega", - }, - "fix_alpha": {"0": "alpha is to be estimated", - "1": "alpha is fixed", - }, - "alpha": {"0": "inifinity: fixed alpha", - "#": "discrete gamma model with shape parameter alpha" - }, - "fix_rho": {"0": "rho is to be estimated", - "1": "rho is fixed", - }, - - "fix_blength": {"0": "ignore branch lengths on given tree", - "-1": "use random branch lengths for given tree", - "1": "use branch lengths on given tree as initial values", - "2": "assume branch lengths on given tree to be fixed"}, - - "rho": {"0": "no correlation between sites", - "#": "initial or fixed rho." - }, - "Malpha": {"0": "same alpha for genes", - "1": "different alpha for genes", - }, - "ncatG": {"#": "number of categories for discrete gamma model in site-specific models", - }, - "getSE": {"0": "do not output standard errors of estimates", - "1": "output standard errors of estimates", - }, - "RateAncestor": {"0": "do not calculate ancestral states", - "1": "calculate ancestral states (only works with runmode 0)", - "2": "?"}, - "Small_Diff": {".5e-6": "default value for small difference", - "#": "small difference", - }, - "cleandata": {"0": "do not remove sites with ambiguity characters (default)", - "1": "remove sites with ambiguity characters", - }, - "method": {"0": "simultaneous calculation of parameters", - "1": "one branch at a time calculation of parameters", - }, - } - - self.mExecutable = "baseml" - - # ------------------------------------------------------------------------ - def AddOptions(self, parser): - """add options to an OptionParser object.""" - CodeML.AddOptions(self, parser) - - parser.add_option("--baseml-model", dest="baseml_model", type="choice", - choices=("T92", "JC69", "F84", - "K80", "F81", "HKY85", "TN93", "REV", "UNREST", "REVU", - "UNRESTU"), - help="baseml model [default=%default].") - - parser.set_defaults(baseml_model="REV") - - # ------------------------------------------------------------------------ - def SetOptions(self, options): - """set options from the command line.""" - CodeML.SetOptions(self, options) - - map_model2index = {} - for key, val in list(self.mOptions["model"].items()): - map_model2index[val] = key - - if options.baseml_model.upper() in map_model2index: - self.SetOption("model", map_model2index[options.baseml_model]) - else: - raise "unknown model for baseml: %s" % options.baseml_model - - def parseOutput(self, lines, lines_log=None, rst_lines=None): - """parse BASEML output. This is rather tricky, as paml output is as - freeformat as it can get. Also, there is a log file and an - output file. Proceed sequentially through file. - - """ - - result = BaseMLResult() - - self.saveSummary(result, lines, lines_log) - - # chop and strip - lines = [x[:-1].strip() for x in lines] - # lines = map(lambda x: x[:-1].strip(), filter( lambda x: x[0] != "#", - # lines )) - - result = BaseMLResult() - - self.parseVersion(lines, result) - - # self.parseSitePatterns( lines, result ) - - # self.parseSequenceDifferences( lines, result ) - - self.parseFrequencies(lines, result) - - self.parseTree(lines, result) - - self.parseParameters(lines, result) - - return result - - def parseFrequencies(self, inlines, result): - """parse frequency section.""" - - lines = self.getSection(inlines, "Frequencies..") - - del lines[0] - del lines[0] - result.mBaseFrequencies = {} - for x in range(self.mNumSequences): - data = re.split("\s+", lines[0]) - del lines[0] - f = {} - for n, y in enumerate(("T", "C", "A", "G")): - f[y] = data[n + 1] - - result.mBaseFrequencies[data[0]] = f - - self.nextSection(lines) - - if not re.match("Homogeneity statistic", lines[0]): - raise ParsingError( - "wrong section, expected 'Homogeneity statistic'", lines[0]) - - result.mX2, result.mG = list(map(float, re.search( - "Homogeneity statistic: X2 = (\S+) G = (\S+)", lines[0]).groups())) - del lines[0] - self.nextSection(lines) - - data = re.split("\s+", lines[0]) - del lines[0] - f = {} - for n, y in enumerate(("T", "C", "A", "G")): - f[y] = data[n + 1] - - result.mBaseFrequencies["average"] = f - - self.nextSection(lines) - - self.nextSection(lines) - - def parseTree(self, lines, result): - - lines = self.getSection(lines, "TREE") - del lines[0] - - try: - a, b, c = re.match( - "lnL\(ntime:\s*(\d+)\s*np:\s*(\d+)\):\s*(\S+)\s+\S+", lines[0]).groups() - except AttributeError: - raise ParsingError("parsing error", lines[0]) - - result.mNTime, result.mNumParameters, result.mLogLikelihood = int( - a), int(b), float(c) - del lines[0] - - while lines and not re.match("tree length", lines[0]): - del lines[0] - - result.mTreeLength = re.match( - "tree length\s+=\s+(\S+)", lines[0]).groups()[0] - del lines[0] - - self.nextSection(lines) - # skip over tree topology - self.skipSection(lines) - - # read rate tree - result.mTree = lines[0] - del lines[0] - - # convert tree to matrix - tree = TreeTools.Newick2Tree(result.mTree) - - result.mDistanceMatrix = {} - - nodes = tree.get_terminals() - for x in range(len(nodes) - 1): - - key1 = tree.node(nodes[x]).data.taxon - - if key1 not in result.mDistanceMatrix: - result.mDistanceMatrix[key1] = {} - - for y in range(x + 1, len(nodes)): - - key2 = tree.node(nodes[y]).data.taxon - if key2 not in result.mDistanceMatrix: - result.mDistanceMatrix[key2] = {} - - d = tree.distance(nodes[x], nodes[y]) - - result.mDistanceMatrix[key1][key2] = d - result.mDistanceMatrix[key2][key1] = d - - self.nextSection(lines) - - def parseParameters(self, inlines, result): - - try: - lines = self.getSection( - inlines, "Detailed output identifying parameters") - except ParsingError: - return - - # read parameters - del lines[0] - self.nextSection(lines) - - if re.match("Parameters \(kappa\)", lines[0]): - del lines[0] - result.mKappa = float(lines[0]) - del lines[0] - self.nextSection(lines) - else: - result.mKappa = "na" - - if not lines: - return - - if re.match("Parameters in the rate matrix", lines[0]): - while not lines[0].startswith("Rate parameters"): - del lines[0] - d = re.split( - "\s+", re.search("Rate parameters: +(.