diff --git a/.tt_blacklist b/.tt_blacklist
index d7902283..e100ea5c 100644
--- a/.tt_blacklist
+++ b/.tt_blacklist
@@ -129,22 +129,6 @@ tool_collections/vcftools/vcftools_merge
 tool_collections/vcftools/vcftools_subset
 tool_collections/vcftools/vcftools_annotate
 tool_collections/vcftools/vcftools_isec
-tool_collections/fastx_toolkit/fastq_quality_converter
-tool_collections/fastx_toolkit/fasta_clipping_histogram
-tool_collections/fastx_toolkit/fastx_nucleotides_distribution
-tool_collections/fastx_toolkit/fastx_trimmer
-tool_collections/fastx_toolkit/fastx_clipper
-tool_collections/fastx_toolkit/fastx_artifacts_filter
-tool_collections/fastx_toolkit/fastx_barcode_splitter
-tool_collections/fastx_toolkit/fastq_quality_filter
-tool_collections/fastx_toolkit/fastx_renamer
-tool_collections/fastx_toolkit/fastx_quality_statistics
-tool_collections/fastx_toolkit/fasta_formatter
-tool_collections/fastx_toolkit/fastq_quality_boxplot
-tool_collections/fastx_toolkit/fasta_nucleotide_changer
-tool_collections/fastx_toolkit/fastq_to_fasta
-tool_collections/fastx_toolkit/fastx_collapser
-tool_collections/fastx_toolkit/fastx_reverse_complement
 tool_collections/gatk/variant_annotator
 tool_collections/gatk/variant_apply_recalibration
 tool_collections/gatk/count_covariates
diff --git a/tool_collections/fastx_toolkit/fasta_clipping_histogram/fasta_clipping_histogram.xml b/tool_collections/fastx_toolkit/fasta_clipping_histogram/fasta_clipping_histogram.xml
index 7275e20e..cf14f7fc 100644
--- a/tool_collections/fastx_toolkit/fasta_clipping_histogram/fasta_clipping_histogram.xml
+++ b/tool_collections/fastx_toolkit/fasta_clipping_histogram/fasta_clipping_histogram.xml
@@ -1,18 +1,25 @@
-<tool id="cshl_fasta_clipping_histogram" name="Length Distribution" version="1.0.0">
+<tool id="cshl_fasta_clipping_histogram" name="Length Distribution" version="@VERSION@">
     <description>chart</description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
-    <command>fasta_clipping_histogram.pl $input $outfile</command>
-
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
+    <command><![CDATA[
+        command -v perl5.22.0 &&
+        perl5.22.0 `command -v fasta_clipping_histogram.pl` '$input' '$outfile' ||
+        fasta_clipping_histogram.pl '$input' '$outfile'
+    ]]></command>
     <inputs>
         <param format="fasta" name="input" type="data" label="Library to analyze" />
     </inputs>
-
     <outputs>
         <data format="png" name="outfile" metadata_source="input" />
     </outputs>
     <tests>
+        <test>
+            <param name="input" value="input.fasta" ftype="fasta"/>
+            <output name="outfile" file="histogram.pdf" />
+        </test>
     </tests>
     <help>
 **What it does**
diff --git a/tool_collections/fastx_toolkit/fasta_clipping_histogram/fastx_macros.xml b/tool_collections/fastx_toolkit/fasta_clipping_histogram/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fasta_clipping_histogram/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fasta_clipping_histogram/test-data/input.fasta b/tool_collections/fastx_toolkit/fasta_clipping_histogram/test-data/input.fasta
new file mode 100644
index 00000000..042e11fa
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fasta_clipping_histogram/test-data/input.fasta
@@ -0,0 +1,6 @@
+>sequence1
+AGTAGTAGGTGATGTAGAGAGAGAGAGAGTAG
+>sequence2
+GTGTGTGTGGGAAGTTGACACAGTA
+>sequence3
+CCTTGAGATTAACGCTAATCAAGTAAAC
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fasta_clipping_histogram/tool_dependencies.xml b/tool_collections/fastx_toolkit/fasta_clipping_histogram/tool_dependencies.xml
deleted file mode 100644
index 5474ad78..00000000
--- a/tool_collections/fastx_toolkit/fasta_clipping_histogram/tool_dependencies.xml
+++ /dev/null
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository name="package_fastx_toolkit_0_0_13" owner="devteam" />
-    </package>
-</tool_dependency>
diff --git a/tool_collections/fastx_toolkit/fasta_formatter/fasta_formatter.xml b/tool_collections/fastx_toolkit/fasta_formatter/fasta_formatter.xml
index 52a53ce4..b8eb0172 100644
--- a/tool_collections/fastx_toolkit/fasta_formatter/fasta_formatter.xml
+++ b/tool_collections/fastx_toolkit/fasta_formatter/fasta_formatter.xml
@@ -1,8 +1,9 @@
-<tool id="cshl_fasta_formatter" version="1.0.0" name="FASTA Width">
+<tool id="cshl_fasta_formatter" version="@VERSION@" name="FASTA Width">
     <description>formatter</description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
     <!--
         Note:
             fasta_formatter also has a tabular output mode (-t),
@@ -13,9 +14,9 @@
             FASTA file.
