model_t5_large.ipynb

{
 "cells": [
  {
   "cell_type": "code",
   "execution_count": 1,
   "id": "fe6bf5ef",
   "metadata": {
    "_cell_guid": "3bf717cb-05ee-4c77-b511-432bdfde2bd8",
    "_uuid": "6e621983-8a5f-4cd5-9b2f-708ee331750c",
    "collapsed": false,
    "execution": {
     "iopub.execute_input": "2023-08-06T08:11:50.764158Z",
     "iopub.status.busy": "2023-08-06T08:11:50.763696Z",
     "iopub.status.idle": "2023-08-06T08:12:22.097458Z",
     "shell.execute_reply": "2023-08-06T08:12:22.096766Z"
    },
    "jupyter": {
     "outputs_hidden": false
    },
    "papermill": {
     "duration": 31.341751,
     "end_time": "2023-08-06T08:12:22.099522",
     "exception": false,
     "start_time": "2023-08-06T08:11:50.757771",
     "status": "completed"
    },
    "tags": []
   },
   "outputs": [
    {
     "name": "stderr",
     "output_type": "stream",
     "text": [
      "/opt/conda/lib/python3.10/site-packages/scipy/__init__.py:146: UserWarning: A NumPy version >=1.16.5 and <1.23.0 is required for this version of SciPy (detected version 1.23.5\n",
      "  warnings.warn(f\"A NumPy version >={np_minversion} and <{np_maxversion}\"\n",
      "/opt/conda/lib/python3.10/site-packages/tensorflow_io/python/ops/__init__.py:98: UserWarning: unable to load libtensorflow_io_plugins.so: unable to open file: libtensorflow_io_plugins.so, from paths: ['/opt/conda/lib/python3.10/site-packages/tensorflow_io/python/ops/libtensorflow_io_plugins.so']\n",
      "caused by: ['/opt/conda/lib/python3.10/site-packages/tensorflow_io/python/ops/libtensorflow_io_plugins.so: undefined symbol: _ZN3tsl6StatusC1EN10tensorflow5error4CodeESt17basic_string_viewIcSt11char_traitsIcEENS_14SourceLocationE']\n",
      "  warnings.warn(f\"unable to load libtensorflow_io_plugins.so: {e}\")\n",
      "/opt/conda/lib/python3.10/site-packages/tensorflow_io/python/ops/__init__.py:104: UserWarning: file system plugins are not loaded: unable to open file: libtensorflow_io.so, from paths: ['/opt/conda/lib/python3.10/site-packages/tensorflow_io/python/ops/libtensorflow_io.so']\n",
      "caused by: ['/opt/conda/lib/python3.10/site-packages/tensorflow_io/python/ops/libtensorflow_io.so: undefined symbol: _ZTVN10tensorflow13GcsFileSystemE']\n",
      "  warnings.warn(f\"file system plugins are not loaded: {e}\")\n"
     ]
    },
    {
     "data": {
      "application/vnd.jupyter.widget-view+json": {
       "model_id": "e5b3b138f19c49f484a93929ee2ea1d2",
       "version_major": 2,
       "version_minor": 0
      },
      "text/plain": [
       "Downloading (…)lve/main/config.json:   0%|          | 0.00/1.21k [00:00<?, ?B/s]"
      ]
     },
     "metadata": {},
     "output_type": "display_data"
    },
    {
     "data": {
      "application/vnd.jupyter.widget-view+json": {
       "model_id": "9367ed2738fc40708ee4117469cac504",
       "version_major": 2,
       "version_minor": 0
      },
      "text/plain": [
       "Downloading (…)ve/main/spiece.model:   0%|          | 0.00/792k [00:00<?, ?B/s]"
      ]
     },
     "metadata": {},
     "output_type": "display_data"
    },
    {
     "data": {
      "application/vnd.jupyter.widget-view+json": {
       "model_id": "7dcb11c789354033aaba288284c85f69",
       "version_major": 2,
       "version_minor": 0
      },
      "text/plain": [
       "Downloading (…)/main/tokenizer.json:   0%|          | 0.00/1.39M [00:00<?, ?B/s]"
      ]
     },
     "metadata": {},
     "output_type": "display_data"
    },
    {
     "name": "stderr",
     "output_type": "stream",
     "text": [
      "/opt/conda/lib/python3.10/site-packages/transformers/models/t5/tokenization_t5_fast.py:155: FutureWarning: This tokenizer was incorrectly instantiated with a model max length of 512 which will be corrected in Transformers v5.\n",
      "For now, this behavior is kept to avoid breaking backwards compatibility when padding/encoding with `truncation is True`.\n",
      "- Be aware that you SHOULD NOT rely on t5-large automatically truncating your input to 512 when padding/encoding.\n",
      "- If you want to encode/pad to sequences longer than 512 you can either instantiate this tokenizer with `model_max_length` or pass `max_length` when encoding/padding.\n",
      "- To avoid this warning, please instantiate this tokenizer with `model_max_length` set to your preferred value.\n",
      "  warnings.warn(\n"
     ]
    },
    {
     "data": {
      "application/vnd.jupyter.widget-view+json": {
       "model_id": "312b9dde8534481e9c1c3cdb2ef69e7d",
       "version_major": 2,
       "version_minor": 0
      },
      "text/plain": [
       "Downloading model.safetensors:   0%|          | 0.00/2.95G [00:00<?, ?B/s]"
      ]
     },
     "metadata": {},
     "output_type": "display_data"
    },
    {
     "data": {
      "application/vnd.jupyter.widget-view+json": {
       "model_id": "34283512144245c48af435b2e51ec2e2",
       "version_major": 2,
       "version_minor": 0
      },
      "text/plain": [
       "Downloading (…)neration_config.json:   0%|          | 0.00/147 [00:00<?, ?B/s]"
      ]
     },
     "metadata": {},
     "output_type": "display_data"
    }
   ],
   "source": [
    "from transformers import pipeline, AutoModelForSeq2SeqLM, AutoTokenizer\n",
    "\n",
    "# Specify the model name and revision\n",
    "model_name = \"t5-large\"\n",
    "model_revision = \"main\"\n",
    "\n",
    "# Load the tokenizer and model\n",
    "tokenizer = AutoTokenizer.from_pretrained(model_name, revision=model_revision)\n",
    "model = AutoModelForSeq2SeqLM.from_pretrained(model_name, revision=model_revision)\n",
    "\n",
    "# Load the summarization pipeline\n",
    "summarizer = pipeline(\"summarization\", model=model, tokenizer=tokenizer)\n",
    "\n",
    "# Use a library like requests to fetch the webpage content\n",
    "import requests\n",
    "from bs4 import BeautifulSoup"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 2,
   "id": "1e4d4f19",
   "metadata": {
    "_cell_guid": "36b16365-32d8-4703-9a11-63f5d55a2058",
    "_uuid": "9135561d-1353-4707-a4a6-0b8774acbc68",
    "collapsed": false,
    "execution": {
     "iopub.execute_input": "2023-08-06T08:12:22.110139Z",
     "iopub.status.busy": "2023-08-06T08:12:22.109493Z",
     "iopub.status.idle": "2023-08-06T08:12:22.117729Z",
     "shell.execute_reply": "2023-08-06T08:12:22.116420Z"
    },
    "jupyter": {
     "outputs_hidden": false
    },
    "papermill": {
     "duration": 0.01585,
     "end_time": "2023-08-06T08:12:22.120102",
     "exception": false,
     "start_time": "2023-08-06T08:12:22.104252",
     "status": "completed"
    },
    "tags": []
   },
   "outputs": [],
   "source": [
    "def info(id):\n",
    "    url = f\"https://parts.igem.org/Part:{id}\"\n",
    "    response = requests.get(url)\n",
    "    soup = BeautifulSoup(response.text, \"html.parser\")\n",
    "    article_text = soup.find(\"div\", id=\"mw-content-text\").get_text()\n",
    "\n",
    "    # Set the maximum length of the summary\n",
    "    max_length = 25  # Adjust this value as needed\n",
    "\n",
    "    # Generate the summary\n",
    "    summary = summarizer(article_text, max_length=max_length, min_length=15, do_sample=False)\n",
    "\n",
    "    return summary[0][\"summary_text\"]"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 3,
   "id": "4ddfbf77",
   "metadata": {
    "_cell_guid": "f9cad045-311e-4fb8-9ec6-a382b63586cd",
    "_uuid": "840b52d5-9ab9-4357-b4ab-d5898505efae",
    "collapsed": false,
    "execution": {
     "iopub.execute_input": "2023-08-06T08:12:22.132958Z",
     "iopub.status.busy": "2023-08-06T08:12:22.132613Z",
     "iopub.status.idle": "2023-08-06T08:12:30.740609Z",
     "shell.execute_reply": "2023-08-06T08:12:30.739604Z"
    },
    "jupyter": {
     "outputs_hidden": false
    },
    "papermill": {
     "duration": 8.61585,
     "end_time": "2023-08-06T08:12:30.742893",
     "exception": false,
     "start_time": "2023-08-06T08:12:22.127043",
     "status": "completed"
    },
    "tags": []
   },
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'this is the promoter activated by the transcriptional regulator xylr in response to detection of environmental '"
      ]
     },
     "execution_count": 3,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "# Example\n",
    "info(\"BBa_I723020\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 4,
   "id": "144d9d7b",
   "metadata": {
    "_cell_guid": "71a84098-bd2b-4a25-9f08-dc0893bcbf44",
    "_uuid": "f59234ac-5983-4c48-9975-78cfc6468219",
    "collapsed": false,
    "execution": {
     "iopub.execute_input": "2023-08-06T08:12:30.753350Z",
     "iopub.status.busy": "2023-08-06T08:12:30.753071Z",
     "iopub.status.idle": "2023-08-06T08:12:30.756899Z",
     "shell.execute_reply": "2023-08-06T08:12:30.756282Z"
    },
    "jupyter": {
     "outputs_hidden": false
    },
    "papermill": {