*)", lines[0]).groups()[0]) - result.mRevRateBaseParameters = list(map(float, d)) - del lines[0] - result.mRevBaseFrequencies = list(map( - float, re.split("\s+", re.search("Base frequencies: +(.*)", lines[0]).groups()[0]))) - del lines[0] - try: - result.mRevK = float( - re.match("Rate matrix Q, Average Ts/Tv =\s*(\S+)", lines[0]).groups()[0]) - except AttributeError: - raise ParsingError("could not parse average Ts/Tv", lines[0]) - result.mKappa = float(result.mRevK) - - del lines[0] - self.mRevQ = [] - for x in range(0, 4): - self.mRevQ.append(list(map(float, re.split("\s+", lines[0])))) - del lines[0] - self.nextSection(lines) - - if not len(lines): - return - - if re.match("check convergence..", lines[0]): - del lines[0] - result.mCheckConvergence = True - if len(lines) == 0: - return - - try: - result.mNumGammaBins, result.mAlpha = re.match( - "alpha \(gamma, K=(\d+)\)\s+=\s+(\S+)", lines[0]).groups() - except AttributeError: - raise ParsingError("could not parse alpha and gamma", lines[0]) - - result.mAlpha, result.mNumGammaBins = float( - result.mAlpha), int(result.mNumGammaBins) - del lines[0] - r = re.split("\s+", lines[0])[1:] - del lines[0] - f = re.split("\s+", lines[0])[1:] - result.mGammaBins = [] - for x in range(result.mNumGammaBins): - result.mGammaBins.append({"r": float(r[x]), "f": float(f[x])}) - - -class Evolver: - - """interface class for running evolver. - """ - - def __init__(self): - - self.mExecutable = "evolver" - random.seed() - x = random.randint(0, 10000001) - while x % 2 == 0: - x = random.randint(0, 10000001) - - self.mSeed = x - self.mReplicates = 1 - self.mNucleotides = 1000 - self.mNSequences = 2 - self.mTree = "(1:1,2:1);" - self.mScale = -1 - self.mOmega = 0.3 - self.mKappa = 2 - self.mCodonTable = None - self.mDs = 0.5 - - # runmode 6 = codons (5=na, 7=aa) - self.mRunMode = 6 - - # ------------------------------------------------------------------------ - def setOmega(self, omega): - self.mOmega = omega - - def setKappa(self, kappa): - self.mKappa = kappa - - def setLength(self, length): - self.mNucleotides = length - - def setDs(self, ds): - self.mDs = ds - - def setReplicates(self, replicates): - self.mReplicates = replicates - - # ------------------------------------------------------------------------ - def writeControlFile(self, outfile): - """write control file to outfile.""" - - self.calculateScale(self.mDs) - - if self.mCodonTable is None: - raise ValueError("please supply a codon table") - - self.mNSequences = len( - TreeTools.Newick2Nexus(self.mTree).trees[0].get_taxa()) - - outfile.write("0 * paml format output\n") - outfile.write("%i * random number seed\n" % self.mSeed) - outfile.write("%i %i %i * nsequences nnucleotides nreplicates\n\n" % - (self.mNSequences, - self.mNucleotides, - self.mReplicates)) - - outfile.write( - "%f * tree length (-1 = unscaled)\n" % self.mScale) - outfile.write(self.mTree + "\n\n") - outfile.write("%f * omega\n" % self.mOmega) - outfile.write("%f * kappa\n" % self.mKappa) - outfile.write("\n") - - for c1 in ("T", "C", "A", "G"): - for c2 in ("T", "C", "A", "G"): - for c3 in ("T", "C", "A", "G"): - codon = c1 + c2 + c3 - outfile.write(" %10.9f" % self.mCodonTable[codon]) - outfile.write("\n") - - outfile.write("// end of file\n") - - # ------------------------------------------------------------------------ - def fromMali(self, mali): - """compute codon table from a multiple alignment.""" - self.mCodonTable = {} - for c1 in ("T", "C", "A", "G"): - for c2 in ("T", "C", "A", "G"): - for c3 in ("T", "C", "A", "G"): - codon = c1 + c2 + c3 - self.mCodonTable[codon] = 0 - - for id, i in list(mali.items()): - s = i.mString - for x in range(0, len(s), 3): - codon = s[x:x + 3].upper() - try: - self.mCodonTable[codon] += 1 - except KeyError: - continue - - total = sum(self.mCodonTable.values()) - for codon in list(self.mCodonTable.keys()): - self.mCodonTable[codon] = float(self.mCodonTable[codon]) / total - - # ------------------------------------------------------------------------ - def setUniformFrequencies(self): - """use uniform codon frequencies.""" - self.mCodonTable = {} - - frequency = 1.0 / 61.0 - - for c1 in ("T", "C", "A", "G"): - for c2 in ("T", "C", "A", "G"): - for c3 in ("T", "C", "A", "G"): - codon = c1 + c2 + c3 - if Genomics.IsStopCodon(codon): - self.mCodonTable[codon] = 0.0 - else: - self.mCodonTable[codon] = frequency - - # ------------------------------------------------------------------------ - def calculateScale(self, ds): - """calculate tree scale for a given dS value. - - The branch scale is given by: - - t = 3 dS * ps + 3 omega * dS * (1-ps) - t = 3 dS * (ps + omega (1 - ps ) - """ - - if self.mCodonTable is None: - raise ValueError("please supply a codon table") - - # number of synonymous/non-synonymous sites - Q, t = RateEstimation.getQMatrix( - self.mCodonTable, self.mKappa, 