     -->
     <command>
-<![CDATA[
-zcat -f < '$input' | fasta_formatter -w $width -o '$output'
-]]>
+    <![CDATA[
+    zcat -f < '$input' | fasta_formatter -w $width -o '$output'
+    ]]>
     </command>
     <inputs>
         <param format="fasta" name="input" type="data" label="Library to re-format" />
diff --git a/tool_collections/fastx_toolkit/fasta_formatter/fastx_macros.xml b/tool_collections/fastx_toolkit/fasta_formatter/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fasta_formatter/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fasta_formatter/tool_dependencies.xml b/tool_collections/fastx_toolkit/fasta_formatter/tool_dependencies.xml
deleted file mode 100644
index 5474ad78..00000000
--- a/tool_collections/fastx_toolkit/fasta_formatter/tool_dependencies.xml
+++ /dev/null
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository name="package_fastx_toolkit_0_0_13" owner="devteam" />
-    </package>
-</tool_dependency>
diff --git a/tool_collections/fastx_toolkit/fasta_nucleotide_changer/fasta_nucleotide_changer.xml b/tool_collections/fastx_toolkit/fasta_nucleotide_changer/fasta_nucleotide_changer.xml
index e15c6060..1f256298 100644
--- a/tool_collections/fastx_toolkit/fasta_nucleotide_changer/fasta_nucleotide_changer.xml
+++ b/tool_collections/fastx_toolkit/fasta_nucleotide_changer/fasta_nucleotide_changer.xml
@@ -1,12 +1,13 @@
-<tool id="cshl_fasta_nucleotides_changer" version="1.0.0" name="RNA/DNA" >
+<tool id="cshl_fasta_nucleotides_changer" version="@VERSION@" name="RNA/DNA" >
     <description>converter</description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
     <command>
-<![CDATA[
-zcat -f < '$input' | fasta_nucleotide_changer -$mode -v -o '$output'
-]]>
+        <![CDATA[
+        zcat -f < '$input' | fasta_nucleotide_changer -$mode -v -o '$output'
+        ]]>
     </command>
     <inputs>
         <param format="fasta" name="input" type="data" label="Library to convert" />
diff --git a/tool_collections/fastx_toolkit/fasta_nucleotide_changer/fastx_macros.xml b/tool_collections/fastx_toolkit/fasta_nucleotide_changer/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fasta_nucleotide_changer/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastq_quality_boxplot/fastq_quality_boxplot.xml b/tool_collections/fastx_toolkit/fastq_quality_boxplot/fastq_quality_boxplot.xml
index 2c76a645..2eade8ed 100644
--- a/tool_collections/fastx_toolkit/fastq_quality_boxplot/fastq_quality_boxplot.xml
+++ b/tool_collections/fastx_toolkit/fastq_quality_boxplot/fastq_quality_boxplot.xml
@@ -1,17 +1,25 @@
-<tool id="cshl_fastq_quality_boxplot" name="Draw quality score boxplot" version="1.0.0">
-	<description></description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
-	<command>fastq_quality_boxplot_graph.sh -t '$input.name' -i $input -o $output</command>
-	
-	<inputs>
-		<param format="txt" name="input" type="data" label="Statistics report file"  help="output of 'FASTQ Statistics' tool" />
-	</inputs>
-
-	<outputs>
-		<data format="png" name="output" metadata_source="input" />
-	</outputs>
+<tool id="cshl_fastq_quality_boxplot" name="Draw quality score boxplot" version="@VERSION@">
+    <description></description>
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
+    <command>
+        fastq_quality_boxplot_graph.sh -t '$input.name' -i '$input' -o '$output'
+    </command>
+    <inputs>
+        <param format="txt" name="input" type="data" label="Statistics report file"  help="output of 'FASTQ Statistics' tool" />
+    </inputs>
+
+    <outputs>
+        <data format="png" name="output" metadata_source="input" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="fastq_stats1.out" ftype="txt"></param>
+            <output name="output" file="quality_boxplot_out.png"></output>
+        </test>
+    </tests>
 <help>
 
 **What it does**
diff --git a/tool_collections/fastx_toolkit/fastq_quality_boxplot/fastx_macros.xml b/tool_collections/fastx_toolkit/fastq_quality_boxplot/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastq_quality_boxplot/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastq_quality_boxplot/test-data/fastq_stats1.out b/tool_collections/fastx_toolkit/fastq_quality_boxplot/test-data/fastq_stats1.out
new file mode 100644
index 00000000..852c8122
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastq_quality_boxplot/test-data/fastq_stats1.out
@@ -0,0 +1,37 @@
+column	count	min	max	sum	mean	Q1	med	Q3	IQR	lW	rW	A_Count	C_Count	G_Count	T_Count	N_Count	Max_count
+1	9	23	34	288	32.00	33	33	33	0	33	33	3	1	4	1	0	9
+2	9	28	33	287	31.89	31	33	33	2	28	33	3	3	2	1	0	9
+3	9	13	34	268	29.78	28	33	33	5	21	34	5	1	0	3	0	9
+4	9	17	33	261	29.00	30	33	33	3	26	33	1	2	3	3	0	9
+5	9	22	33	269	29.89	30	33	33	3	26	33	3	3	3	0	0	9
+6	9	22	33	277	30.78	30	33	33	3	26	33	5	3	0	1	0	9
+7	9	21	33	258	28.67	24	33	33	9	21	33	4	1	3	1	0	9
+8	9	12	33	263	29.22	32	33	33	1	31	33	2	1	1	5	0	9
+9	9	29	33	290	32.22	33	33	33	0	33	33	3	3	2	1	0	9
+10	9	23	33	277	30.78	32	33	33	1	31	33	1	4	2	2	0	9
+11	9	12	33	245	27.22	21	31	33	12	12	33	5	2	1	1	0	9
+12	9	13	33	214	23.78	15	24	33	18	13	33	2	4	2	1	0	9
+13	9	5	33	249	27.67	29	31	33	4	23	33	2	1	1	5	0	9
+14	9	5	33	233	25.89	24	33	33	9	11	33	3	3	2	1	0	9