     "duration": 0.010808,
     "end_time": "2023-08-06T08:12:30.758497",
     "exception": false,
     "start_time": "2023-08-06T08:12:30.747689",
     "status": "completed"
    },
    "tags": []
   },
   "outputs": [],
   "source": [
    "import torch\n",
    "from torch.utils.data import Dataset, DataLoader\n",
    "from torch.nn.utils.rnn import pad_sequence"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 5,
   "id": "bbb4911b",
   "metadata": {
    "_cell_guid": "346bb9ec-121e-4555-9e99-c641a7105cff",
    "_uuid": "88c5e024-afc2-4591-bc00-699a5d67a5e3",
    "collapsed": false,
    "execution": {
     "iopub.execute_input": "2023-08-06T08:12:30.768513Z",
     "iopub.status.busy": "2023-08-06T08:12:30.768255Z",
     "iopub.status.idle": "2023-08-06T08:12:31.216799Z",
     "shell.execute_reply": "2023-08-06T08:12:31.215870Z"
    },
    "jupyter": {
     "outputs_hidden": false
    },
    "papermill": {
     "duration": 0.456069,
     "end_time": "2023-08-06T08:12:31.218949",
     "exception": false,
     "start_time": "2023-08-06T08:12:30.762880",
     "status": "completed"
    },
    "tags": []
   },
   "outputs": [],
   "source": [
    "with open(\"/kaggle/input/biobricks/parts.txt\") as f:\n",
    "    text = f.read()\n",
    "\n",
    "parts_raw = [x.strip() for x in text.split(\">\")][1:]\n",
    "parts = []\n",
    "desc_lens = {}\n",
    "\n",
    "for p in parts_raw:\n",
    "    id = p.split(maxsplit=1)[0]\n",
    "    part_type = p.split(\"\\n\", maxsplit=1)[0].split()[3]\n",
    "    description = p.split('\"', 1)[1].split('\"', 1)[0]\n",
    "\n",
    "    if len(description) not in desc_lens:\n",
    "        desc_lens[len(description)] = 0\n",
    "    desc_lens[len(description)] += 1\n",
    "\n",
    "    parts.append({\n",
    "        \"id\": id,\n",
    "        \"type\": part_type,\n",
    "        \"description\": description\n",
    "    })\n",
    "\n",
    "\n",
    "# Create a plot on the distribution of description lengths\n",
    "\n",
    "# import matplotlib.pyplot as plt\n",
    "\n",
    "# plt.bar(desc_lens.keys(), desc_lens.values())\n",
    "# plt.xlabel(\"Description length\")\n",
    "# plt.ylabel(\"Number of parts\")\n",
    "# plt.title(\"Distribution of description lengths\")\n",
    "# plt.show()\n",
    "\n",
    "\n",
    "# Parts with descriptions of length 0 to 4 (708 such parts)\n",
    "# These are poor descriptions, and should be modified!\n",
    "\n",
    "for_improvement = [x for x in parts if len(x[\"description\"]) < 5]\n",
    "\n",
    "# Parts with descriptions of length over 80 (758 such parts)\n",
    "# These are good descriptions, and should be used for training!\n",
    "\n",
    "for_training = [x for x in parts if len(x[\"description\"]) > 80]"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 6,
   "id": "fb4d8379",
   "metadata": {
    "execution": {
     "iopub.execute_input": "2023-08-06T08:12:31.229517Z",
     "iopub.status.busy": "2023-08-06T08:12:31.229222Z",
     "iopub.status.idle": "2023-08-06T10:03:04.073821Z",
     "shell.execute_reply": "2023-08-06T10:03:04.070798Z"
    },
    "papermill": {
     "duration": 6632.896593,
     "end_time": "2023-08-06T10:03:04.120210",
     "exception": false,
     "start_time": "2023-08-06T08:12:31.223617",
     "status": "completed"
    },
    "tags": []
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "0 BBa_C0090\n",
      "1 BBa_C0400\n",
      "2 BBa_C0420\n",
      "3 BBa_C0600\n",
      "4 BBa_C0620\n",
      "5 BBa_C2030\n",
      "6 BBa_C2031\n",
      "7 BBa_C2032\n",
      "8 BBa_C52934\n",
      "9 BBa_I10010\n",
      "10 BBa_I10101\n",
      "11 BBa_I10652\n",
      "12 BBa_I10777\n",
      "13 BBa_I11000\n",
      "14 BBa_I11010\n",
      "15 BBa_I12205\n",
      "16 BBa_I13700\n",
      "17 BBa_I13701\n",
      "18 BBa_I13702\n",
      "19 BBa_I15006\n",
      "20 BBa_I20533\n",
      "21 BBa_I712002\n",
      "22 BBa_I712024\n",
      "23 BBa_I714005\n"
     ]
    },
    {
     "name": "stderr",
     "output_type": "stream",
     "text": [
      "Your max_length is set to 25, but your input_length is only 13. Since this is a summarization task, where outputs shorter than the input are typically wanted, you might consider decreasing max_length manually, e.g. summarizer('...', max_length=6)\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "24 BBa_I7154\n",
      "25 BBa_I716000\n",
      "26 BBa_I716001\n",
      "27 BBa_I716024\n",
      "28 BBa_I716151\n",
      "29 BBa_I716153\n",
      "30 BBa_I716154\n",
      "31 BBa_I716155\n",
      "32 BBa_I716209\n",
      "33 BBa_I716252\n",
      "34 BBa_I716255\n",
      "35 BBa_I716257\n",
      "36 BBa_I716270\n",
      "37 BBa_I716301\n",
      "38 BBa_I716331\n",
      "39 BBa_I716333\n",
      "40 BBa_I716334\n",
      "41 BBa_I720000\n",
      "42 BBa_I722003\n",
      "43 BBa_I723020\n",
      "44 BBa_I723024\n",
      "45 BBa_I723025\n",
      "46 BBa_I725001\n",
      "47 BBa_I725010\n",
      "48 BBa_I726001\n",
      "49 BBa_I726002\n",
      "50 BBa_I726003\n",
      "51 BBa_I726004\n",
      "52 BBa_I729000\n",
      "53 BBa_I732100\n"
     ]
    },
    {
     "name": "stderr",
     "output_type": "stream",
     "text": [
      "Token indices sequence length is longer than the specified maximum sequence length for this model (525 > 512). Running this sequence through the model will result in indexing errors\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "54 BBa_I732101\n",
      "55 BBa_I732102\n",
      "56 BBa_I732103\n",
      "57 BBa_I732104\n",
      "58 BBa_I732997\n",
      "59 BBa_I741009\n",
      "60 BBa_I741049\n",
      "61 BBa_I741108\n",
      "62 BBa_I742107\n",
      "63 BBa_I745017\n",
      "64 BBa_I745018\n",
      "65 BBa_I766204\n",
      "66 BBa_I766205\n",
      "67 BBa_I766206\n",
      "68 BBa_I766210\n",
      "69 BBa_I769902\n",
      "70 BBa_I769903\n",
      "71 BBa_J01086\n",
      "72 BBa_J01087\n",
      "73 BBa_J01088\n",
      "74 BBa_J01089\n",
      "75 BBa_J01090\n",
      "76 BBa_J01091\n",
      "77 BBa_J05829\n",
      "78 BBa_J07006\n",
      "79 BBa_J07021\n",
      "80 BBa_J07065\n",
      "81 BBa_J125000\n",
      "82 BBa_J125001\n",
      "83 BBa_J17004\n",
      "84 BBa_J176000\n",
      "85 BBa_J176003\n",
      "86 BBa_J176004\n",
      "87 BBa_J176005\n",
      "88 BBa_J176006\n",
      "89 BBa_J176007\n",
      "90 BBa_J176008\n",
      "91 BBa_J176013\n",
      "92 BBa_J176016\n",
      "93 BBa_J176018\n",
      "94 BBa_J176021\n",
      "95 BBa_J176023\n",
      "96 BBa_J176027\n",
      "97 BBa_J176028\n",
      "98 BBa_J176032\n",
      "99 BBa_J176033\n",
      "100 BBa_J176034\n",
      "101 BBa_J176035\n",
      "102 BBa_J176036\n",
      "103 BBa_J176037\n",
      "104 BBa_J18958\n",
      "105 BBa_J18960\n",
      "106 BBa_J212099\n",
      "107 BBa_J212100\n",
      "108 BBa_J212103\n",
      "109 BBa_J22051\n",
      "110 BBa_J22052\n",
      "111 BBa_J29000\n",
      "112 BBa_J29001\n",
      "113 BBa_J29002\n",
      "114 BBa_J290045\n",
      "115 BBa_J29026\n",
      "116 BBa_J29027\n",
      "117 BBa_J29029\n",
      "118 BBa_J29030\n",
      "119 BBa_J29032\n",
      "120 BBa_J29033\n",
      "121 BBa_J29037\n",
      "122 BBa_J29038\n",
      "123 BBa_J29039\n",
      "124 BBa_J29040\n",
      "125 BBa_J29041\n",
      "126 BBa_J29042\n",
      "127 BBa_J29043\n",
      "128 BBa_J29044\n",
      "129 BBa_J29045\n",
      "130 BBa_J29048\n",
      "131 BBa_J29052\n",
      "132 BBa_J32004\n",
      "133 BBa_J32010\n",
      "134 BBa_J32020\n",
      "135 BBa_J32021\n",
      "136 BBa_J32023\n",
      "137 BBa_J33202\n",
      "138 BBa_J37013\n",
      "139 BBa_J40002\n",
      "140 BBa_J45987\n",
      "141 BBa_J45991\n",
      "142 BBa_J47500\n",
      "143 BBa_J51000\n",
      "144 BBa_J51001\n",
      "145 BBa_J52001\n",
      "146 BBa_J52002\n",
      "147 BBa_J52025\n",
      "148 BBa_J52990\n",
      "149 BBa_J52996\n",
      "150 BBa_J54001\n",
      "151 BBa_J54002\n",
      "152 BBa_J54004\n",
      "153 BBa_J54011\n",
      "154 BBa_J54012\n",
      "155 BBa_J5515\n",
      "156 BBa_J5532\n",
      "157 BBa_J5759\n",
      "158 BBa_J58000\n",
      "159 BBa_J59001\n",
      "160 BBa_J64006\n",
      "161 BBa_J64007\n",
      "162 BBa_J64805\n",
      "163 BBa_J64806\n",
      "164 BBa_J64991\n",
      "165 BBa_J69998\n",
      "166 BBa_J69999\n",
      "167 BBa_J70578\n",
      "168 BBa_J70598\n",
      "169 BBa_J70599\n",
      "170 BBa_J70600\n",
      "171 BBa_J70601\n",
      "172 BBa_J70602\n",
      "173 BBa_J70603\n",
      "174 BBa_J72139\n",
      "175 BBa_J92213\n",
      "176 BBa_J96013\n",
      "177 BBa_J96017\n",
      "178 BBa_J96023\n",
      "179 BBa_J96026\n",
      "180 BBa_J96031\n",
      "181 BBa_J96035\n",
      "182 BBa_J96036\n",
      "183 BBa_J96037\n",
      "184 BBa_J96039\n",
      "185 BBa_J96040\n",