1.0, self.mKappa, 1.0) - - rI, rV, rS, rN = RateEstimation.countSubstitutions(self.mCodonTable, Q) - - ps = rS / (rS + rN) - - self.mScale = 3.0 * self.mDs * (ps + self.mOmega * (1 - ps)) - - # ------------------------------------------------------------------------ - def setTree(self, tree): - """set tree.""" - self.mTree = tree - - # ------------------------------------------------------------------------ - def run(self, ds=None, tree=None, test=False, dump=False): - """run evolver.""" - - self.mTempdir = tempfile.mkdtemp() - - self.mWarnings = [] - - self.mFilenameOutput = "mc.paml" - - if test: - print("# temporary directory is %s" % self.mTempdir) - - if tree: - # check what kind of tree is given. - if type(tree) == StringType: - t = tree.strip() - if t[0] == "(" and t[-1] in ");": - self.mTree = t - else: - nexus = TreeTools.Newick2Nexus(open(tree, "r")) - self.mTree = nexus.trees[0].to_string() - - if ds: - self.mDs = ds - - self.mFilenameControl = "evolver.ctl" - self.writeControlFile( - open(self.mTempdir + "/" + self.mFilenameControl, "w")) - - if dump: - print("################### control file input ########") - infile = open(self.mTempdir + "/" + self.mFilenameControl, "r") - print("".join(infile.readlines())) - infile.close() - - s = subprocess.Popen("%s %i %s" % - (self.mExecutable, self.mRunMode, - self.mFilenameControl), - shell=True, - stdout=subprocess.PIPE, - stderr=subprocess.PIPE, - cwd=self.mTempdir, - close_fds=True) - - (out, err) = s.communicate() - - if s.returncode != 0: - raise UsageError( - "Error in running %s \n%s\n%s\nTemporary directory in %s" % - (self.mExecutable, err, out, self.mTempdir)) - - lines = open("%s/%s" % - (self.mTempdir, self.mFilenameOutput), "r").readlines() - - if len(lines) == 0: - raise UsageError( - "Empty result from %s \n%s\n%s\nTemporary directory in %s" % - (self.mExecutable, err, out, self.mTempdir)) - - if dump: - print("# result output of %s:\n%s\n######################################" % ( - self.mExecutable, "".join(lines))) - print( - "############################### LOG OUTPUT ############################") - print("# stdout output of %s:\n%s\n######################################" % ( - self.mExecutable, out)) - - if not test: - shutil.rmtree(self.mTempdir) - - return self.parseOutput(lines, out.split("\n")) - - def parseOutput(self, lines, lines_log=None, rst_lines=None): - - result = [] - chunk = [] - for line in lines: - line = line.strip() - if not line: - continue - if re.match("\d+", line): - if chunk: - mali = Mali.Mali() - mali.readFromFile(chunk, format="phylip") - result.append(mali) - chunk = [] - chunk.append(line + "\n") - - if chunk: - mali = Mali.Mali() - mali.readFromFile(chunk, format="phylip") - result.append(mali) - - return result - - def printFrequencies(self, outfile): - - if not self.mCodonTable: - outfile.write("# no frequency table defined\n") - else: - codons = list(self.mCodonTable.keys()) - outfile.write("# codon table used in evolver:\n") - for codon in codons: - outfile.write("# %s\t%6.4f\n" % - (codon, self.mCodonTable[codon])) - - -class EvolverBaseml(Evolver): - - """interface class for running evolver for nucleotides. - """ - - def __init__(self, *args, **kwargs): - - Evolver.__init__(self, *args, **kwargs) - - self.mFrequencies = None - - # runmode 5 = codons (5=na, 7=aa) - self.mRunMode = 5 - - self.mKappa = 2.0 - self.mModel = "K80" - self.mModels = {"JC69": 0, - "K80": 1, - "F81": 2, - "F84": 3, - "HKY85": 4, - "T92": 5, - "TN93": 6, - "REV": 7} - - # 0 is same rate over all sites - self.mAlpha = 0 - - # 0 is continuous gamma - self.mGammaCategories = 0 - - # ------------------------------------------------------------------------ - def setModel(self, model): - self.mModel = model.upper() - - # ------------------------------------------------------------------------ - def setUniformFrequencies(self): - self.mFrequencies = {} - for c in ("T", "C", "A", "G"): - self.mFrequencies[c] = 0.25 - - # ------------------------------------------------------------------------ - def fromMali(self, mali): - """compute frequencies from a multiple alignment.""" - self.mFrequencies = {} - for c in ("T", "C", "A", "G"): - self.mFrequencies[c] = 0 - - for id, i in list(mali.items()): - for c in i.mString: - try: - self.mFrequencies[c] += 1 - except KeyError: - continue - - total = sum(self.mFrequencies.values()) - for c in list(self.mFrequecies.keys()): - self.mFrequencies[c] = float(self.mFrequencies[c]) / total - - # ------------------------------------------------------------------------ - def getParameters(self): - """get parameters for a model. - - From the MCbase.dat: - Parameter kappa or rate parameters in the substituton model: - For TN93, two kappa values are required, while for REV, 5 values - (a,b,c,d,e) are required (see Yang 1994 for the definition of these - parameters). - The kappa parameter is defined differently under HKY85 (when k=1 means - no transition bias) and under F84 (when k=0 means no bias). - JC69 and F81 are considered species cases of HKY85, so use 1 for kappa - for those two models. Notation is from my two papers in JME in 1994. - """ - - if self.mModel in ("JC69", "F81"): - self.mKappa = 1.0 - - if self.mModel == "REV": - return (10, 5, 1, 2, 3) - - elif self.mModel == "TN93": - raise NotImplementedError("not implemented") - return (k1, k2) - - else: - return (self.mKappa,) - - # ------------------------------------------------------------------------ - def writeControlFile(self, outfile): - """write control file to outfile.""" - - if self.mModel in ("JC69", "K80"): - self.setUniformFrequencies() - - if self.mFrequencies is None: - raise ValueError("please supply nucleotide frequencies") - - self.mNSequences = len( - TreeTools.Newick2Nexus(self.mTree).trees[0].get_taxa()) - - outfile.write("0 * paml format output\n") - outfile.write("%i * random number seed\n" % self.mSeed) - outfile.write("%i %i %i * nsequences nnucleotides nreplicates\n\n" % - (self.mNSequences, - self.mNucleotides, - self.mReplicates)) - - outfile.write("%f * tree length (-1 = unscaled)\n" % self.mDs) - outfile.write(self.mTree + "\n\n") - outfile.write("%i * model: 0:JC69, 1:K80, 2:F81, 3:F84, 4:HKY85, 5:T92, 6:TN93, 7:REV\n" % - self.mModels[self.mModel]) - outfile.write("%s * kappa or rate parameters in model\n" % - " ".join(map(str, self.getParameters()))) - outfile.write("%f %i * <#categories for discrete gamma>\n" % - (self.mAlpha, self.mGammaCategories)) - outfile.write("\n") - - for c in ("T", "C", "A", "G"): - outfile.write(" %10.9f" % self.mFrequencies[c]) - outfile.write("\n") - for c in ("T", "C", "A", "G"): - outfile.write(" %s" % c) - outfile.write("\n") - - outfile.write("// end of file\n") - - def printFrequencies(self, outfile): - - if not self.mFrequencies: - outfile.write("# no frequency table defined\n") - else: - outfile.write("# frequency table used in evolver:\n") - for c in list(evolver.mFrequencies.keys()): - outfile.write("# %s\t%6.4f\n" % (c, evolver.mFrequencies[c])) - - -def getOptions(options): - """translate command line options to PAML options.""" - - codeml_options = {} - - if options.analysis == "branch-specific-kaks": - codeml_options["seqtype"] = "1" - codeml_options["model"] = "1" - - elif options.analysis == "branch-fixed-kaks": - codeml_options["seqtype"] = "1" - codeml_options["model"] = "0" - - elif options.analysis == "branch-all-but-one-fixed-kaks": - codeml_options["seqtype"] = "1" - codeml_options["model"] = "2" - if not tree: - raise ValueError("please supply a tree for this mode.") - if not options.filename_output_tree: - raise ValueError( - "please speficy filename-output-tree as location " - "(relative to this script) for trees.") - - elif options.analysis == "site-specific-kaks": - codeml_options["ncatG"] = "10" - codeml_options["getSE"] = "1" - codeml_options["seqtype"] = "1" - codeml_options["NSsites"] = "0 3 1 2 7 8" - codeml_options["model"] = "0" - codeml_options["CodonFreq"] = "2" - - elif options.analysis == "pairwise": - codeml_options["seqtype"] = "1" - codeml_options["model"] = "0" - codeml_options["runmode"] = "-2" - - if options.multiple_genes: - codeml_options["Malpha"] = "0" - codeml_options["Mgene"] = "0" - - if options.omega is not None: - codeml_options["omega"] = str(options.omega) - - if options.estimate_ancestors: - codeml_options["RateAncestor"] = "1" - - if options.codon_frequencies is not None: - c = options.codon_frequencies.upper() - if c in ("UNIFORM", "FEQUAL"): - a = "0" - elif c == "F1X4": - a = "1" - elif c == "F3X4": - a = "2" - elif c == "F61": - a = "3" - else: - a = options.codon_frequencies - codeml_options["CodonFreq"] = a - if options.method is not None: - codeml_options["method"] = str(options.method) - - if options.optimization_threshold is not None: - codeml_options["Small_Diff"] = str(options.optimization_threshold) - - if options.clean_data: - codeml_options["cleandata"] = options.clean_data - - return codeml_options - - -def runEvolver(options): - """run evolver.""" - - if options.evolver_model == "codon": - evolver = Evolver() - if options.omega: - evolver.setOmega(options.omega) - else: - evolver = EvolverBaseml() - evolver.setModel(options.evolver_model) - - if options.kappa: - evolver.setKappa(options.kappa) - - if options.evolver_tree: - evolver.setTree(options.evolver_tree) - - if options.evolver_length: - evolver.setLength(options.evolver_length) - - if options.evolver_ds: - evolver.setDs(options.evolver_ds) - - if options.evolver_replicates: - evolver.setReplicates(options.evolver_replicates) - - if options.filename_sequences != "input": - mali = Mali.Mali() - if options.loglevel >= 1: - options.stdlog.write( - "# reading multiple alignment from %s\n" % (options.filename_sequences)) - options.stdlog.flush() - mali.readFromFile(open(options.filename_sequences, "r"), - format="fasta") - if options.loglevel >= 1: - options.stdlog.write("# calculating frequency table\n") - options.stdlog.flush() - - evolver.fromMali(mali) - - if options.loglevel >= 2: - evolver.printFrequencies(options.stdlog) - else: - if options.loglevel >= 1: - options.stdlog.write("# using uniform codon frequencies.