+15	9	15	33	251	27.89	24	33	33	9	15	33	5	1	1	2	0	9
+16	9	23	34	269	29.89	24	33	33	9	23	34	3	1	2	3	0	9
+17	9	13	34	266	29.56	33	33	33	0	33	33	2	3	1	3	0	9
+18	9	21	34	272	30.22	31	33	33	2	28	34	0	5	1	3	0	9
+19	9	5	34	244	27.11	27	30	33	6	18	34	4	4	1	0	0	9
+20	9	11	34	241	26.78	23	32	33	10	11	34	3	4	2	0	0	9
+21	9	13	33	240	26.67	24	27	33	9	13	33	1	4	0	4	0	9
+22	9	5	33	190	21.11	13	21	33	20	5	33	1	4	0	3	1	9
+23	9	5	33	205	22.78	16	26	33	17	5	33	4	4	1	0	0	9
+24	9	5	33	247	27.44	28	31	33	5	21	33	1	5	1	2	0	9
+25	9	11	34	241	26.78	24	33	33	9	11	34	3	4	0	2	0	9
+26	9	5	33	212	23.56	18	31	33	15	5	33	0	6	0	3	0	9
+27	9	5	33	227	25.22	21	26	33	12	5	33	3	4	1	1	0	9
+28	9	21	33	255	28.33	24	31	33	9	21	33	2	4	3	0	0	9
+29	9	5	33	228	25.33	21	30	33	12	5	33	2	4	1	2	0	9
+30	9	10	33	213	23.67	16	28	33	17	10	33	3	4	2	0	0	9
+31	9	5	33	236	26.22	21	31	33	12	5	33	1	4	1	3	0	9
+32	9	5	33	210	23.33	12	29	33	21	5	33	3	3	0	3	0	9
+33	9	5	33	183	20.33	9	21	33	24	5	33	1	4	2	2	0	9
+34	9	5	33	150	16.67	7	17	22	15	5	33	3	4	1	1	0	9
+35	9	13	33	217	24.11	21	24	29	8	13	33	1	4	1	3	0	9
+36	9	5	33	195	21.67	18	21	32	14	5	33	3	2	1	3	0	9
diff --git a/tool_collections/fastx_toolkit/fastq_quality_boxplot/test-data/quality_boxplot_out.png b/tool_collections/fastx_toolkit/fastq_quality_boxplot/test-data/quality_boxplot_out.png
new file mode 100644
index 00000000..dac7b46c
Binary files /dev/null and b/tool_collections/fastx_toolkit/fastq_quality_boxplot/test-data/quality_boxplot_out.png differ
diff --git a/tool_collections/fastx_toolkit/fastq_quality_boxplot/tool_dependencies.xml b/tool_collections/fastx_toolkit/fastq_quality_boxplot/tool_dependencies.xml
deleted file mode 100644
index 5474ad78..00000000
--- a/tool_collections/fastx_toolkit/fastq_quality_boxplot/tool_dependencies.xml
+++ /dev/null
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository name="package_fastx_toolkit_0_0_13" owner="devteam" />
-    </package>
-</tool_dependency>
diff --git a/tool_collections/fastx_toolkit/fastq_quality_converter/fastq_quality_converter.xml b/tool_collections/fastx_toolkit/fastq_quality_converter/fastq_quality_converter.xml
index c143cb89..e8c23208 100644
--- a/tool_collections/fastx_toolkit/fastq_quality_converter/fastq_quality_converter.xml
+++ b/tool_collections/fastx_toolkit/fastq_quality_converter/fastq_quality_converter.xml
@@ -1,8 +1,9 @@
-<tool id="cshl_fastq_quality_converter" name="Quality format converter" version="1.0.0">
+<tool id="cshl_fastq_quality_converter" name="Quality format converter" version="@VERSION@">
     <description>(ASCII-Numeric)</description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
     <command>
 <![CDATA[
 zcat -f < '$input' | fastq_quality_converter $QUAL_FORMAT -o '$output' -Q $offset
diff --git a/tool_collections/fastx_toolkit/fastq_quality_converter/fastx_macros.xml b/tool_collections/fastx_toolkit/fastq_quality_converter/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastq_quality_converter/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastq_quality_converter/tool_dependencies.xml b/tool_collections/fastx_toolkit/fastq_quality_converter/tool_dependencies.xml
deleted file mode 100644
index 5474ad78..00000000
--- a/tool_collections/fastx_toolkit/fastq_quality_converter/tool_dependencies.xml
+++ /dev/null
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository name="package_fastx_toolkit_0_0_13" owner="devteam" />
-    </package>
-</tool_dependency>
diff --git a/tool_collections/fastx_toolkit/fastq_quality_filter/fastq_quality_filter.xml b/tool_collections/fastx_toolkit/fastq_quality_filter/fastq_quality_filter.xml
index ba360c7f..f1875adf 100644
--- a/tool_collections/fastx_toolkit/fastq_quality_filter/fastq_quality_filter.xml
+++ b/tool_collections/fastx_toolkit/fastq_quality_filter/fastq_quality_filter.xml
@@ -1,15 +1,19 @@
-<tool id="cshl_fastq_quality_filter" version="1.0.0" name="Filter by quality">
+<tool id="cshl_fastq_quality_filter" version="@VERSION@" name="Filter by quality">
     <description></description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
     <command>
-<![CDATA[
-zcat -f < '$input' | fastq_quality_filter -q $quality -p $percent -v -o '$output'
-#if $input.ext == "fastqsanger":
-    -Q 33
-#end if
-]]>
+        <![CDATA[
+        zcat -f < '$input' | fastq_quality_filter -q $quality -p $percent -v -o '$output'
+        ## fastqsanger uses offset 33, illumina and solexa offset 64 (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2847217/table/T1/)
+        #if $input.is_of_type(fastqsanger):
+            -Q 33
+        #elif $input.is_of_type(fastqillumina" or $input.is_of_type(fastqsolexa):
+            -Q 64
+        #end if
+        ]]>
     </command>
 
     <inputs>
diff --git a/tool_collections/fastx_toolkit/fastq_quality_filter/fastx_macros.xml b/tool_collections/fastx_toolkit/fastq_quality_filter/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastq_quality_filter/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastq_quality_filter/tool_dependencies.xml b/tool_collections/fastx_toolkit/fastq_quality_filter/tool_dependencies.xml
deleted file mode 100644
index 5474ad78..00000000
--- a/tool_collections/fastx_toolkit/fastq_quality_filter/tool_dependencies.xml
+++ /dev/null