      "186 BBa_J96041\n",
      "187 BBa_J96042\n",
      "188 BBa_J96043\n",
      "189 BBa_J96044\n",
      "190 BBa_J96045\n",
      "191 BBa_K076002\n",
      "192 BBa_K076004\n",
      "193 BBa_K076009\n",
      "194 BBa_K078102\n",
      "195 BBa_K079012\n",
      "196 BBa_K079013\n",
      "197 BBa_K079022\n",
      "198 BBa_K079025\n",
      "199 BBa_K079027\n",
      "200 BBa_K079028\n",
      "201 BBa_K079033\n",
      "202 BBa_K079034\n",
      "203 BBa_K079035\n",
      "204 BBa_K091109\n",
      "205 BBa_K091156\n",
      "206 BBa_K092902\n",
      "207 BBa_K094001\n",
      "208 BBa_K094113\n",
      "209 BBa_K103010\n",
      "210 BBa_K104000\n",
      "211 BBa_K1051501\n",
      "212 BBa_K106026\n",
      "213 BBa_K108000\n",
      "214 BBa_K108001\n",
      "215 BBa_K108002\n",
      "216 BBa_K108003\n",
      "217 BBa_K108004\n",
      "218 BBa_K108005\n",
      "219 BBa_K108006\n",
      "220 BBa_K108007\n",
      "221 BBa_K108008\n",
      "222 BBa_K108009\n",
      "223 BBa_K108010\n",
      "224 BBa_K108011\n",
      "225 BBa_K108012\n",
      "226 BBa_K108013\n",
      "227 BBa_K108014\n",
      "228 BBa_K108015\n",
      "229 BBa_K108016\n",
      "230 BBa_K108017\n",
      "231 BBa_K108019\n",
      "232 BBa_K108020\n",
      "233 BBa_K108021\n",
      "234 BBa_K108022\n",
      "235 BBa_K108023\n",
      "236 BBa_K108024\n",
      "237 BBa_K108025\n",
      "238 BBa_K108026\n",
      "239 BBa_K108027\n",
      "240 BBa_K108028\n",
      "241 BBa_K108029\n",
      "242 BBa_K112900\n",
      "243 BBa_K112901\n",
      "244 BBa_K112907\n",
      "245 BBa_K113006\n",
      "246 BBa_K113020\n",
      "247 BBa_K121000\n",
      "248 BBa_K121005\n",
      "249 BBa_K121006\n",
      "250 BBa_K121097\n",
      "251 BBa_K121098\n",
      "252 BBa_K121099\n",
      "253 BBa_K121998\n",
      "254 BBa_K123003\n",
      "255 BBa_K125505\n",
      "256 BBa_K130000\n",
      "257 BBa_K130001\n",
      "258 BBa_K132018\n",
      "259 BBa_K133016\n",
      "260 BBa_K133025\n",
      "261 BBa_K133052\n",
      "262 BBa_K133057\n",
      "263 BBa_K133059\n",
      "264 BBa_K133066\n",
      "265 BBa_K133071\n",
      "266 BBa_K133140\n",
      "267 BBa_K134900\n",
      "268 BBa_K137000\n",
      "269 BBa_K137001\n",
      "270 BBa_K137007\n",
      "271 BBa_K137015\n",
      "272 BBa_K137052\n",
      "273 BBa_K137067\n",
      "274 BBa_K137111\n",
      "275 BBa_K137112\n",
      "276 BBa_K137113\n",
      "277 BBa_K141000\n",
      "278 BBa_K141001\n",
      "279 BBa_K142077\n",
      "280 BBa_K147000\n",
      "281 BBa_K147002\n",
      "282 BBa_K147003\n",
      "283 BBa_K149000\n",
      "284 BBa_K150006\n",
      "285 BBa_K150108\n",
      "286 BBa_K153006\n",
      "287 BBa_K157043\n",
      "288 BBa_K174010\n",
      "289 BBa_K177045\n",
      "290 BBa_K185013\n",
      "291 BBa_K185021\n",
      "292 BBa_K187028\n",
      "293 BBa_K187030\n",
      "294 BBa_K187031\n",
      "295 BBa_K187032\n",
      "296 BBa_K188004\n",
      "297 BBa_K188009\n",
      "298 BBa_K188027\n",
      "299 BBa_K188028\n",
      "300 BBa_K188341\n",
      "301 BBa_K188661\n",
      "302 BBa_K188774\n",
      "303 BBa_K188777\n",
      "304 BBa_K188778\n",
      "305 BBa_K188779\n",
      "306 BBa_K188900\n",
      "307 BBa_K188901\n",
      "308 BBa_K188902\n",
      "309 BBa_K188903\n",
      "310 BBa_K188904\n",
      "311 BBa_K188905\n",
      "312 BBa_K190001\n",
      "313 BBa_K190004\n",
      "314 BBa_K190014\n",
      "315 BBa_K190018\n",
      "316 BBa_K190019\n",
      "317 BBa_K190020\n",
      "318 BBa_K190021\n",
      "319 BBa_K190028\n",
      "320 BBa_K191000\n",
      "321 BBa_K194999\n",
      "322 BBa_K197021\n",
      "323 BBa_K197022\n",
      "324 BBa_K197023\n",
      "325 BBa_K200003\n",
      "326 BBa_K200004\n",
      "327 BBa_K206108\n",
      "328 BBa_K208000\n",
      "329 BBa_K211001\n",
      "330 BBa_K223038\n",
      "331 BBa_K237007\n",
      "332 BBa_K238008\n",
      "333 BBa_K238009\n",
      "334 BBa_K238010\n",
      "335 BBa_K238024\n",
      "336 BBa_K243030\n",
      "337 BBa_K243031\n",
      "338 BBa_K243033\n",
      "339 BBa_K243037\n",
      "340 BBa_K245001\n",
      "341 BBa_K245021\n",
      "342 BBa_K245022\n",
      "343 BBa_K245024\n",
      "344 BBa_K245025\n",
      "345 BBa_K245026\n",
      "346 BBa_K245027\n",
      "347 BBa_K245028\n",
      "348 BBa_K245029\n",
      "349 BBa_K245030\n",
      "350 BBa_K245031\n",
      "351 BBa_K245038\n",
      "352 BBa_K245039\n",
      "353 BBa_K245042\n",
      "354 BBa_K245046\n",
      "355 BBa_K245114\n",
      "356 BBa_K245116\n",
      "357 BBa_K245118\n",
      "358 BBa_K245119\n",
      "359 BBa_K245120\n",
      "360 BBa_K245121\n",
      "361 BBa_K245122\n",
      "362 BBa_K245123\n",
      "363 BBa_K245124\n",
      "364 BBa_K245125\n",
      "365 BBa_K245126\n",
      "366 BBa_K245127\n",
      "367 BBa_K245128\n",
      "368 BBa_K245130\n",
      "369 BBa_K245131\n",
      "370 BBa_K245132\n",
      "371 BBa_K245133\n",
      "372 BBa_K245134\n",
      "373 BBa_K245135\n",
      "374 BBa_K245138\n",
      "375 BBa_K245139\n",
      "376 BBa_K245140\n",
      "377 BBa_K249016\n",
      "378 BBa_K252015\n",
      "379 BBa_K256004\n",
      "380 BBa_K266013\n",
      "381 BBa_K269000\n",
      "382 BBa_K269001\n",
      "383 BBa_K269002\n",
      "384 BBa_K269003\n",
      "385 BBa_K270005\n",
      "386 BBa_K273020\n",
      "387 BBa_K273021\n",
      "388 BBa_K273022\n",
      "389 BBa_K273023\n",
      "390 BBa_K273024\n",
      "391 BBa_K273025\n",
      "392 BBa_K273026\n",
      "393 BBa_K273027\n",
      "394 BBa_K273028\n",
      "395 BBa_K273029\n",
      "396 BBa_K273030\n",
      "397 BBa_K273031\n"
     ]
    },
    {
     "name": "stderr",
     "output_type": "stream",
     "text": [
      "Your max_length is set to 25, but your input_length is only 3. Since this is a summarization task, where outputs shorter than the input are typically wanted, you might consider decreasing max_length manually, e.g. summarizer('...', max_length=1)\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "398 BBa_K289002\n",
      "399 BBa_K289003\n",
      "400 BBa_K289005\n",
      "401 BBa_K289007\n",
      "402 BBa_K294060\n",
      "403 BBa_K294120\n",
      "404 BBa_K294206\n",
      "405 BBa_K294354\n",
      "406 BBa_K294898\n",
      "407 BBa_K294902\n",
      "408 BBa_K302006\n",
      "409 BBa_K302007\n",
      "410 BBa_K302008\n",
      "411 BBa_K302009\n",
      "412 BBa_K302010\n",
      "413 BBa_K302011\n",
      "414 BBa_K302019\n",
      "415 BBa_K302023\n",
      "416 BBa_K302024\n",
      "417 BBa_K302025\n",
      "418 BBa_K302026\n",
      "419 BBa_K302027\n",
      "420 BBa_K302028\n",
      "421 BBa_K302029\n",
      "422 BBa_K302032\n",
      "423 BBa_K302033\n",
      "424 BBa_K305000\n",
      "425 BBa_K307101\n",
      "426 BBa_K307102\n",
      "427 BBa_K307105\n",
      "428 BBa_K307106\n",
      "429 BBa_K309099\n",
      "430 BBa_K310018\n",
      "431 BBa_K314011\n",
      "432 BBa_K314444\n",
      "433 BBa_K314560\n",
      "434 BBa_K317035\n",
      "435 BBa_K317998\n",
      "436 BBa_K317999\n",
      "437 BBa_K318516\n",
      "438 BBa_K319033\n",
      "439 BBa_K320015\n",
      "440 BBa_K320016\n",
      "441 BBa_K320999\n",
      "442 BBa_K323104\n",
      "443 BBa_K323129\n",
      "444 BBa_K323137\n",
      "445 BBa_K323140\n",
      "446 BBa_K323141\n",
      "447 BBa_K323142\n",
      "448 BBa_K323143\n",
      "449 BBa_K323144\n",
      "450 BBa_K336054\n",
      "451 BBa_K341453\n",
      "452 BBa_K341717\n",
      "453 BBa_K341718\n",
      "454 BBa_K341719\n",
      "455 BBa_K341720\n",
      "456 BBa_K361010\n",
      "457 BBa_K364202\n",
      "458 BBa_K364300\n",
      "459 BBa_K371037\n",
      "460 BBa_K371037\n",
      "461 BBa_K371039\n",
      "462 BBa_K371040\n",
      "463 BBa_K371056\n",
      "464 BBa_K371060\n"
     ]
    },
    {
     "name": "stderr",
     "output_type": "stream",
     "text": [
      "Your max_length is set to 25, but your input_length is only 3. Since this is a summarization task, where outputs shorter than the input are typically wanted, you might consider decreasing max_length manually, e.g. summarizer('...', max_length=1)\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "465 BBa_K377700\n",
      "466 BBa_K377703\n",
      "467 BBa_K377704\n",
      "468 BBa_K387008\n",
      "469 BBa_K392029\n",
      "470 BBa_K398100\n",
      "471 BBa_K398200\n",
      "472 BBa_K398201\n",
      "473 BBa_K398300\n",
      "474 BBa_K404245\n",
      "475 BBa_K404249\n",
      "476 BBa_K404307\n",
      "477 BBa_K404316\n",
      "478 BBa_K419007\n",
      "479 BBa_K419009\n",
      "480 BBa_K426003\n",
      "481 BBa_K426006\n",
      "482 BBa_K426007\n",
      "483 BBa_K500005\n",
      "484 BBa_K500006\n",
      "485 BBa_K500007\n",