\n") - - evolver.setUniformFrequencies() - - if options.write_control_file: - evolver.writeControlFile(sys.stdout) - return - - result = evolver.run( - test=options.test, - dump=options.dump) - - for r in result: - if options.evolver_pairwise: - ids = r.getIdentifiers() - for x in range(0, len(ids)): - for y in range(0, x): - options.stdout.write(">%s\n%s\n>%s\n%s\n" % - (ids[x], - r.getSequence(ids[x]), - ids[y], - r.getSequence(ids[y]))) - else: - r.writeToFile(options.stdout, format="fasta") - - if options.loglevel >= 2: - options.stdlog.write("# Parameters used for evolver\n") - options.stdlog.write("# dS=%f t=%f kappa=%f omega=%f\n" % - (evolver.mDs, - evolver.mScale, - evolver.mKappa, - evolver.mOmega)) - options.stdlog.write("# tree: %s\n" % evolver.mTree) - -if __name__ == "__main__": - - parser = E.OptionParser( - version="%prog version: $Id$") - - parser.add_option( - "--write-control-file", dest="write_control_file", action="store_true", - help="write a control file.") - - parser.add_option( - "--flavour", dest="flavour", type="choice", - choices=("codeml", "baseml", "evolver"), - help="codeml or baseml or evolver, that is the question.") - - parser.add_option( - "--analysis", dest="analysis", type="choice", - choices=("branch-specific-kaks", "branch-fixed-kaks", - "branch-all-but-one-fixed-kaks", "site-specific-kaks", - "pairwise"), - help="choose an analysis scenario.") - - parser.add_option( - "--multiple-genes", dest="multiple_genes", action="store_true", - help="analyse multiple genes.") - parser.add_option( - "-t", "--tree-nh-file", dest="filename_tree", type="string", - help="filename with tree information. Evolver: tree and number of sequences.") - parser.add_option( - "-i", "--filename-sequences", dest="filename_sequences", type="string", - help="filename with sequences. Evolver: determines codon frequencies.") - parser.add_option( - "-o", "--filename-output", dest="filename_output", type="string", - help="filename for output information.") - parser.add_option( - "--filename-clusters", dest="filename_clusters", type="string", - help="filename for cluster information.") - parser.add_option( - "--filename-output-tree", dest="filename_output_tree", type="string", - help="filename pattern for trees to be output.") - parser.add_option( - "-l", "--filename-log", dest="filename_log", type="string", - help="filename for logging information.") - parser.add_option( - "--filename-pattern-control", dest="filename_pattern_control", - type="string", - help="filename with pattern for control files to create.") - parser.add_option( - "--output-pattern-id", dest="output_pattern_id", type="string", - help="output pattern for id.") - parser.add_option( - "-p", "--parse-output", dest="parse_output", type="choice", - choices=("none", "all", "terminal-nodes", "likelihood", - "ancestral-sequence", - "ks-tree", "ka-tree", "kaks-tree", "sds-tree", - "ndn-tree", "s-tree", "n-tree", - "mali", "sequences"), - help="parse output") - parser.add_option( - "-b", "--parse-batch", dest="parse_batch", type="string", - help="""supply a batch file for output parsing. The batch " - "file contains the following (tab-separated): " - "1. name, 2. output-filename, 3. logfile-filename, " - "4. rst-filename, 5. mali filename(fasta) (all options " - "after the second are optional and can be empty.)""") - - parser.add_option( - "--parse-tabular", dest="parse_tabular", action="store_true", - help="""output parsing results in tabular format (default = fasta-like format).""") - parser.add_option( - "--filename-rst", dest="filename_rst", type="string", - help="filename with ancestral data. Needed for parsing ancestral sequences.") - parser.add_option("--set-omega", dest="omega", type="float", - help="initial omega value. Evolver: omega values used for simulation.") - parser.add_option("--set-kappa", dest="kappa", type="float", - help="initial kappa value. Evolver: kappa values used for simulation.") - parser.add_option("--set-codon-frequencies", dest="codon_frequencies", type="string", - help="set codon frequencies.") - parser.add_option("--set-method", dest="method", type="int", - help="set paml optimization method [0|1].") - parser.add_option("--set-optimization-threshold", dest="optimization_threshold", type="string", - help="set paml optimization threshold.") - parser.add_option("--estimate-ancestors", dest="estimate_ancestors", action="store_true", - help="estimat ancestral sequences.") - parser.add_option("--filename-read-tree", dest="input_filename_tree", type="string", - help="filename with tree information to read (synonym for input-filename-tree).") - parser.add_option("--input-filename-tree", dest="input_filename_tree", type="string", - help="filename with tree information.") - parser.add_option("--test", dest="test", action="store_true", - help="run a test.") - parser.add_option("--dump", dest="dump", action="store_true", - help="dump output.") - parser.add_option("--set-clean-data", dest="clean_data", type="choice", - choices=("0", "1"), - help="PAML should cleanup data: 0=only gaps within pair are removed, 1=columns in the mali with gaps are removed.") - - parser.add_option("--filter-output", dest="filter_output", type="choice", action="append", - choices=("ndn", "sds"), - help="filter output. Give values as options to --filter_parameters.") - - parser.add_option("--filter-parameters", dest="filter_parameters", type="string", - help="comma-separated list of filter values.") - - parser.add_option("--evolver-length", dest="evolver_length", type="int", - help="evolver: number of nucleotides/amino acids/codons to simulate.") - - parser.add_option("--evolver-replicates", dest="evolver_replicates", type="int", - help="evolver: number of replicates to simulate.") - - parser.add_option("--evolver-model", dest="evolver_model", type="choice", - choices=( - "T92", "JC69", "F84", "K80", "F81", "HKY85", "TN93", "REV", "codon"), - help="model for evolver[default=%default].") - - parser.add_option("--evolver-ds", dest="evolver_ds", type="float", - help="evolver: ds to use to scale tree.") - - parser.add_option("--evolver-tree", dest="evolver_tree", type="string", - help="Evolver: tree to use. Determines the number of sequences. Default are two sequences.") - - parser.add_option("--filename-mali", dest="filename_mali", type="string", - help="Filename with mali in fasta format. Used for special purpose: map species names back to genes for 1:1 ortholog cluster.") - - parser.add_option("--map-tsv-file", dest="filename_map_old2new", type="string", - help="Filename with map of identifiers mapping from old to new identifiers.") - - parser.add_option("--invert-map", dest="invert_map", action="store_true", - help="invert the mapping, so that old2new is read from new2old [%default].") - - parser.add_option("--evolver-pairwise", dest="evolver_pairwise", action="store_true", - help="output results from evolver simulation as all-on-all sequence pairs [%default].") - - parser.set_defaults( - write_control_file=False, - analysis=None, - filename_tree=None, - filename_output="output", - filename_output_tree=None, - filename_sequences="input", - filename_pattern_control="-", - filename_clusters=None, - filename_log=None, - filename_rst=None, - filename_mali=None, - filename_map_old2new=None, - multiple_genes=False, - parse_output=None, - omega=None, - kappa=None, - codon_frequencies=None, - method=None, - optimization_threshold=None, - output_pattern_id="%s", - input_filename_tree=None, - test=False, - dump=False, - flavour="codeml", - clean_data=None, - filter_output=None, - filter_parameters=None, - evolver_tree=None, - evolver_length=None, - evolver_ds=None, - evolver_model="codon", - estimate_ancestors=False, - parse_batch=None, - parse_tabular=False, - separator="|", - invert_map=False, - evolver_pairwise=False, - ) - - (options, args) = experiment.Start(parser) - - if options.filter_parameters is not None: - options.filter_parameters = options.filter_parameters.split(",") - options.filter_parameters.reverse() - - if options.flavour == "codeml": - if options.analysis in ("branch-specific-kaks", "branch-fixed-kaks", - "branch-all-but-one-fixed-kaks", - "pairwise"): - codeml = CodeML() - - elif options.analysis == "site-specific-kaks": - codeml = CodeMLSites() - - else: - raise ValueError("unknown analysis scenario %s" % options.analysis) - elif options.flavour == "baseml": - if 1: - codeml = BaseML() - else: - raise ValueError("unknown analysis scenario %s" % options.analysis) - elif options.flavour == "evolver": - - runEvolver(options) - experiment.Stop() - sys.exit(0) - - else: - raise ValueError("unknown flavour %s" % options.flavour) - - if options.input_filename_tree: - nexus = TreeTools.Newick2Nexus(open(options.input_filename_tree, "r")) - Tree.updateNexus(nexus) - tree = nexus.trees[0] - else: - tree = None - - ########################################################################## - ########################################################################## - ########################################################################## - # build options - ########################################################################## - codeml_options = getOptions(options) - - ########################################################################## - ########################################################################## - ########################################################################## - # write control file(s) - ########################################################################## - if options.write_control_file: - - if options.filename_clusters: - clusters, nerrors = iotools.ReadList( - open(options.filename_clusters, "r")) - else: - clusters = ("", ) - - nwritten = 0 - - for cluster in clusters: - - id = options.output_pattern_id % cluster - fn_sequences = re.sub("%s", id, options.filename_sequences) - fn_output = re.sub("%s", id, options.filename_output) - if options.filename_tree: - fn_tree = re.sub("%s", id, options.filename_tree) - else: - fn_tree = None - - fn_ctl = re.sub("%s", id, options.filename_pattern_control) - - if options.analysis == "branch-all-but-one-fixed-kaks": - - branch = 0 - # setup branch specific models. - # You need to create a new tree for each one - for node_id, node in list(tree.chain.items()): - if node.prev is None: - continue - - branch += 1 - - fn_branch_ctl = fn_ctl % branch - fn_branch_tree = fn_tree % branch - fn_branch_out = fn_output % branch - - old_name = node.data.taxon - - if node.succ == []: - node.data.taxon += " # 1 " - else: - node.data.taxon = " $ 1 " - - outfile = open(options.filename_output_tree % branch, "w") - outfile.write(TreeTools.Tree2Newick( - tree, with_branch_lengths=False, write_all_taxa=True) + "\n") - outfile.close() - - outfile = open(fn_branch_ctl, "w") - - codeml.writeControlFile(outfile, - filename_sequences=fn_sequences, - filename_output=fn_branch_out, - filename_tree=fn_branch_tree, - options=codeml_options) - outfile.close() - - node.data.taxon = old_name - nwritten += 1 - else: - - if fn_ctl == "-": - outfile = options.stdout - else: - outfile = open(fn_ctl, "w") - - codeml.writeControlFile(outfile, - filename_sequences=fn_sequences, - filename_output=fn_output, - filename_tree=fn_tree, - options=codeml_options) - - if outfile != options.stdout: - outfile.close() - - nwritten += 1 - - if options.loglevel >= 1: - options.stdout.write("# written %i control files.