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository name="package_fastx_toolkit_0_0_13" owner="devteam" />
-    </package>
-</tool_dependency>
diff --git a/tool_collections/fastx_toolkit/fastq_to_fasta/fastq_to_fasta.xml b/tool_collections/fastx_toolkit/fastq_to_fasta/fastq_to_fasta.xml
index 410aa022..0af01176 100644
--- a/tool_collections/fastx_toolkit/fastq_to_fasta/fastq_to_fasta.xml
+++ b/tool_collections/fastx_toolkit/fastq_to_fasta/fastq_to_fasta.xml
@@ -1,49 +1,54 @@
-<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA" version="1.0.0">
-	<description>converter from FASTX-toolkit</description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
-	<command>gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v
-#if $input.ext == "fastqsanger":
--Q 33
-#end if
-	</command>
-
-	<inputs>
-		<param format="fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="FASTQ Library to convert" />
-
-		<param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases ">
-			<option value="">yes</option>
-			<option value="-n">no</option>
-		</param>
-
-		<param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)">
-			<option value="-r">yes</option>
-			<option value="">no</option>
-		</param>
-
-	</inputs>
-
-	<tests>
-		<test>
-			<!-- FASTQ-To-FASTA, keep N, don't rename -->
-			<param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
-			<param name="SKIPN" value=""/>
-			<param name="RENAMESEQ" value=""/>
-			<output name="output" file="fastq_to_fasta1a.out" />
-		</test>
-		<test>
-			<!-- FASTQ-To-FASTA, discard N, rename -->
-			<param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
-			<param name="SKIPN" value="no"/>
-			<param name="RENAMESEQ" value="yes"/>
-			<output name="output" file="fastq_to_fasta1b.out" />
-		</test>
-	</tests>
-
-	<outputs>
-		<data format="fasta" name="output" metadata_source="input" />
-	</outputs>
+<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA" version="@VERSION@">
+    <description>converter from FASTX-toolkit</description>
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
+    <command>
+        <![CDATA[
+        gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v
+        #if $input.is_of_type('fastqsanger'):
+            -Q 33
+        #elif $input.is_of_type('fastqillumina') or $input.is_of_type('fastqsolexa'):
+            -Q 64
+        #end if
+        ]]>
+    </command>
+    <inputs>
+        <param format="fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="FASTQ Library to convert" />
+
+        <param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases ">
+            <option value="">yes</option>
+            <option value="-n">no</option>
+        </param>
+
+        <param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)">
+            <option value="-r">yes</option>
+            <option value="">no</option>
+        </param>
+
+    </inputs>
+
+    <tests>
+        <test>
+            <!-- FASTQ-To-FASTA, keep N, don't rename -->
+            <param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
+            <param name="SKIPN" value=""/>
+            <param name="RENAMESEQ" value=""/>
+            <output name="output" file="fastq_to_fasta1a.out" />
+        </test>
+        <test>
+            <!-- FASTQ-To-FASTA, discard N, rename -->
+            <param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
+            <param name="SKIPN" value="no"/>
+            <param name="RENAMESEQ" value="yes"/>
+            <output name="output" file="fastq_to_fasta1b.out" />
+        </test>
+    </tests>
+
+    <outputs>
+        <data format="fasta" name="output" metadata_source="input" />
+    </outputs>
 
 <help>
 
diff --git a/tool_collections/fastx_toolkit/fastq_to_fasta/fastx_macros.xml b/tool_collections/fastx_toolkit/fastq_to_fasta/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastq_to_fasta/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastq_to_fasta/tool_dependencies.xml b/tool_collections/fastx_toolkit/fastq_to_fasta/tool_dependencies.xml
deleted file mode 100644
index 5474ad78..00000000
--- a/tool_collections/fastx_toolkit/fastq_to_fasta/tool_dependencies.xml
+++ /dev/null
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository name="package_fastx_toolkit_0_0_13" owner="devteam" />
-    </package>
-</tool_dependency>
diff --git a/tool_collections/fastx_toolkit/fastx_artifacts_filter/fastx_artifacts_filter.xml b/tool_collections/fastx_toolkit/fastx_artifacts_filter/fastx_artifacts_filter.xml
index 4f7505f5..5024af84 100644
--- a/tool_collections/fastx_toolkit/fastx_artifacts_filter/fastx_artifacts_filter.xml
+++ b/tool_collections/fastx_toolkit/fastx_artifacts_filter/fastx_artifacts_filter.xml
@@ -1,15 +1,18 @@
-<tool id="cshl_fastx_artifacts_filter" version="1.0.0" name="Remove sequencing artifacts">
+<tool id="cshl_fastx_artifacts_filter" version="@VERSION@" name="Remove sequencing artifacts">
     <description></description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
     <command>
-<![CDATA[
-zcat -f < '$input' | fastx_artifacts_filter -v -o '$output'
-#if $input.ext == "fastqsanger":
-    -Q 33
-#end if
-]]>
+        <![CDATA[
+        zcat -f < '$input' | fastx_artifacts_filter -v -o '$output'