      "486 BBa_K500008\n",
      "487 BBa_K509005\n",
      "488 BBa_K510034\n",
      "489 BBa_K510035\n",
      "490 BBa_K512000\n",
      "491 BBa_K518005\n",
      "492 BBa_K519004\n",
      "493 BBa_K519005\n",
      "494 BBa_K519010\n",
      "495 BBa_K524204\n",
      "496 BBa_K530001\n",
      "497 BBa_K530002\n",
      "498 BBa_K530025\n",
      "499 BBa_K530026\n",
      "500 BBa_K530027\n",
      "501 BBa_K539413\n",
      "502 BBa_K539513\n",
      "503 BBa_K545005\n",
      "504 BBa_K545006\n",
      "505 BBa_K549010\n",
      "506 BBa_K554003\n",
      "507 BBa_K554004\n",
      "508 BBa_K554005\n",
      "509 BBa_K554009\n",
      "510 BBa_K564000\n",
      "511 BBa_K566027\n",
      "512 BBa_K566028\n",
      "513 BBa_K567020\n",
      "514 BBa_K569011\n",
      "515 BBa_K569017\n",
      "516 BBa_K575003\n",
      "517 BBa_K584017\n",
      "518 BBa_K587000\n",
      "519 BBa_K588000\n",
      "520 BBa_K588001\n",
      "521 BBa_K590080\n",
      "522 BBa_K590081\n",
      "523 BBa_K592002\n",
      "524 BBa_K607015\n",
      "525 BBa_K628004\n",
      "526 BBa_K631039\n",
      "527 BBa_K634000\n",
      "528 BBa_K634001\n",
      "529 BBa_K641000\n",
      "530 BBa_K648035\n",
      "531 BBa_K648036\n",
      "532 BBa_K648037\n",
      "533 BBa_K648038\n",
      "534 BBa_K648124\n",
      "535 BBa_K649010\n",
      "536 BBa_K649901\n",
      "537 BBa_K660004\n",
      "538 BBa_K669000\n",
      "539 BBa_K669001\n",
      "540 BBa_K669002\n",
      "541 BBa_K678070\n",
      "542 BBa_K726004\n",
      "543 BBa_K726006\n",
      "544 BBa_K726013\n",
      "545 BBa_K764002\n",
      "546 BBa_K764003\n",
      "547 BBa_K764004\n",
      "548 BBa_K764007\n",
      "549 BBa_K769100\n",
      "550 BBa_K769101\n",
      "551 BBa_K769200\n",
      "552 BBa_K769201\n",
      "553 BBa_K769203\n",
      "554 BBa_K769205\n",
      "555 BBa_K771301\n",
      "556 BBa_K771302\n",
      "557 BBa_K771303\n",
      "558 BBa_K771304\n",
      "559 BBa_K776004\n",
      "560 BBa_K776005\n",
      "561 BBa_K777109\n",
      "562 BBa_K777113\n",
      "563 BBa_K777117\n",
      "564 BBa_K777121\n",
      "565 BBa_K787001\n",
      "566 BBa_K798018\n",
      "567 BBa_K805013\n",
      "568 BBa_K805014\n",
      "569 BBa_K805016\n",
      "570 BBa_K817001\n",
      "571 BBa_K817004\n",
      "572 BBa_K817005\n",
      "573 BBa_K817006\n",
      "574 BBa_K821000\n",
      "575 BBa_K821999\n",
      "576 BBa_K826008\n",
      "577 BBa_K826009\n",
      "578 BBa_K826010\n",
      "579 BBa_K835001\n",
      "580 BBa_K838004\n",
      "581 BBa_K842000\n",
      "582 BBa_K842001\n",
      "583 BBa_K842002\n",
      "584 BBa_K842003\n",
      "585 BBa_K842004\n",
      "586 BBa_K842005\n",
      "587 BBa_K842006\n",
      "588 BBa_K842007\n",
      "589 BBa_K842008\n",
      "590 BBa_K842009\n",
      "591 BBa_K842010\n",
      "592 BBa_K842011\n",
      "593 BBa_K842012\n",
      "594 BBa_K851003\n",
      "595 BBa_K858000\n",
      "596 BBa_K858004\n",
      "597 BBa_K864204\n",
      "598 BBa_K864680\n",
      "599 BBa_K875003\n",
      "600 BBa_K879011\n",
      "601 BBa_K879017\n",
      "602 BBa_K879018\n",
      "603 BBa_K879927\n",
      "604 BBa_K879928\n",
      "605 BBa_K892008\n",
      "606 BBa_K892009\n",
      "607 BBa_K892010\n",
      "608 BBa_K892016\n",
      "609 BBa_K892101\n",
      "610 BBa_K902010\n",
      "611 BBa_K902011\n",
      "612 BBa_K902068\n",
      "613 BBa_K902069\n",
      "614 BBa_K918012\n",
      "615 BBa_K934027\n",
      "616 BBa_K950005\n",
      "617 BBa_M1011\n",
      "618 BBa_M11301\n",
      "619 BBa_M11302\n",
      "620 BBa_M11304\n",
      "621 BBa_M11305\n",
      "622 BBa_M11306\n",
      "623 BBa_M11307\n",
      "624 BBa_M11308\n",
      "625 BBa_M11309\n",
      "626 BBa_M11310\n",
      "627 BBa_M11311\n",
      "628 BBa_M11312\n",
      "629 BBa_M11313\n",
      "630 BBa_M11314\n",
      "631 BBa_M11315\n",
      "632 BBa_M11316\n",
      "633 BBa_M11317\n",
      "634 BBa_M11318\n",
      "635 BBa_M1145\n",
      "636 BBa_M1147\n",
      "637 BBa_M11560\n",
      "638 BBa_M11561\n",
      "639 BBa_M11563\n",
      "640 BBa_M11564\n",
      "641 BBa_M11565\n",
      "642 BBa_M11566\n",
      "643 BBa_M11567\n",
      "644 BBa_M1160\n",
      "645 BBa_M1161\n",
      "646 BBa_M1166\n",
      "647 BBa_M1167\n",
      "648 BBa_M1173\n",
      "649 BBa_M1176\n",
      "650 BBa_M1177\n",
      "651 BBa_M1182\n",
      "652 BBa_M1185\n",
      "653 BBa_M1188\n",
      "654 BBa_M1189\n",
      "655 BBa_M1190\n",
      "656 BBa_M1191\n",
      "657 BBa_M1199\n",
      "658 BBa_M12067\n",
      "659 BBa_M1298\n",
      "660 BBa_M1299\n",
      "661 BBa_M1300\n",
      "662 BBa_M1311\n",
      "663 BBa_M1355\n",
      "664 BBa_M1356\n",
      "665 BBa_M1398\n",
      "666 BBa_M1399\n",
      "667 BBa_M1401\n",
      "668 BBa_M1402\n",
      "669 BBa_M1409\n",
      "670 BBa_M1414\n",
      "671 BBa_M1440\n",
      "672 BBa_M1526\n",
      "673 BBa_M1527\n",
      "674 BBa_M1619\n",
      "675 BBa_M1699\n",
      "676 BBa_M1839\n",
      "677 BBa_M1843\n",
      "678 BBa_M1845\n",
      "679 BBa_M1871\n",
      "680 BBa_M1872\n",
      "681 BBa_M1887\n",
      "682 BBa_M1888\n",
      "683 BBa_M1989\n",
      "684 BBa_M1990\n",
      "685 BBa_M1991\n",
      "686 BBa_M1998\n",
      "687 BBa_M300067\n",
      "688 BBa_M300068\n",
      "689 BBa_M36005\n",
      "690 BBa_M36113\n",
      "691 BBa_M36123\n",
      "692 BBa_M36711\n",
      "693 BBa_M39008\n",
      "694 BBa_M39009\n",
      "695 BBa_M39013\n",
      "696 BBa_M39015\n",
      "697 BBa_M39017\n",
      "698 BBa_M39903\n",
      "699 BBa_Q00121\n",
      "700 BBa_Q00400\n",
      "701 BBa_Q02121\n",
      "702 BBa_Q02400\n",
      "703 BBa_T3000\n",
      "704 BBa_T4000\n",
      "705 BBa_V1001\n",
      "706 BBa_Y1005\n",
      "707 BBa_Z52934\n"
     ]
    }
   ],
   "source": [
    "# Add website summaries to both these datasets\n",
    "\n",
    "for i, p in enumerate(for_improvement):\n",
    "    p[\"info\"] = info(p[\"id\"])\n",
    "    print(i, p[\"id\"])"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 7,
   "id": "b63dcb2b",
   "metadata": {
    "_cell_guid": "4ab3e36b-50fe-48e2-9a20-a20c76a4d2dc",
    "_uuid": "9d8a18dc-55a5-498f-9881-6c333dda4458",
    "collapsed": false,
    "execution": {
     "iopub.execute_input": "2023-08-06T10:03:04.212438Z",
     "iopub.status.busy": "2023-08-06T10:03:04.211589Z",
     "iopub.status.idle": "2023-08-06T13:28:10.292703Z",
     "shell.execute_reply": "2023-08-06T13:28:10.289263Z"
    },
    "jupyter": {
     "outputs_hidden": false
    },
    "papermill": {
     "duration": 12306.134265,
     "end_time": "2023-08-06T13:28:10.297418",
     "exception": false,
     "start_time": "2023-08-06T10:03:04.163153",
     "status": "completed"
    },
    "tags": []
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "0 BBa_C0060\n",
      "1 BBa_C0080\n",
      "2 BBa_E0033\n",
      "3 BBa_E0035\n",
      "4 BBa_E0040\n",
      "5 BBa_E0044\n",
      "6 BBa_E1010\n",
      "7 BBa_G00200\n",
      "8 BBa_I12040\n",
      "9 BBa_I12046\n",
      "10 BBa_I12047\n",
      "11 BBa_I13035\n",
      "12 BBa_I13940\n",
      "13 BBa_I13941\n",
      "14 BBa_I13942\n",
      "15 BBa_I13943\n",
      "16 BBa_I20248\n",
      "17 BBa_I20249\n",
      "18 BBa_I20250\n",
      "19 BBa_I20251\n",
      "20 BBa_I20257\n",
      "21 BBa_I3000\n",
      "22 BBa_I3001\n",
      "23 BBa_I3002\n",
      "24 BBa_I3420\n",
      "25 BBa_I3421\n",
      "26 BBa_I3422\n",
      "27 BBa_I3423\n",
      "28 BBa_I3424\n",
      "29 BBa_I3425\n",
      "30 BBa_I3521\n",
      "31 BBa_I3522\n",
      "32 BBa_I3600\n",
      "33 BBa_I711022\n",
      "34 BBa_I711034\n",
      "35 BBa_I712016\n",
      "36 BBa_I712028\n",
      "37 BBa_I716183\n",
      "38 BBa_I716184\n",
      "39 BBa_I716377\n",
      "40 BBa_I716378\n",
      "41 BBa_I716380\n",
      "42 BBa_I716381\n",
      "43 BBa_I731014\n",
      "44 BBa_I735010\n",
      "45 BBa_I739007\n",
      "46 BBa_I741016\n",
      "47 BBa_I741017\n",
      "48 BBa_I741107\n",
      "49 BBa_I746008\n",
      "50 BBa_I746101\n",
      "51 BBa_I746103\n",
      "52 BBa_I765002\n",
      "53 BBa_I765003\n",
      "54 BBa_J01025\n",
      "55 BBa_J01056\n",
      "56 BBa_J01062\n",
      "57 BBa_J01102\n",
      "58 BBa_J01105\n",
      "59 BBa_J04700\n",
      "60 BBa_J04800\n",
      "61 BBa_J04900\n",
      "62 BBa_J06551\n",
      "63 BBa_J06571\n",
      "64 BBa_J06574\n",
      "65 BBa_J06610\n",
      "66 BBa_J06611\n",
      "67 BBa_J06612\n",
      "68 BBa_J06628\n",
      "69 BBa_J06629\n",
      "70 BBa_J120014\n",
      "71 BBa_J120024\n",
      "72 BBa_J120025\n",
      "73 BBa_J120029\n",
      "74 BBa_J120030\n",
      "75 BBa_J120031\n",
      "76 BBa_J23040\n",
      "77 BBa_J23120\n",
      "78 BBa_J24717\n",
      "79 BBa_J24718\n",