\n" % nwritten) - - ########################################################################## - ########################################################################## - ########################################################################## - # parse output - ########################################################################## - elif options.parse_output: - - filters = [] - if options.filter_output: - for f in options.filter_output: - if f == "sds": - p = options.filter_parameters.pop() - filters.append(lambda x: x.mSds < p) - elif f == "ndn": - p = options.filter_parameters.pop() - filters.append(lambda x: x.mNdn < p) - - batch = [] - ninput, noutput, nerrors = 0, 0, 0 - - if options.parse_batch: - batch = [] - for line in open(options.parse_batch, "r"): - if line[0] == "#": - continue - data = line[:-1].split("\t") - id, filename_log, filename_rst, filename_mali, filename_map_old2new = None, None, None, None, None - if len(data) == 2: - filename_out, id = data - elif len(data) == 3: - filename_out, id, filename_log = data - elif len(data) == 4: - filename_out, id, filename_log, filename_rst = data - elif len(data) == 5: - filename_out, id, filename_log, filename_rst, filename_mali = data - elif len(data) == 6: - filename_out, id, filename_log, filename_rst, filename_mali, filename_map_old2new = data - else: - raise ValueError( - "please supply at least two arguments (filename + id): %s" % str(data)) - - batch.append( - (id, filename_out, filename_log, filename_rst, filename_mali, filename_map_old2new)) - - else: - batch.append((None, None, options.filename_log, options.filename_rst, - options.filename_mali, options.filename_map_old2new)) - - first = True - - for cluster_id, filename_out, filename_log, filename_rst, filename_mali, filename_map_old2new in batch: - - if options.loglevel >= 2: - options.stdlog.write("# processing: id=%s, out=%s, log=%s, rst=%s, mali=%s\n" % - (cluster_id, filename_out, filename_log, filename_rst, filename_mali)) - - try: - if filename_log: - log_lines = open(filename_log, "r").readlines() - else: - log_lines = None - - if filename_rst: - rst_lines = open(filename_rst, "r").readlines() - else: - rst_lines = None - - if filename_out: - out_lines = open(filename_out, "r").readlines() - else: - out_lines = sys.stdin.readlines() - - except IOError as msg: - options.stdlog.write( - "file not found error for cluster id %s: %s\n" % (str(cluster_id), msg)) - traceback.print_exc() - nerrors += 1 - continue - - try: - result = codeml.parseOutput(out_lines, log_lines, rst_lines) - except ParsingError as msg: - options.stdlog.write( - "parsing error for cluster id %s: %s\n" % (str(cluster_id), msg)) - traceback.print_exc() - nerrors += 1 - continue - - if cluster_id and first and options.parse_tabular: - options.stdout.write("id\t") - - if filename_mali: - mali = Mali.Mali() - infile = open(filename_mali, "r") - mali.readFromFile(infile) - map_old2new = {} - for id in mali.getIdentifiers(): - species = id.split(options.separator)[0] - map_old2new[species] = id - - result.mapNames(map_old2new) - infile.close() - - if filename_map_old2new: - map_old2new = iotools.read_map(open(filename_map_old2new)) - if options.invert_map: - map_old2new = iotools.invert_dictionary( - map_old2new, make_unique=True) - result.mapNames(map_old2new) - - if options.parse_output == "all": - output = "%s" % str(result) - - elif options.parse_output == "likelihood": - if first and options.parse_tabular: - options.stdout.write("lnL\tnp\n") - output = "%f\t%i" % ( - result.mLogLikelihood, result.mNumParameters) - - elif options.parse_output == "terminal-nodes": - if first and options.parse_tabular: - options.stdout.write("branch\tka\tks\tkaks\n") - for branch in result.mBranchInfo: - if branch.mBranch1 in result.mSequences: - output = "%s\t%s\t%s\t%s" % (branch.mBranch1, - branch.mKa, branch.mKs, branch.mKaks) - elif branch.mBranch2 in result.mSequences: - output = "%s\t%s\t%s\t%s" % (branch.mBranch2, - branch.mKa, branch.mKs, branch.mKaks) - - elif options.parse_output == "ks-tree": - output = TreeTools.Tree2Newick( - result.mTreeKs, with_branch_lengths=True, write_all_taxa=True) - - elif options.parse_output == "ka-tree": - output = TreeTools.Tree2Newick( - result.mTreeKa, with_branch_lengths=True, write_all_taxa=True) - - elif options.parse_output == "kaks-tree": - output = TreeTools.Tree2Newick( - result.mTreeKaks, with_branch_lengths=True, write_all_taxa=True) - - elif options.parse_output == "sds-tree": - output = TreeTools.Tree2Newick( - result.mTreeSds, with_branch_lengths=True, write_all_taxa=True) - - elif options.parse_output == "ndn-tree": - output = TreeTools.Tree2Newick( - result.mTreeNdn, with_branch_lengths=True, write_all_taxa=True) - - elif options.parse_output == "s-tree": - output = TreeTools.Tree2Newick( - result.mTreeS, with_branch_lengths=True, write_all_taxa=True) - - elif options.parse_output == "n-tree": - output = TreeTools.Tree2Newick( - result.mTreeN, with_branch_lengths=True, write_all_taxa=True) - - elif options.parse_output == "sequences": - output = [] - for id, s in list(result.mSequences.items()): - output.append(">%s\n%s" % (id, s)) - output = "\n".join(output) - - elif options.parse_output == "ancestral-sequence": - - if not hasattr(result, "mAncestralSequences"): - raise ValueError( - "no ancestral sequences defined in result") - - # return most ancestral sequence - # mid-point root the tree with ks and then return the sequence closest to the root. - # this is not the true ancestral sequence, as PAML works on - # unrooted trees. - result.mTreeKs.root_midpoint() - succ = result.mTreeKs.node(result.mTreeKs.root).succ - assert(len(succ) == 2) - if result.mTreeKs.node(succ[0]).data.branchlength < result.mTreeKs.node(succ[1]).data.branchlength: - s = succ[0] - else: - s = succ[1] - - t = result.mAncestralTree.node(s).data.taxon - a = result.mAncestralSequences[t] - - if first and options.parse_tabular: - options.stdout.write( - "taxon\tacc_site\tacc_seq\tsequence\n") - - output = "%s\t%f\t%f\t%s" % (t, - a.mAccuracyPerSite, - a.mAccuracyPerSequence, - a.mSequence) - - elif options.parse_output == "mali": - - # output multiple alignment information - if first and options.parse_tabular: - options.stdout.write("nseq\tlength\tnsite_patterns\n") - - output = "%i\t%i\t%i" % ( - result.mNumSequences, result.mLength, result.mNumSitePatterns) - - if options.parse_tabular: - if cluster_id: - options.stdout.write("%s\t" % cluster_id) - else: - if cluster_id: - options.stdout.write(">%s\n" % (cluster_id)) - - options.stdout.write("%s\n" % (output)) - - noutput += 1 - first = False - - if options.loglevel >= 1: - options.stdlog.write( - "# ninput=%i, noutput=%i, nerrors=%i\n" % (ninput, noutput, nerrors)) - - ########################################################################## - ########################################################################## - ########################################################################## - # do a small test - ########################################################################## - elif options.test: - - alignment = ( - ('Hsa_Human', - "AAGGTCTTTGAAAGGTGTGAGTTGGCCAGAACTCTGAAAAGATTGGGAATGGATGGCTACAGGGGAATCAGCCTAGCAAACTGGATGTGTTTGGCCAAATGGGAGAGTGGTTACAACACACGAGCTACAAACTACAATGCTGGAGACAGAAGCACTGATTATGGGATATTTCAGATCAATAGCCGCTACTGGTGTAATGATGGCAAAACCCCAGGAGCAGTTAATGCCTGTCATTTATCCTGCAGTGCTTTGCTGCAAGATAACATCGCTGATGCTGTAGCTTGTGCAAAGAGGGTTGTCCGTGATCCACAAGGCATTAGAGCATGGGTGGCATGGAGAAATCGTTGTCAAAACAGAGATGTCCGTCAGTATGTTCAAGGTTGTGGAGTG"), - ("Hla_gibbon", - "AAGGTCTTTGAAAGGTGTGAGTTGGCCAGAACTCTGAAAAGATTGGGAATGGATGGCTACAGGGGAATCAGCCTAGCAAACTGGATGTGTTTGGCCAAATGGGAGAGTGGTTATAACACACGAGCTACAAACTACAATCCTGGAGACAGAAGCACTGATTATGGGATATTTCAGATCAATAGCCGCTACTGGTGTAATGATGGCAAAACCCCAGGAGCAGTTAATGCCTGTCATTTATCCTGCAATGCTTTGCTGCAAGATAACATCGCcgatGCTGTAGCTTGTGCAAAGAGGGTTGTCCGcgatCCACAAGGCATTAGAGCATGGGTGGCATGGAGAAATCGTTGTCAAAACAGAGATCTCCGTCAGTATATTCAAGGTTGTGGAGTA"), - ("Cgu/Can_colobus", - "AAGATCTTTGAAAGGTGTGAGTTGGCCAGAACTCTGAAAAAATTGGGACTGGATGGCTACAAGGGAGTCAGCCTAGCAAACTGGGTGTGTTTGGCCAAATGGGAGAGTGGTTATAACACAGACGCTACAAACTACAATCCTGGAGATGAAAGCACTGATTATGGGATATTTCAGATCAATAGCCGCTACTGGTGTAATAATGGCAAAACCCCAGGAGCAGTTAATGCCTGTCATATATCCTGCAATGCTTTGCTGCAAAATAACATCGCTGATGCTGTAGCTTGTGCAAAGAGGGTTGTCAGTGATCCACAAGGCATTCGAGCATGGGTGGCATGGAAAAAGCACTGTCAAAACAGAGATGTCAGTCAGTATGTTGAAGGTTGTGGAGTA"), - ("Pne_langur", - "AAGATCTTTGAAAGGTGTGAGTTGGCCAGAACTCTGAAAAAATTGGGACTGGATGGCTACAAGGGAGTCAGCCTAGCAAACTGGGTGTGTTTGGCCAAATGGGAGAGTGGTTATAACACAGAAGCTACAAACTACAATCCTGGAGACGAAAGCACTGATTATGGGATATTTCAGATCAATAGCCGCTACTGGTGTAATAATGGCAAAACCCCAGGAGCAGTTGATGCCTGTCATATATCCTGCAGTGCTTTGCTGCAAAACAACATCGCTGATGCTGTAGCTTGTGCAAAGAGGGTTGTCAGTGATCCACAAGGCGTTCGAGCATGGGTGGCATGGAGAAATCACTGTCAAAACAAAGATGTCAGTCAGTACGTTAAAGGTTGTGGAGTG"), - ("Mmu_rhesus", - "AAGATCTTTGAAAGGTGTGAGTTGGCCAGAACTCTGAAAAGATTGGGACTGGATGGCTACAGGGGAATCAGCCTAGCAAACTGGGTGTGTTTGGCCAAATGGGAGAGTAATTATAACACACAAGCTACAAACTACAATCCTGGAGACCAAAGCACTGATTATGGGATATTTCAGATCAATAGCCACTACTGGTGTAATAATGGCAAAACCCCAGGAGCAGTTAATGCCTGTCATATATCCTGCAATGCTTTGCTGCAAGATAACATCGCTGATGCTGTAACTTGTGCAAAGAGGGTTGTCAGTGATCCACAAGGCATTAGAGCATGGGTGGCATGGAGAAATCACTGTCAAAACAGAGATGTCAGTCAGTATGTTCAAGGTTGTGGAGTG"), - ("Ssc_squirrelM", - "AAGGTCTTCGAAAGGTGTGAGTTGGCCAGAACTCTGAAAAGGCTTGGAATGGATGGCTACAGGGGAATCAGCCTAGCAAACTGGATGTGTTTGGCCAAATGGGAGAGTGACTATAACACACGTGCTACAAACTACAATCCTGGAGACCAAAGCACTGATTATGGGATATTTCAGATCAATAGCCACTATTGGTGTAATAATGGCAGAACCCCAGGAGCAGTTAATGCCTGTCATATATCCTGCAATGCTTTGCTGCAAGATGACATCACTCAAGCTGTGGCCTGTGCAAAGAGGGTTGTCCGTGATCCACAAGGCATTAGAGCATGGGTGGCATGGAAAGCTCATTGTCAAAACAGAGATGTCAGTCAGTATGTTCAAGGTTGTGGAGTA"), - ("Cja_marmoset", - "AAGGTCTTTGAAAGGTGTGAGTTGGCCAGAACTCTGAAAAGGTTTGGACTGGATGGCTACAGGGGAATCAGCCTAGCAAACTGGATGTGTTTGGCCAAATGGGAGAGTGATTATAACACACGTGCTACAAACTACAATCCTGGAGACCAAAGCACTGATTATGGGATATTTCAGATCAATAGCCACTATTGGTGTAACAATGGCAGAACCCCAGGAGCAGTTAATGCCTGTCATATATCCTGCAATGCTTTGCTGCAAGATGACATCACTGAAGCTGTGGCCTGTGCAAAGAGGGTTGTCCGcgatCCACAAGGCATTAGGGCATGGGTGGCATGGAAAGCTCATTGTCAAAACAGAGATGTCAGTCAGTATGTTCAAGGTTGTGGAGTA"), - ) - - mali = Mali.Mali() - for key, s in alignment: - mali.addSequence(key, 0, len(s), s) - - tree = "((Hsa_Human, Hla_gibbon),((Cgu/Can_colobus, Pne_langur),Mmu_rhesus), (Ssc_squirrelM, Cja_marmoset));" - - result = codeml.Run(mali, tree, - options=codeml_options, - dump=options.dump) - - print(result) - else: - - mali = Mali.Mali() - - mali.readFromFile( - open(options.filename_sequences, "r"), format="fasta") - - # run it on input and dump out the output - result = codeml.Run(mali, options.filename_tree, - options=codeml_options, - dump=options.dump) - - for x in codeml.mWarnings: - options.stdlog.write("# PAML warning: %s\n" % x) - - options.stdout.write(result.mResult + "\n") - - if options.filename_log: - outfile = open(options.filename_log, "w") - else: - outfile = options.stdlog - outfile.write( - "############################### LOG OUTPUT ############################\n") - - outfile.write(result.mLog + "\n") - - if outfile != options.stdlog: - outfile.close() - - experiment.Stop()