+        #if $input.is_of_type('fastqsanger'):
+            -Q 33
+        #elif $input.is_of_type('fastqillumina') or $input.is_of_type('fastqsolexa'):
+            -Q 64
+        #end if
+        ]]>
     </command>
 
     <inputs>
diff --git a/tool_collections/fastx_toolkit/fastx_artifacts_filter/fastx_macros.xml b/tool_collections/fastx_toolkit/fastx_artifacts_filter/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastx_artifacts_filter/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastx_artifacts_filter/tool_dependencies.xml b/tool_collections/fastx_toolkit/fastx_artifacts_filter/tool_dependencies.xml
deleted file mode 100644
index 5474ad78..00000000
--- a/tool_collections/fastx_toolkit/fastx_artifacts_filter/tool_dependencies.xml
+++ /dev/null
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository name="package_fastx_toolkit_0_0_13" owner="devteam" />
-    </package>
-</tool_dependency>
diff --git a/tool_collections/fastx_toolkit/fastx_barcode_splitter/fastx_barcode_splitter.xml b/tool_collections/fastx_toolkit/fastx_barcode_splitter/fastx_barcode_splitter.xml
index 3f627f3d..baa28c1a 100644
--- a/tool_collections/fastx_toolkit/fastx_barcode_splitter/fastx_barcode_splitter.xml
+++ b/tool_collections/fastx_toolkit/fastx_barcode_splitter/fastx_barcode_splitter.xml
@@ -1,10 +1,14 @@
-<tool id="cshl_fastx_barcode_splitter" version="1.0.0" name="Barcode Splitter">
+<tool id="cshl_fastx_barcode_splitter" version="@VERSION@" name="Barcode Splitter">
     <description></description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
-    <command interpreter="bash">fastx_barcode_splitter_galaxy_wrapper.sh '$BARCODE' '$input' "$input.name" "$output.files_path" --mismatches $mismatches --partial $partial $EOL > '$output' </command>
-
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
+    <command>
+        <![CDATA[
+        bash "$__tool_directory__"/fastx_barcode_splitter_galaxy_wrapper.sh '$BARCODE' '$input' "$input.name" "$output.files_path" --mismatches $mismatches --partial $partial $EOL > '$output'
+        ]]>
+    </command>
     <inputs>
         <param format="txt" name="BARCODE" type="data" label="Barcodes to use" />
         <param format="fasta,fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="Library to split" />
diff --git a/tool_collections/fastx_toolkit/fastx_barcode_splitter/fastx_macros.xml b/tool_collections/fastx_toolkit/fastx_barcode_splitter/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastx_barcode_splitter/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastx_barcode_splitter/tool_dependencies.xml b/tool_collections/fastx_toolkit/fastx_barcode_splitter/tool_dependencies.xml
deleted file mode 100644
index 5474ad78..00000000
--- a/tool_collections/fastx_toolkit/fastx_barcode_splitter/tool_dependencies.xml
+++ /dev/null
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository name="package_fastx_toolkit_0_0_13" owner="devteam" />
-    </package>
-</tool_dependency>
diff --git a/tool_collections/fastx_toolkit/fastx_clipper/fastx_clipper.xml b/tool_collections/fastx_toolkit/fastx_clipper/fastx_clipper.xml
index 2fb04f55..9195a6c3 100644
--- a/tool_collections/fastx_toolkit/fastx_clipper/fastx_clipper.xml
+++ b/tool_collections/fastx_toolkit/fastx_clipper/fastx_clipper.xml
@@ -1,15 +1,18 @@
-<tool id="cshl_fastx_clipper" name="Clip" version="1.0.1">
+<tool id="cshl_fastx_clipper" name="Clip" version="@VERSOIN@">
     <description>adapter sequences</description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
     <command>
-<![CDATA[
-zcat -f < '$input' | fastx_clipper -l $minlength -a '$clip_source.clip_sequence' -d $keepdelta -o '$output' -v $KEEP_N $DISCARD_OPTIONS
-#if $input.ext == "fastqsanger":
-   -Q 33
-#end if
-]]>
+        <![CDATA[
+        zcat -f < '$input' | fastx_clipper -l $minlength -a '$clip_source.clip_sequence' -d $keepdelta -o '$output' -v $KEEP_N $DISCARD_OPTIONS
+        #if $input.is_of_type('fastqsanger'):
+            -Q 33
+        #elif $input.is_of_type('fastqillumina') or $input.is_of_type('fastqsolexa'):
+            -Q 64
+        #end if
+        ]]>
     </command>
 
     <inputs>
diff --git a/tool_collections/fastx_toolkit/fastx_clipper/fastx_macros.xml b/tool_collections/fastx_toolkit/fastx_clipper/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastx_clipper/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastx_clipper/tool_dependencies.xml b/tool_collections/fastx_toolkit/fastx_clipper/tool_dependencies.xml
deleted file mode 100644
index 5474ad78..00000000
--- a/tool_collections/fastx_toolkit/fastx_clipper/tool_dependencies.xml
+++ /dev/null
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository name="package_fastx_toolkit_0_0_13" owner="devteam" />
-    </package>
-</tool_dependency>
diff --git a/tool_collections/fastx_toolkit/fastx_collapser/fastx_collapser.xml b/tool_collections/fastx_toolkit/fastx_collapser/fastx_collapser.xml
index 1f5e0a25..906e28ec 100644
--- a/tool_collections/fastx_toolkit/fastx_collapser/fastx_collapser.xml
+++ b/tool_collections/fastx_toolkit/fastx_collapser/fastx_collapser.xml
@@ -1,15 +1,18 @@
-<tool id="cshl_fastx_collapser" version="1.0.0" name="Collapse">