      "80 BBa_J24719\n",
      "81 BBa_J24823\n",
      "82 BBa_J31016\n",
      "83 BBa_J36849\n",
      "84 BBa_J36851\n",
      "85 BBa_J37017\n",
      "86 BBa_J45001\n",
      "87 BBa_J45002\n",
      "88 BBa_J45003\n",
      "89 BBa_J45004\n",
      "90 BBa_J45005\n",
      "91 BBa_J45007\n",
      "92 BBa_J45008\n",
      "93 BBa_J45009\n",
      "94 BBa_J45011\n",
      "95 BBa_J45013\n",
      "96 BBa_J45014\n",
      "97 BBa_J45017\n",
      "98 BBa_J48104\n",
      "99 BBa_J52008\n",
      "100 BBa_J52028\n",
      "101 BBa_J58011\n",
      "102 BBa_J64713\n",
      "103 BBa_J64714\n",
      "104 BBa_J64804\n",
      "105 BBa_J70032\n",
      "106 BBa_J70034\n",
      "107 BBa_J70036\n",
      "108 BBa_J70040\n",
      "109 BBa_J70604\n",
      "110 BBa_J70635\n",
      "111 BBa_J72096\n",
      "112 BBa_J72099\n",
      "113 BBa_J72101\n",
      "114 BBa_J72102\n",
      "115 BBa_J72103\n",
      "116 BBa_J72104\n",
      "117 BBa_J72106\n",
      "118 BBa_J72115\n",
      "119 BBa_J72116\n",
      "120 BBa_K078004\n",
      "121 BBa_K078005\n",
      "122 BBa_K078007\n",
      "123 BBa_K079020\n",
      "124 BBa_K079021\n",
      "125 BBa_K079024\n",
      "126 BBa_K079026\n",
      "127 BBa_K079049\n",
      "128 BBa_K079050\n",
      "129 BBa_K079051\n",
      "130 BBa_K079052\n",
      "131 BBa_K086001\n",
      "132 BBa_K086002\n",
      "133 BBa_K086003\n",
      "134 BBa_K086004\n",
      "135 BBa_K086005\n",
      "136 BBa_K086006\n",
      "137 BBa_K086007\n",
      "138 BBa_K086008\n",
      "139 BBa_K086009\n",
      "140 BBa_K086010\n",
      "141 BBa_K086011\n",
      "142 BBa_K086012\n",
      "143 BBa_K086013\n",
      "144 BBa_K086014\n",
      "145 BBa_K086015\n",
      "146 BBa_K086016\n",
      "147 BBa_K086020\n",
      "148 BBa_K086021\n",
      "149 BBa_K086022\n",
      "150 BBa_K086023\n",
      "151 BBa_K086024\n",
      "152 BBa_K086025\n",
      "153 BBa_K086026\n",
      "154 BBa_K086027\n",
      "155 BBa_K086028\n",
      "156 BBa_K086029\n",
      "157 BBa_K086030\n",
      "158 BBa_K086031\n",
      "159 BBa_K086032\n",
      "160 BBa_K086033\n",
      "161 BBa_K092700\n",
      "162 BBa_K092800\n",
      "163 BBa_K092900\n",
      "164 BBa_K103006\n",
      "165 BBa_K1051350\n",
      "166 BBa_K1051351\n",
      "167 BBa_K1051352\n",
      "168 BBa_K1051353\n",
      "169 BBa_K1051354\n",
      "170 BBa_K1051355\n",
      "171 BBa_K1051356\n",
      "172 BBa_K1051357\n",
      "173 BBa_K1051358\n",
      "174 BBa_K1051359\n",
      "175 BBa_K1051360\n",
      "176 BBa_K1051361\n",
      "177 BBa_K1051362\n",
      "178 BBa_K1051363\n",
      "179 BBa_K1051364\n",
      "180 BBa_K1051365\n",
      "181 BBa_K1051366\n",
      "182 BBa_K1051367\n",
      "183 BBa_K1051368\n",
      "184 BBa_K1051369\n",
      "185 BBa_K1051370\n",
      "186 BBa_K1051371\n",
      "187 BBa_K1051372\n",
      "188 BBa_K1051373\n",
      "189 BBa_K1051374\n",
      "190 BBa_K1088000\n"
     ]
    },
    {
     "name": "stderr",
     "output_type": "stream",
     "text": [
      "Your max_length is set to 25, but your input_length is only 3. Since this is a summarization task, where outputs shorter than the input are typically wanted, you might consider decreasing max_length manually, e.g. summarizer('...', max_length=1)\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "191 BBa_K1088002\n",
      "192 BBa_K112203\n",
      "193 BBa_K112204\n",
      "194 BBa_K112205\n",
      "195 BBa_K112211\n",
      "196 BBa_K112212\n",
      "197 BBa_K112217\n",
      "198 BBa_K112223\n",
      "199 BBa_K112234\n",
      "200 BBa_K112246\n",
      "201 BBa_K112248\n",
      "202 BBa_K112361\n",
      "203 BBa_K112362\n",
      "204 BBa_K112363\n",
      "205 BBa_K112369\n",
      "206 BBa_K112370\n",
      "207 BBa_K112371\n",
      "208 BBa_K113021\n",
      "209 BBa_K125000\n",
      "210 BBa_K127003\n",
      "211 BBa_K132025\n",
      "212 BBa_K137083\n",
      "213 BBa_K137084\n",
      "214 BBa_K137085\n",
      "215 BBa_K137086\n",
      "216 BBa_K137087\n",
      "217 BBa_K137088\n",
      "218 BBa_K137089\n",
      "219 BBa_K137090\n",
      "220 BBa_K137091\n",
      "221 BBa_K137101\n",
      "222 BBa_K137102\n",
      "223 BBa_K137107\n",
      "224 BBa_K137108\n",
      "225 BBa_K142024\n",
      "226 BBa_K142025\n",
      "227 BBa_K142026\n",
      "228 BBa_K142027\n",
      "229 BBa_K142028\n",
      "230 BBa_K142029\n",
      "231 BBa_K142030\n",
      "232 BBa_K142031\n",
      "233 BBa_K142048\n",
      "234 BBa_K157001\n",
      "235 BBa_K157010\n",
      "236 BBa_K165091\n",
      "237 BBa_K165101\n",
      "238 BBa_K175006\n",
      "239 BBa_K175034\n",
      "240 BBa_K175035\n",
      "241 BBa_K175050\n",
      "242 BBa_K176026\n",
      "243 BBa_K176028\n",
      "244 BBa_K176029\n",
      "245 BBa_K176030\n",
      "246 BBa_K176031\n",
      "247 BBa_K176032\n",
      "248 BBa_K176036\n",
      "249 BBa_K176080\n",
      "250 BBa_K176089\n",
      "251 BBa_K176090\n",
      "252 BBa_K176091\n",
      "253 BBa_K176092\n",
      "254 BBa_K176093\n",
      "255 BBa_K176094\n",
      "256 BBa_K176095\n",
      "257 BBa_K176096\n",
      "258 BBa_K176097\n",
      "259 BBa_K176098\n",
      "260 BBa_K176115\n",
      "261 BBa_K176116\n",
      "262 BBa_K176117\n",
      "263 BBa_K176118\n",
      "264 BBa_K176119\n",
      "265 BBa_K176120\n",
      "266 BBa_K176121\n",
      "267 BBa_K176122\n",
      "268 BBa_K176123\n",
      "269 BBa_K176124\n",
      "270 BBa_K176125\n",
      "271 BBa_K176126\n",
      "272 BBa_K176127\n",
      "273 BBa_K176128\n",
      "274 BBa_K176129\n",
      "275 BBa_K176130\n",
      "276 BBa_K176131\n",
      "277 BBa_K176132\n",
      "278 BBa_K176133\n",
      "279 BBa_K176134\n",
      "280 BBa_K176146\n",
      "281 BBa_K176147\n",
      "282 BBa_K176149\n",
      "283 BBa_K176150\n",
      "284 BBa_K176152\n",
      "285 BBa_K176153\n",
      "286 BBa_K176155\n",
      "287 BBa_K176156\n",
      "288 BBa_K176168\n",
      "289 BBa_K176169\n",
      "290 BBa_K176170\n",
      "291 BBa_K176171\n",
      "292 BBa_K176172\n",
      "293 BBa_K176173\n",
      "294 BBa_K176174\n",
      "295 BBa_K176185\n",
      "296 BBa_K176186\n",
      "297 BBa_K176187\n",
      "298 BBa_K176188\n",
      "299 BBa_K176195\n",
      "300 BBa_K176196\n",
      "301 BBa_K176197\n",
      "302 BBa_K176198\n",
      "303 BBa_K176199\n",
      "304 BBa_K176200\n",
      "305 BBa_K176201\n",
      "306 BBa_K176202\n",
      "307 BBa_K176203\n",
      "308 BBa_K176204\n",
      "309 BBa_K176205\n",
      "310 BBa_K176206\n",
      "311 BBa_K176207\n",
      "312 BBa_K176208\n",
      "313 BBa_K176209\n",
      "314 BBa_K176210\n",
      "315 BBa_K176211\n",
      "316 BBa_K176212\n",
      "317 BBa_K176213\n",
      "318 BBa_K176214\n",
      "319 BBa_K176215\n",
      "320 BBa_K176216\n",
      "321 BBa_K176240\n",
      "322 BBa_K176247\n",
      "323 BBa_K176248\n",
      "324 BBa_K176249\n",
      "325 BBa_K177044\n",
      "326 BBa_K180005\n",
      "327 BBa_K182002\n",
      "328 BBa_K182003\n",
      "329 BBa_K182100\n",
      "330 BBa_K185033\n",
      "331 BBa_K185053\n",
      "332 BBa_K188006\n",
      "333 BBa_K193207\n",
      "334 BBa_K193208\n",
      "335 BBa_K196005\n",
      "336 BBa_K197032\n",
      "337 BBa_K197034\n",
      "338 BBa_K202004\n",
      "339 BBa_K223034\n",
      "340 BBa_K233001\n",
      "341 BBa_K233002\n",
      "342 BBa_K233306\n",
      "343 BBa_K233307\n",
      "344 BBa_K235019\n",
      "345 BBa_K235022\n",
      "346 BBa_K235024\n",
      "347 BBa_K235025\n",
      "348 BBa_K235033\n",
      "349 BBa_K235034\n",
      "350 BBa_K235035\n",
      "351 BBa_K235036\n",
      "352 BBa_K235037\n",
      "353 BBa_K237001\n",
      "354 BBa_K237002\n",
      "355 BBa_K237003\n",
      "356 BBa_K237004\n",
      "357 BBa_K237006\n",
      "358 BBa_K257000\n",
      "359 BBa_K258007\n",
      "360 BBa_K258008\n",
      "361 BBa_K258012\n",
      "362 BBa_K259002\n",
      "363 BBa_K259004\n",
      "364 BBa_K259008\n",
      "365 BBa_K259009\n",
      "366 BBa_K272500\n",
      "367 BBa_K272501\n",
      "368 BBa_K272991\n",
      "369 BBa_K273001\n",
      "370 BBa_K273006\n",
      "371 BBa_K273007\n",
      "372 BBa_K273008\n",
      "373 BBa_K283002\n",
      "374 BBa_K299106\n",
      "375 BBa_K299107\n",
      "376 BBa_K299201\n",
      "377 BBa_K299300\n",
      "378 BBa_K299301\n",
      "379 BBa_K299307\n",
      "380 BBa_K299317\n",
      "381 BBa_K299327\n",
      "382 BBa_K311004\n",
      "383 BBa_K314970\n",
      "384 BBa_K314986\n",
      "385 BBa_K315004\n",
      "386 BBa_K315005\n",
      "387 BBa_K322007\n",
      "388 BBa_K323089\n",
      "389 BBa_K323163\n",
      "390 BBa_K325100\n",
      "391 BBa_K325101\n",
      "392 BBa_K325102\n",
      "393 BBa_K325108\n",
      "394 BBa_K325109\n",