+<tool id="cshl_fastx_collapser" version="@VERSION@" name="Collapse">
     <description>sequences</description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
     <command>
-<![CDATA[
-zcat -f < '$input' | fastx_collapser -v -o '$output'
-#if $input.ext == "fastqsanger":
-    -Q 33
-#end if
-]]>
+        <![CDATA[
+        zcat -f < '$input' | fastx_collapser -v -o '$output'
+        #if $input.is_of_type('fastqsanger'):
+            -Q 33
+        #elif $input.is_of_type('fastqillumina') or $input.is_of_type('fastqsolexa'):
+            -Q 64
+        #end if
+        ]]>
     </command>
 
     <inputs>
diff --git a/tool_collections/fastx_toolkit/fastx_collapser/fastx_macros.xml b/tool_collections/fastx_toolkit/fastx_collapser/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastx_collapser/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastx_collapser/tool_dependencies.xml b/tool_collections/fastx_toolkit/fastx_collapser/tool_dependencies.xml
deleted file mode 100644
index 5474ad78..00000000
--- a/tool_collections/fastx_toolkit/fastx_collapser/tool_dependencies.xml
+++ /dev/null
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository name="package_fastx_toolkit_0_0_13" owner="devteam" />
-    </package>
-</tool_dependency>
diff --git a/tool_collections/fastx_toolkit/fastx_macros.xml b/tool_collections/fastx_toolkit/fastx_macros.xml
new file mode 100644
index 00000000..bca9a9cf
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastx_macros.xml
@@ -0,0 +1,10 @@
+<macros>
+  <token name="@VERSION@">1.14</token>
+
+  <xml name="requirements">
+    <requirements>
+      <requirement type="package" version="0.0.14">fastx_toolkit</requirement>
+      <yield />
+    </requirements>
+  </xml>
+</macros>
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/fastx_macros.xml b/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/fastx_nucleotides_distribution.xml b/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/fastx_nucleotides_distribution.xml
index 7bb498e9..98cfa850 100644
--- a/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/fastx_nucleotides_distribution.xml
+++ b/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/fastx_nucleotides_distribution.xml
@@ -1,17 +1,22 @@
-<tool id="cshl_fastx_nucleotides_distribution" version="1.0.0" name="Draw nucleotides distribution chart">
-	<description></description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
-	<command>fastx_nucleotide_distribution_graph.sh -t '$input.name' -i $input -o $output</command>
-	
-	<inputs>
-		<param format="txt" name="input" type="data" label="Statistics Text File" help="output of 'FASTX Statistics' tool" />
-	</inputs>
-	
-	<outputs>
-		<data format="png" name="output" metadata_source="input" />
-	</outputs>
+<tool id="cshl_fastx_nucleotides_distribution" version="@VERSION@" name="Draw nucleotides distribution chart">
+    <description></description>
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
+    <command detect_errors="aggressive">fastx_nucleotide_distribution_graph.sh -t '$input.name' -i '$input' -o '$output'</command>
+    <inputs>
+        <param format="txt" name="input" type="data" label="Statistics Text File" help="output of 'FASTX Statistics' tool" />
+    </inputs>
+    <outputs>
+        <data format="png" name="output" metadata_source="input" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="fastq_stats1.out" ftype="txt" />
+            <output name="output" file="fastx_nt_distribution.png" compare="sim_size"/>
+        </test>
+    </tests>
 <help>
 
 **What it does**
diff --git a/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/test-data/fastq_stats1.out b/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/test-data/fastq_stats1.out
new file mode 100644
index 00000000..852c8122
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/test-data/fastq_stats1.out
@@ -0,0 +1,37 @@
+column	count	min	max	sum	mean	Q1	med	Q3	IQR	lW	rW	A_Count	C_Count	G_Count	T_Count	N_Count	Max_count
+1	9	23	34	288	32.00	33	33	33	0	33	33	3	1	4	1	0	9
+2	9	28	33	287	31.89	31	33	33	2	28	33	3	3	2	1	0	9
+3	9	13	34	268	29.78	28	33	33	5	21	34	5	1	0	3	0	9
+4	9	17	33	261	29.00	30	33	33	3	26	33	1	2	3	3	0	9
+5	9	22	33	269	29.89	30	33	33	3	26	33	3	3	3	0	0	9
+6	9	22	33	277	30.78	30	33	33	3	26	33	5	3	0	1	0	9
+7	9	21	33	258	28.67	24	33	33	9	21	33	4	1	3	1	0	9
+8	9	12	33	263	29.22	32	33	33	1	31	33	2	1	1	5	0	9
+9	9	29	33	290	32.22	33	33	33	0	33	33	3	3	2	1	0	9
+10	9	23	33	277	30.78	32	33	33	1	31	33	1	4	2	2	0	9
+11	9	12	33	245	27.22	21	31	33	12	12	33	5	2	1	1	0	9
+12	9	13	33	214	23.78	15	24	33	18	13	33	2	4	2	1	0	9
+13	9	5	33	249	27.67	29	31	33	4	23	33	2	1	1	5	0	9
+14	9	5	33	233	25.89	24	33	33	9	11	33	3	3	2	1	0	9
+15	9	15	33	251	27.89	24	33	33	9	15	33	5	1	1	2	0	9
+16	9	23	34	269	29.89	24	33	33	9	23	34	3	1	2	3	0	9
+17	9	13	34	266	29.56	33	33	33	0	33	33	2	3	1	3	0	9
+18	9	21	34	272	30.22	31	33	33	2	28	34	0	5	1	3	0	9
+19	9	5	34	244	27.11	27	30	33	6	18	34	4	4	1	0	0	9
+20	9	11	34	241	26.78	23	32	33	10	11	34	3	4	2	0	0	9
+21	9	13	33	240	26.67	24	27	33	9	13	33	1	4	0	4	0	9
+22	9	5	33	190	21.11	13	21	33	20	5	33	1	4	0	3	1	9
+23	9	5	33	205	22.78	16	26	33	17	5	33	4	4	1	0	0	9
+24	9	5	33	247	27.44	28	31	33	5	21	33	1	5	1	2	0	9
+25	9	11	34	241	26.78	24	33	33	9	11	34	3	4	0	2	0	9
+26	9	5	33	212	23.56	18	31	33	15	5	33	0	6	0	3	0	9
+27	9	5	33	227	25.22	21	26	33	12	5	33	3	4	1	1	0	9
+28	9	21	33	255	28.33	24	31	33	9	21	33	2	4	3	0	0	9
+29	9	5	33	228	25.33	21	30	33	12	5	33	2	4	1	2	0	9
+30	9	10	33	213	23.67	16	28	33	17	10	33	3	4	2	0	0	9
+31	9	5	33	236	26.22	21	31	33	12	5	33	1	4	1	3	0	9
+32	9	5	33	210	23.33	12	29	33	21	5	33	3	3	0	3	0	9
+33	9	5	33	183	20.33	9	21	33	24	5	33	1	4	2	2	0	9
+34	9	5	33	150	16.67	7	17	22	15	5	33	3	4	1	1	0	9
+35	9	13	33	217	24.11	21	24	29	8	13	33	1	4	1	3	0	9
+36	9	5	33	195	21.67	18	21	32	14	5	33	3	2	1	3	0	9
diff --git a/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/test-data/fastx_nt_distribution.png b/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/test-data/fastx_nt_distribution.png
new file mode 100644
index 00000000..7dc745a6
Binary files /dev/null and b/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/test-data/fastx_nt_distribution.png differ
diff --git a/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/tool_dependencies.xml b/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/tool_dependencies.xml
deleted file mode 100644
index 5474ad78..00000000
--- a/tool_collections/fastx_toolkit/fastx_nucleotides_distribution/tool_dependencies.xml
+++ /dev/null
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository name="package_fastx_toolkit_0_0_13" owner="devteam" />
-    </package>
-</tool_dependency>
diff --git a/tool_collections/fastx_toolkit/fastx_quality_statistics/fastx_macros.xml b/tool_collections/fastx_toolkit/fastx_quality_statistics/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastx_quality_statistics/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastx_quality_statistics/fastx_quality_statistics.xml b/tool_collections/fastx_toolkit/fastx_quality_statistics/fastx_quality_statistics.xml
index 17da76c5..3715c39f 100644
--- a/tool_collections/fastx_toolkit/fastx_quality_statistics/fastx_quality_statistics.xml
+++ b/tool_collections/fastx_toolkit/fastx_quality_statistics/fastx_quality_statistics.xml
@@ -1,16 +1,22 @@
-<tool id="cshl_fastx_quality_statistics" version="1.0.0" name="Compute quality statistics">
+<tool id="cshl_fastx_quality_statistics" version="@VERSION@" name="Compute quality statistics">
     <description></description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
     <command>
-<![CDATA[
-zcat -f < '$input' | fastx_quality_stats -o '$output' -Q 33
-]]>
+        <![CDATA[
+        zcat -f < '$input' | fastx_quality_stats -o '$output'
+        #if $input.is_of_type('fastqsanger'):
+            -Q 33
+        #elif $input.is_of_type('fastqillumina') or $input.is_of_type('fastqsolexa'):
+            -Q 64
+        #end if
+        ]]>
     </command>
 
     <inputs>
-        <param format="fastqsanger" name="input" type="data" label="Library to analyse" />
+        <param format="fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="Library to analyse" />
     </inputs>
     <outputs>
         <data format="txt" name="output" metadata_source="input" />
diff --git a/tool_collections/fastx_toolkit/fastx_quality_statistics/tool_dependencies.xml b/tool_collections/fastx_toolkit/fastx_quality_statistics/tool_dependencies.xml
deleted file mode 100644
index 5474ad78..00000000
--- a/tool_collections/fastx_toolkit/fastx_quality_statistics/tool_dependencies.xml
+++ /dev/null
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository name="package_fastx_toolkit_0_0_13" owner="devteam" />
-    </package>
-</tool_dependency>
diff --git a/tool_collections/fastx_toolkit/fastx_renamer/fastx_macros.xml b/tool_collections/fastx_toolkit/fastx_renamer/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastx_renamer/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastx_renamer/fastx_renamer.xml b/tool_collections/fastx_toolkit/fastx_renamer/fastx_renamer.xml
index 9db83ac9..0382bc61 100644
--- a/tool_collections/fastx_toolkit/fastx_renamer/fastx_renamer.xml
+++ b/tool_collections/fastx_toolkit/fastx_renamer/fastx_renamer.xml
@@ -1,15 +1,18 @@
-<tool id="cshl_fastx_renamer" name="Rename sequences" version="0.0.11" >
+<tool id="cshl_fastx_renamer" name="Rename sequences" version="@VERSION@" >
     <description></description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
     <command>
-<![CDATA[
-zcat -f < '$input' | fastx_renamer -n $TYPE -o '$output' -v
-#if $input.ext == "fastqsanger":
-    -Q 33
-#end if
-]]>
+        <![CDATA[
+        zcat -f < '$input' | fastx_renamer -n $TYPE -o '$output' -v
+        #if $input.is_of_type('fastqsanger'):
+            -Q 33
+        #elif $input.is_of_type('fastqillumina') or $input.is_of_type('fastqsolexa'):
+            -Q 64
+        #end if
+        ]]>
     </command>
 
     <inputs>
@@ -25,6 +28,11 @@ zcat -f < '$input' | fastx_renamer -n $TYPE -o '$output' -v
         <data format_source="input" name="output" metadata_source="input" />
     </outputs>
     <tests>
+        <test>
+            <param name="input" value="input.fastqsolexa" ftype="fastqsolexa"></param>
+            <param name="TYPE" value="SEQ"></param>
+            <output name="output" file="renamed_nt_sequence.fastqsolexa"></output>
+        </test>
     </tests>
     <help>
 **What it does**
diff --git a/tool_collections/fastx_toolkit/fastx_renamer/test-data/input.fastqsolexa b/tool_collections/fastx_toolkit/fastx_renamer/test-data/input.fastqsolexa
new file mode 100644
index 00000000..6dd52e0c
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastx_renamer/test-data/input.fastqsolexa
@@ -0,0 +1,4 @@
+@CSHL_4_FC042GAMMII_2_1_517_596
+GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
++CSHL_4_FC042GAMMII_2_1_517_596
+40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastx_renamer/test-data/renamed_nt_sequence.fastqsolexa b/tool_collections/fastx_toolkit/fastx_renamer/test-data/renamed_nt_sequence.fastqsolexa
new file mode 100644
index 00000000..2dfe3ffb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastx_renamer/test-data/renamed_nt_sequence.fastqsolexa
@@ -0,0 +1,4 @@
+@GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
++GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
diff --git a/tool_collections/fastx_toolkit/fastx_renamer/tool_dependencies.xml b/tool_collections/fastx_toolkit/fastx_renamer/tool_dependencies.xml
deleted file mode 100644
index 5474ad78..00000000
--- a/tool_collections/fastx_toolkit/fastx_renamer/tool_dependencies.xml
+++ /dev/null
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository name="package_fastx_toolkit_0_0_13" owner="devteam" />
-    </package>
-</tool_dependency>
diff --git a/tool_collections/fastx_toolkit/fastx_reverse_complement/fastx_macros.xml b/tool_collections/fastx_toolkit/fastx_reverse_complement/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastx_reverse_complement/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastx_reverse_complement/fastx_reverse_complement.xml b/tool_collections/fastx_toolkit/fastx_reverse_complement/fastx_reverse_complement.xml
index 1dc46aed..859b7bb3 100644
--- a/tool_collections/fastx_toolkit/fastx_reverse_complement/fastx_reverse_complement.xml
+++ b/tool_collections/fastx_toolkit/fastx_reverse_complement/fastx_reverse_complement.xml
@@ -1,15 +1,18 @@
-<tool id="cshl_fastx_reverse_complement" version="1.0.0" name="Reverse-Complement">
+<tool id="cshl_fastx_reverse_complement" version="@VERSION@" name="Reverse-Complement">
     <description></description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
     <command>
-<![CDATA[
-zcat -f < '$input' | fastx_reverse_complement -v -o '$output'
-#if $input.ext == "fastqsanger":
-    -Q 33
-#end if
-]]>
+        <![CDATA[
+        zcat -f < '$input' | fastx_reverse_complement -v -o '$output'
+        #if $input.is_of_type('fastqsanger'):
+            -Q 33
+        #elif $input.is_of_type('fastqillumina') or $input.is_of_type('fastqsolexa'):
+            -Q 64
+        #end if
+        ]]>
     </command>
     <inputs>
         <param format="fasta,fastqsolexa,fastqsanger" name="input" type="data" label="Library to reverse-complement" />
diff --git a/tool_collections/fastx_toolkit/fastx_reverse_complement/tool_dependencies.xml b/tool_collections/fastx_toolkit/fastx_reverse_complement/tool_dependencies.xml
deleted file mode 100644
index 5474ad78..00000000
--- a/tool_collections/fastx_toolkit/fastx_reverse_complement/tool_dependencies.xml
+++ /dev/null
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository name="package_fastx_toolkit_0_0_13" owner="devteam" />
-    </package>
-</tool_dependency>
diff --git a/tool_collections/fastx_toolkit/fastx_trimmer/fastx_macros.xml b/tool_collections/fastx_toolkit/fastx_trimmer/fastx_macros.xml
new file mode 120000
index 00000000..a6c33dbb
--- /dev/null
+++ b/tool_collections/fastx_toolkit/fastx_trimmer/fastx_macros.xml
@@ -0,0 +1 @@
+../fastx_macros.xml
\ No newline at end of file
diff --git a/tool_collections/fastx_toolkit/fastx_trimmer/fastx_trimmer.xml b/tool_collections/fastx_toolkit/fastx_trimmer/fastx_trimmer.xml
index d6ebbc50..2537f5d3 100644
--- a/tool_collections/fastx_toolkit/fastx_trimmer/fastx_trimmer.xml
+++ b/tool_collections/fastx_toolkit/fastx_trimmer/fastx_trimmer.xml
@@ -1,15 +1,18 @@
-<tool id="cshl_fastx_trimmer" version="1.0.0" name="Trim sequences">
+<tool id="cshl_fastx_trimmer" version="@VERSION@" name="Trim sequences">
     <description></description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
+    <expand macro="requirements" />
+    <macros>
+        <import>fastx_macros.xml</import>
+    </macros>
     <command>
-<![CDATA[
-zcat -f < '$input' | fastx_trimmer -v -f $first -l $last -o '$output'
-#if $input.ext == "fastqsanger":
-    -Q 33
-#end if
-]]>
+        <![CDATA[
+        zcat -f < '$input' | fastx_trimmer -v -f $first -l $last -o '$output'
+        #if $input.is_of_type('fastqsanger'):
+            -Q 33
+        #elif $input.is_of_type('fastqillumina') or $input.is_of_type('fastqsolexa'):
+            -Q 64
+        #end if
+        ]]>
     </command>
 
     <inputs>
diff --git a/tool_collections/fastx_toolkit/fastx_trimmer/tool_dependencies.xml b/tool_collections/fastx_toolkit/fastx_trimmer/tool_dependencies.xml
deleted file mode 100644
index 5474ad78..00000000
--- a/tool_collections/fastx_toolkit/fastx_trimmer/tool_dependencies.xml
+++ /dev/null
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository name="package_fastx_toolkit_0_0_13" owner="devteam" />
-    </package>
-</tool_dependency>