      "395 BBa_K325202\n",
      "396 BBa_K325209\n",
      "397 BBa_K325210\n",
      "398 BBa_K325211\n",
      "399 BBa_K325218\n",
      "400 BBa_K325219\n",
      "401 BBa_K325229\n",
      "402 BBa_K325239\n",
      "403 BBa_K325249\n",
      "404 BBa_K325259\n",
      "405 BBa_K325905\n",
      "406 BBa_K331018\n",
      "407 BBa_K331019\n",
      "408 BBa_K332032\n",
      "409 BBa_K336060\n",
      "410 BBa_K336061\n",
      "411 BBa_K337032\n",
      "412 BBa_K337035\n",
      "413 BBa_K337036\n",
      "414 BBa_K337038\n",
      "415 BBa_K337040\n",
      "416 BBa_K337042\n",
      "417 BBa_K337044\n",
      "418 BBa_K337046\n",
      "419 BBa_K343001\n",
      "420 BBa_K346006\n",
      "421 BBa_K346022\n",
      "422 BBa_K346023\n",
      "423 BBa_K346024\n",
      "424 BBa_K346025\n",
      "425 BBa_K346029\n",
      "426 BBa_K346033\n",
      "427 BBa_K346034\n",
      "428 BBa_K346058\n",
      "429 BBa_K346089\n",
      "430 BBa_K351004\n",
      "431 BBa_K357003\n",
      "432 BBa_K357007\n",
      "433 BBa_K362007\n",
      "434 BBa_K362051\n",
      "435 BBa_K362052\n",
      "436 BBa_K362065\n",
      "437 BBa_K363001\n",
      "438 BBa_K363006\n",
      "439 BBa_K363011\n",
      "440 BBa_K363012\n",
      "441 BBa_K373002\n",
      "442 BBa_K374010\n",
      "443 BBa_K395603\n",
      "444 BBa_K411123\n",
      "445 BBa_K411124\n",
      "446 BBa_K415007\n",
      "447 BBa_K415011\n",
      "448 BBa_K415020\n",
      "449 BBa_K415022\n",
      "450 BBa_K415023\n",
      "451 BBa_K415069\n",
      "452 BBa_K424017\n",
      "453 BBa_K431002\n",
      "454 BBa_K497006\n",
      "455 BBa_K497007\n",
      "456 BBa_K497016\n",
      "457 BBa_K497017\n",
      "458 BBa_K497018\n",
      "459 BBa_K497019\n",
      "460 BBa_K511803\n",
      "461 BBa_K511804\n",
      "462 BBa_K511805\n",
      "463 BBa_K511806\n",
      "464 BBa_K511807\n",
      "465 BBa_K511808\n",
      "466 BBa_K511809\n",
      "467 BBa_K511810\n",
      "468 BBa_K511811\n",
      "469 BBa_K511812\n",
      "470 BBa_K511813\n",
      "471 BBa_K511814\n",
      "472 BBa_K511815\n",
      "473 BBa_K511816\n",
      "474 BBa_K511817\n",
      "475 BBa_K511818\n",
      "476 BBa_K511819\n",
      "477 BBa_K511821\n",
      "478 BBa_K511822\n",
      "479 BBa_K511824\n",
      "480 BBa_K511825\n",
      "481 BBa_K511826\n",
      "482 BBa_K511905\n",
      "483 BBa_K511906\n",
      "484 BBa_K511907\n",
      "485 BBa_K511908\n",
      "486 BBa_K511910\n",
      "487 BBa_K525121\n",
      "488 BBa_K525161\n",
      "489 BBa_K525221\n",
      "490 BBa_K525234\n",
      "491 BBa_K525261\n",
      "492 BBa_K525264\n",
      "493 BBa_K525562\n",
      "494 BBa_K531000\n",
      "495 BBa_K531002\n",
      "496 BBa_K531004\n",
      "497 BBa_K531005\n",
      "498 BBa_K531007\n",
      "499 BBa_K531008\n",
      "500 BBa_K531009\n",
      "501 BBa_K531010\n",
      "502 BBa_K531011\n",
      "503 BBa_K539392\n",
      "504 BBa_K539461\n",
      "505 BBa_K539691\n",
      "506 BBa_K539732\n",
      "507 BBa_K539733\n",
      "508 BBa_K539741\n",
      "509 BBa_K539742\n",
      "510 BBa_K541029\n",
      "511 BBa_K541715\n",
      "512 BBa_K541800\n",
      "513 BBa_K541915\n",
      "514 BBa_K541925\n",
      "515 BBa_K542008\n",
      "516 BBa_K542012\n",
      "517 BBa_K546001\n",
      "518 BBa_K546005\n",
      "519 BBa_K557000\n",
      "520 BBa_K557001\n",
      "521 BBa_K563010\n",
      "522 BBa_K563053\n",
      "523 BBa_K568004\n",
      "524 BBa_K575024\n",
      "525 BBa_K575025\n",
      "526 BBa_K575026\n",
      "527 BBa_K575027\n",
      "528 BBa_K575028\n",
      "529 BBa_K575029\n",
      "530 BBa_K575030\n",
      "531 BBa_K575031\n",
      "532 BBa_K575032\n",
      "533 BBa_K575033\n",
      "534 BBa_K575034\n",
      "535 BBa_K575035\n",
      "536 BBa_K575036\n",
      "537 BBa_K575037\n",
      "538 BBa_K575038\n",
      "539 BBa_K575039\n",
      "540 BBa_K575044\n",
      "541 BBa_K575045\n",
      "542 BBa_K575046\n",
      "543 BBa_K575047\n",
      "544 BBa_K582000\n",
      "545 BBa_K594011\n",
      "546 BBa_K594014\n",
      "547 BBa_K598015\n",
      "548 BBa_K598016\n",
      "549 BBa_K598020\n",
      "550 BBa_K598023\n",
      "551 BBa_K598024\n",
      "552 BBa_K598025\n",
      "553 BBa_K608000\n",
      "554 BBa_K608001\n",
      "555 BBa_K611099\n",
      "556 BBa_K611100\n",
      "557 BBa_K611101\n",
      "558 BBa_K611102\n",
      "559 BBa_K624027\n",
      "560 BBa_K624028\n",
      "561 BBa_K624029\n",
      "562 BBa_K627011\n",
      "563 BBa_K629005\n",
      "564 BBa_K633014\n",
      "565 BBa_K646008\n",
      "566 BBa_K733001\n",
      "567 BBa_K733002\n",
      "568 BBa_K733007\n",
      "569 BBa_K733012\n",
      "570 BBa_K737000\n",
      "571 BBa_K737001\n",
      "572 BBa_K737048\n",
      "573 BBa_K737049\n",
      "574 BBa_K737050\n",
      "575 BBa_K737057\n",
      "576 BBa_K737058\n",
      "577 BBa_K737070\n",
      "578 BBa_K737071\n",
      "579 BBa_K748000\n",
      "580 BBa_K748001\n",
      "581 BBa_K748002\n",
      "582 BBa_K748006\n",
      "583 BBa_K749023\n",
      "584 BBa_K749024\n",
      "585 BBa_K750008\n",
      "586 BBa_K750104\n",
      "587 BBa_K750105\n",
      "588 BBa_K750106\n",
      "589 BBa_K750107\n",
      "590 BBa_K750108\n",
      "591 BBa_K750115\n",
      "592 BBa_K758000\n",
      "593 BBa_K769003\n",
      "594 BBa_K774004\n",
      "595 BBa_K774005\n",
      "596 BBa_K774006\n",
      "597 BBa_K774007\n",
      "598 BBa_K774102\n",
      "599 BBa_K774103\n",
      "600 BBa_K779120\n",
      "601 BBa_K782043\n",
      "602 BBa_K782044\n",
      "603 BBa_K782045\n",
      "604 BBa_K782046\n",
      "605 BBa_K782047\n",
      "606 BBa_K782048\n",
      "607 BBa_K782049\n",
      "608 BBa_K782050\n",
      "609 BBa_K782051\n",
      "610 BBa_K782052\n",
      "611 BBa_K782053\n",
      "612 BBa_K782054\n",
      "613 BBa_K782055\n",
      "614 BBa_K782056\n",
      "615 BBa_K782057\n",
      "616 BBa_K782058\n",
      "617 BBa_K801030\n",
      "618 BBa_K801039\n",
      "619 BBa_K801040\n",
      "620 BBa_K801041\n",
      "621 BBa_K802002\n",
      "622 BBa_K806003\n",
      "623 BBa_K807002\n",
      "624 BBa_K808001\n",
      "625 BBa_K808002\n",
      "626 BBa_K808033\n",
      "627 BBa_K808034\n",
      "628 BBa_K812012\n",
      "629 BBa_K812020\n",
      "630 BBa_K812021\n",
      "631 BBa_K812110\n",
      "632 BBa_K818300\n",
      "633 BBa_K823001\n",
      "634 BBa_K823021\n",
      "635 BBa_K823022\n",
      "636 BBa_K823023\n",
      "637 BBa_K823024\n",
      "638 BBa_K823025\n",
      "639 BBa_K823026\n",
      "640 BBa_K823027\n",
      "641 BBa_K823030\n",
      "642 BBa_K823033\n",
      "643 BBa_K823049\n",
      "644 BBa_K831004\n",
      "645 BBa_K831011\n",
      "646 BBa_K831012\n",
      "647 BBa_K831014\n",
      "648 BBa_K833014\n",
      "649 BBa_K836001\n",
      "650 BBa_K836002\n",
      "651 BBa_K836004\n",
      "652 BBa_K836006\n",
      "653 BBa_K844007\n",
      "654 BBa_K844008\n",
      "655 BBa_K845000\n",
      "656 BBa_K855003\n",
      "657 BBa_K855007\n",
      "658 BBa_K861032\n",
      "659 BBa_K861042\n",
      "660 BBa_K863012\n",
      "661 BBa_K863022\n",
      "662 BBa_K863102\n",
      "663 BBa_K863110\n",
      "664 BBa_K863111\n",
      "665 BBa_K863112\n",
      "666 BBa_K863113\n",
      "667 BBa_K863114\n",
      "668 BBa_K863120\n",
      "669 BBa_K863121\n",
      "670 BBa_K863205\n",
      "671 BBa_K863207\n",
      "672 BBa_K863208\n",
      "673 BBa_K863209\n",
      "674 BBa_K874102\n",
      "675 BBa_K874103\n",
      "676 BBa_K874200\n",
      "677 BBa_K874300\n",
      "678 BBa_K876066\n",
      "679 BBa_K880001\n",
      "680 BBa_K880002\n",
      "681 BBa_K880003\n",
      "682 BBa_K883151\n",
      "683 BBa_K887000\n",
      "684 BBa_K887002\n",
      "685 BBa_K887004\n",
      "686 BBa_K896599\n",
      "687 BBa_K896988\n",
      "688 BBa_K907003\n",
      "689 BBa_K929202\n",
      "690 BBa_K935001\n",
      "691 BBa_K944012\n",
      "692 BBa_K944015\n",
      "693 BBa_K953003\n",
      "694 BBa_K953005\n",
      "695 BBa_K953006\n",
      "696 BBa_K953007\n",
      "697 BBa_K957005\n",
      "698 BBa_K976008\n",
      "699 BBa_K987000\n",
      "700 BBa_K987001\n",
      "701 BBa_M1002\n",
      "702 BBa_M10034\n",
      "703 BBa_M10035\n",
      "704 BBa_M10211\n",
      "705 BBa_M10212\n",
      "706 BBa_M10213\n",
      "707 BBa_M10214\n",
      "708 BBa_M10217\n",
      "709 BBa_M10219\n",
      "710 BBa_M10220\n",
      "711 BBa_M10221\n",
      "712 BBa_M10222\n",
      "713 BBa_M10225\n",
      "714 BBa_M11051\n",
      "715 BBa_M11085\n",
      "716 BBa_M11207\n",
      "717 BBa_M11208\n",
      "718 BBa_M11410\n",
      "719 BBa_M11411\n",
      "720 BBa_M1515\n",
      "721 BBa_M1529\n",
      "722 BBa_M1530\n",
      "723 BBa_M1531\n",
      "724 BBa_M1532\n",
      "725 BBa_M1533\n",
      "726 BBa_M1535\n",
      "727 BBa_M1536\n",
      "728 BBa_M1541\n",
      "729 BBa_M1542\n",
      "730 BBa_M1641\n",
      "731 BBa_M31513\n",
      "732 BBa_M31516\n",
      "733 BBa_M31517\n",
      "734 BBa_M31539\n",
      "735 BBa_M33334\n",
      "736 BBa_M33335\n",
      "737 BBa_M34014\n",
      "738 BBa_M36195\n",
      "739 BBa_M36222\n",
      "740 BBa_M36731\n",
      "741 BBa_M36732\n",
      "742 BBa_M36916\n",
      "743 BBa_S03639\n",
      "744 BBa_S03642\n",
      "745 BBa_S03649\n",
      "746 BBa_S03673\n",
      "747 BBa_S03676\n",
      "748 BBa_S03677\n",
      "749 BBa_S03679\n",
      "750 BBa_S03680\n",
      "751 BBa_S03681\n",
      "752 BBa_S03684\n",
      "753 BBa_S03685\n",
      "754 BBa_S03686\n",
      "755 BBa_S03687\n",
      "756 BBa_S03688\n",
      "757 BBa_Y00100\n"
     ]
    }
   ],
   "source": [
    "for i, p in enumerate(for_training):\n",
    "    p[\"info\"] = info(p[\"id\"])\n",
    "    print(i, p[\"id\"])"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 8,
   "id": "6564f20d",
   "metadata": {
    "execution": {
     "iopub.execute_input": "2023-08-06T13:28:10.475657Z",
     "iopub.status.busy": "2023-08-06T13:28:10.474022Z",
     "iopub.status.idle": "2023-08-06T13:28:10.519647Z",
     "shell.execute_reply": "2023-08-06T13:28:10.518938Z"
    },
    "papermill": {
     "duration": 0.156549,
     "end_time": "2023-08-06T13:28:10.539877",
     "exception": false,
     "start_time": "2023-08-06T13:28:10.383328",
     "status": "completed"
    },
    "tags": []
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "[{\"id\": \"BBa_C0090\", \"type\": \"Coding\", \"description\": \"smaI\", \"info\": \"smaI Coding Region for ahl synthase from serratia sp\"}, {\"id\": \"BBa_C0400\", \"type\": \"Coding\", \"description\": \"BglG\", \"info\": \"BglG is known to bind to terminator loops in bgl operon causing anti\"}, {\"id\": \"BBa_C0420\", \"type\": \"Coding\", \"description\": \"BglF\", \"info\": \"BglF Sensor permease of bgl operon Sequence and Features Assembly Compatibility:\"}, {\"id\": \"BBa_C0600\", \"type\": \"Coding\", \"description\": \"Tar\", \"info\": \"Tar Chemotaxis aspartate receptor Usage and Biology Sequence and Features Assembly Compatibility: 10COM\"}, {\"id\": \"BBa_C0620\", \"type\": \"Coding\", \"description\": \"Tsr\", \"info\": \"Tsr serine receptor sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_C2030\", \"type\": \"Coding\", \"description\": \"Fos\", \"info\": \"Fos Encodes the leucine zipper domain Sequence and Features Assembly Compatibility: 10COMPAT\"}, {\"id\": \"BBa_C2031\", \"type\": \"Coding\", \"description\": \"JunB\", \"info\": \"JunB encodes the leucine zipper sequence and features assembly compatibility: 10COMPATIBLE WITH R\"}, {\"id\": \"BBa_C2032\", \"type\": \"Coding\", \"description\": \"JunD\", \"info\": \"JunD Encodes a JunD leucine zipper . assembly compatibility: 10COMPAT\"}, {\"id\": \"BBa_C52934\", \"type\": \"Coding\", \"description\": \"vdh\", \"info\": \"origin is from pseudomonas aeruginosa . vdh\"}, {\"id\": \"BBa_I10010\", \"type\": \"Coding\", \"description\": \"ferA\", \"info\": \"ferA encodes an 89kda cytochrome involved in the reduction of Fe(III)\"}, {\"id\": \"BBa_I10101\", \"type\": \"Coding\", \"description\": \"csgD\", \"info\": \"csgD gene also encodes a transcription activator the curli subunit encoding c\"}, {\"id\": \"BBa_I10652\", \"type\": \"DNA\", \"description\": \"fdd\", \"info\": \"fdd dkfka;l Sequence and Features Assembly Compatibility: 10COMPAT\"}, {\"id\": \"BBa_I10777\", \"type\": \"Coding\", \"description\": \"GldE\", \"info\": \"gldE confers gliding motility to the bacteria . sequence and features Assembly Compat\"}, {\"id\": \"BBa_I11000\", \"type\": \"Regulatory\", \"description\": \"test\", \"info\": \"test dummy part Usage and Biology Unknown! Sequence and Features Assembly Compatibility: 10COMPA\"}, {\"id\": \"BBa_I11010\", \"type\": \"RBS\", \"description\": \"RBS\", \"info\": \"RBS ribosome binding site sequence and features assembly Compatibility: 10COMPATIBLE WITH RFC\"}, {\"id\": \"BBa_I12205\", \"type\": \"Coding\", \"description\": \"AraC\", \"info\": \"coding region for the arac protein . barcodes are discontinued, but one was appended to the\"}, {\"id\": \"BBa_I13700\", \"type\": \"Coding\", \"description\": \"CheY\", \"info\": \"CheY renamed part:BBa_C0020 Sequence and Features Assembly Compatibility: 10\"}, {\"id\": \"BBa_I13701\", \"type\": \"Coding\", \"description\": \"CheB\", \"info\": \"CheB Renamed C0024 Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH R\"}, {\"id\": \"BBa_I13702\", \"type\": \"Coding\", \"description\": \"CheR\", \"info\": \"CheR renamed part:BBa_C0028 Sequence and Features Assembly Compatibility: 10\"}, {\"id\": \"BBa_I15006\", \"type\": \"Regulatory\", \"description\": \"Cph8\", \"info\": \"Cph8 chimeric cph1/envz light receptor usage and biology -- please enter\"}, {\"id\": \"BBa_I20533\", \"type\": \"Composite\", \"description\": \"foo\", \"info\": \"foo bar sequence and features assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_I712002\", \"type\": \"Coding\", \"description\": \"CCR5\", \"info\": \"CCR5 is a HIV-1 co-receptor . sequence and features assembly compatibility: 10\"}, {\"id\": \"BBa_I712024\", \"type\": \"Coding\", \"description\": \"CD4\", \"info\": \"CD4 sequence for CD4 (glycoprotein expressed on the surface of T helper cells, regulatory T cells\"}, {\"id\": \"BBa_I714005\", \"type\": \"Terminator\", \"description\": \"abc\", \"info\": \"abc florescence secondary structure file:mfold-i714005-1.png how these parts\"}, {\"id\": \"BBa_I7154\", \"type\": \"Regulatory\", \"description\": \"pLac\", \"info\": \"(see part BBa_R0010) . (see . part bba_r00\"}, {\"id\": \"BBa_I716000\", \"type\": \"Other\", \"description\": \"wbbL\", \"info\": \"wbbL is \\\"necessary for completion of the O16 and K1 gene clusters\"}, {\"id\": \"BBa_I716001\", \"type\": \"Other\", \"description\": \"neuS\", \"info\": \"neuS neus, with wbbL, \\\"necessary for completion of the O16\"}, {\"id\": \"BBa_I716024\", \"type\": \"Other\", \"description\": \"VHb\", \"info\": \"VHb bacterial hemoglobin sequence and features assembly Compatibility: 10COMPATIBLE WITH RFC\"}, {\"id\": \"BBa_I716151\", \"type\": \"Other\", \"description\": \"hemA\", \"info\": \"hema delta-aminolevulinate synthase sequence and features assembly compatibility: 10\"}, {\"id\": \"BBa_I716153\", \"type\": \"Coding\", \"description\": \"hemB\", \"info\": \"hemB is an enzyme involved in the heme biosynthetic pathway . also called delta-\"}, {\"id\": \"BBa_I716154\", \"type\": \"Coding\", \"description\": \"hemC\", \"info\": \"hemC is an enzyme involved in the heme biosynthetic pathway . also called porpho\"}, {\"id\": \"BBa_I716155\", \"type\": \"Coding\", \"description\": \"hemD\", \"info\": \"hemD is an enzyme involved in the heme biosynthetic pathway . also called u\"}, {\"id\": \"BBa_I716209\", \"type\": \"Coding\", \"description\": \"ceaB\", \"info\": \"ceaB colicin activity protein - Dnase for bacteria self-destruct mechanism without a\"}, {\"id\": \"BBa_I716252\", \"type\": \"Other\", \"description\": \"sodC\", \"info\": \"sodC basic part for the chaperone/toxicity device Sequence and Features Assembly Compatibility: 10COM\"}, {\"id\": \"BBa_I716255\", \"type\": \"Other\", \"description\": \"edit\", \"info\": \"edit edit Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_I716257\", \"type\": \"Other\", \"description\": \"edit\", \"info\": \"edit edit Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_I716270\", \"type\": \"Other\", \"description\": \"edit\", \"info\": \"edit edit Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_I716301\", \"type\": \"Other\", \"description\": \"otsA\", \"info\": \"otsA - what it does Sequence and Features Assembly Compatibility: 10INCOMPAT\"}, {\"id\": \"BBa_I716331\", \"type\": \"Other\", \"description\": \"ThpA\", \"info\": \"ThpA is very similar to OtsA and otsB, and this will help prevent de\"}, {\"id\": \"BBa_I716333\", \"type\": \"Other\", \"description\": \"ThpC\", \"info\": \"ThpC is very similar to OtsA and otsB, and this will help prevent de\"}, {\"id\": \"BBa_I716334\", \"type\": \"Other\", \"description\": \"ThpD\", \"info\": \"ThpD is very similar to OtsA and otsB, and this will help prevent de\"}, {\"id\": \"BBa_I720000\", \"type\": \"Temporary\", \"description\": \"rpoN\", \"info\": \"this is the rpoN gene, producing sigma54 . there is no promoter. it\"}, {\"id\": \"BBa_I722003\", \"type\": \"RBS\", \"description\": \"er\", \"info\": \"er er Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_I723020\", \"type\": \"Regulatory\", \"description\": \"Pu\", \"info\": \"this is the promoter activated by the transcriptional regulator xylr in response to detection of environmental \"}, {\"id\": \"BBa_I723024\", \"type\": \"Coding\", \"description\": \"PhzM\", \"info\": \"PhzM is the first of two enzymes required to convert phenazine-1-carboxylic\"}, {\"id\": \"BBa_I723025\", \"type\": \"Coding\", \"description\": \"PhzS\", \"info\": \"PhzS is the second of two enzymes required to convert phenazine-1-carboxylic\"}, {\"id\": \"BBa_I725001\", \"type\": \"Composite\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_I725010\", \"type\": \"DNA\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_I726001\", \"type\": \"Intermediate\", \"description\": \"I\", \"info\": \"iGEM 2007 Team Parts I luxI Usage and Biology Sequence and Features Assembly Compatibility\"}, {\"id\": \"BBa_I726002\", \"type\": \"Intermediate\", \"description\": \"R\", \"info\": \"iGEM 2007 Team Parts R luxR Usage and Biology Sequence and Features Assembly Compatibility\"}, {\"id\": \"BBa_I726003\", \"type\": \"Intermediate\", \"description\": \"IC\", \"info\": \"iGEM 2007 Team Parts IC luxI.C Usage and Biology Polycistronic\"}, {\"id\": \"BBa_I726004\", \"type\": \"Intermediate\", \"description\": \"RY\", \"info\": \"iGEM 2007 team parts ry luxR.y Usage and biology polycistronic \"}, {\"id\": \"BBa_I729000\", \"type\": \"Coding\", \"description\": \"FliC\", \"info\": \"FliC is the flagella protein monomer sequence and features assembly compatibility: 10COMPATIBLE WITH\"}, {\"id\": \"BBa_I732100\", \"type\": \"Coding\", \"description\": \"LacI\", \"info\": \"lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins\"}, {\"id\": \"BBa_I732101\", \"type\": \"Coding\", \"description\": \"LRLa\", \"info\": \"repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different\"}, {\"id\": \"BBa_I732102\", \"type\": \"Coding\", \"description\": \"LRLb\", \"info\": \"repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different\"}, {\"id\": \"BBa_I732103\", \"type\": \"Coding\", \"description\": \"LRLc\", \"info\": \"repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different\"}, {\"id\": \"BBa_I732104\", \"type\": \"Coding\", \"description\": \"LRLd\", \"info\": \"repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different\"}, {\"id\": \"BBa_I732997\", \"type\": \"Temporary\", \"description\": \"TEST\", \"info\": \"Compatibility: 10COMPATIBLE WITH RFC[10] . 12Compatible with RFC\"}, {\"id\": \"BBa_I741009\", \"type\": \"Coding\", \"description\": \"recA\", \"info\": \"recA -- Sequence and Features assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_I741049\", \"type\": \"Regulatory\", \"description\": \" \", \"info\": \"Sequence and Features Assembly Compatibility: 10Compatible with rfc[10] 12Compat\"}, {\"id\": \"BBa_I741108\", \"type\": \"Temporary\", \"description\": \"a\", \"info\": \"a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_I742107\", \"type\": \"Coding\", \"description\": \"COMT\", \"info\": \"COMT encodes caffeic acid-O-methyl transferase from alfalfa .\"}, {\"id\": \"BBa_I745017\", \"type\": \"Plasmid\", \"description\": \"p148\", \"info\": \"p148 lentivirus helper plasmid with polymerase/integrase .\"}, {\"id\": \"BBa_I745018\", \"type\": \"Plasmid\", \"description\": \"pLV\", \"info\": \"pLV Lentiviral vector backbone . 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_I766204\", \"type\": \"Coding\", \"description\": \"Ste2\", \"info\": \"Ste2 encodes for the yeast protein Ste2, the integral membrane receptor for alpha-factor, a mating\"}, {\"id\": \"BBa_I766205\", \"type\": \"Coding\", \"description\": \"XhoI\", \"info\": \"Xhoi Restriction site. sequence and features assembly compatibility: 10COMPATIBLE WITH\"}, {\"id\": \"BBa_I766206\", \"type\": \"Coding\", \"description\": \"XmaI\", \"info\": \"xmai restriction site sequence and features assembly Compatibility: 10COMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_I766210\", \"type\": \"Coding\", \"description\": \"GFP\", \"info\": \"GFP encodes for yeast enhanced monomeric green fluorescence protein . sequence and features assembly compatibility:\"}, {\"id\": \"BBa_I769902\", \"type\": \"Coding\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]I\"}, {\"id\": \"BBa_I769903\", \"type\": \"Generator\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]I\"}, {\"id\": \"BBa_J01086\", \"type\": \"RNA\", \"description\": \"Key3\", \"info\": \"this piece is the riboregulator complement intended for use with the J01080 part . it\"}, {\"id\": \"BBa_J01087\", \"type\": \"Temporary\", \"description\": \"Key4\", \"info\": \"Key4 -- No description -- Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_J01088\", \"type\": \"Temporary\", \"description\": \"Key5\", \"info\": \"Key5 -- No description -- Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_J01089\", \"type\": \"Temporary\", \"description\": \"Key6\", \"info\": \"Key6 -- No description -- Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_J01090\", \"type\": \"Temporary\", \"description\": \"Key7\", \"info\": \"Key7 -- No description -- Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_J01091\", \"type\": \"Temporary\", \"description\": \"Key8\", \"info\": \"Key8 -- No description -- Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_J05829\", \"type\": \"DNA\", \"description\": \"Test\", \"info\": \"Test Test Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]I\"}, {\"id\": \"BBa_J07006\", \"type\": \"Coding\", \"description\": \"malE\", \"info\": \"malE is the solute-binding protein member of the ABC transporter complex MalEFGK involved in cell\"}, {\"id\": \"BBa_J07021\", \"type\": \"Coding\", \"description\": \"FecR\", \"info\": \"FecR CDS Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_J07065\", \"type\": \"Temporary\", \"description\": \"ToxR\", \"info\": \"ToxR Front side of tox_cell_signaling_by_dimerization_system \"}, {\"id\": \"BBa_J125000\", \"type\": \"Composite\", \"description\": \"aaa\", \"info\": \"compatibility: 10compatible with RFC[10] 12incompatible with rfc\"}, {\"id\": \"BBa_J125001\", \"type\": \"Composite\", \"description\": \"aaa\", \"info\": \"compatibility: 10compatible with RFC[10] 12incompatible with rfc\"}, {\"id\": \"BBa_J17004\", \"type\": \"Temporary\", \"description\": \"a\", \"info\": \"a a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_J176000\", \"type\": \"Protein_Domain\", \"description\": \"hPCD\", \"info\": \"polycomb chromodomain (PCD) from the human CBX8 protein (orange) crystal\"}, {\"id\": \"BBa_J176003\", \"type\": \"Regulatory\", \"description\": \"Ubc\", \"info\": \"Ubc promoter drives expression at a level below that of the human phosphoglycerate kin\"}, {\"id\": \"BBa_J176004\", \"type\": \"Coding\", \"description\": \"CFP\", \"info\": \"CFP humanized cerulean fluorescent protein sequence and features assembly compatibility: 10COMPATIBLE WITH\"}, {\"id\": \"BBa_J176005\", \"type\": \"Protein_Domain\", \"description\": \"mCh\", \"info\": \"mCherry is a derivative of monomeric RFP from the mushroom coral discosoma s\"}, {\"id\": \"BBa_J176006\", \"type\": \"Coding\", \"description\": \"YFP\", \"info\": \"YFP mammalian venus fluorescent protein sequence and features assembly Compatibility: 10COMPATIBLE\"}, {\"id\": \"BBa_J176007\", \"type\": \"Protein_Domain\", \"description\": \"KRAB\", \"info\": \"KRAB Transc. repression domain Sequence and Features Assembly Compatibility: 10COMPATIBLE\"}, {\"id\": \"BBa_J176008\", \"type\": \"Tag\", \"description\": \"NLS\", \"info\": \"fluorophore-NLS fusions are handy for making glowing nuclei . PKKK\"}, {\"id\": \"BBa_J176013\", \"type\": \"Protein_Domain\", \"description\": \"VP64\", \"info\": \"VP64 Activation Domain Module is often fused to DNA binding domains to make strong synthetic transcription factors \"}, {\"id\": \"BBa_J176016\", \"type\": \"Terminator\", \"description\": \"STOP\", \"info\": \"STOP Contains stop codons TAA and TGA in frame Sequence and Features Assembly Compatibility:\"}, {\"id\": \"BBa_J176018\", \"type\": \"Tag\", \"description\": \"PEST\", \"info\": \"proline - glutamic acid - serine - threonine (PEST) motif\"}, {\"id\": \"BBa_J176021\", \"type\": \"DNA\", \"description\": \"HS4\", \"info\": \"HS4 chicken beta-globin gene insulator sequence and features assembly compatibility: 10COMPAT\"}, {\"id\": \"BBa_J176023\", \"type\": \"Temporary\", \"description\": \"EED\", \"info\": \"EED Embryonic Ectoderm Development; PCR2 member; Polycomb silencing Sequence\"}, {\"id\": \"BBa_J176027\", \"type\": \"Regulatory\", \"description\": \"CMV\", \"info\": \"cytomegalovirus promoter (CMV) promoter drives expression at a level greater than the \"}, {\"id\": \"BBa_J176028\", \"type\": \"Regulatory\", \"description\": \"HPK\", \"info\": \"the human phosphoglycerate kinase (HPK) promoter drives expression at a\"}, {\"id\": \"BBa_J176032\", \"type\": \"Temporary\", \"description\": \"EF1a\", \"info\": \"EF1a EF-1 alpha promoter from pEF5/FRT/V5/TO\"}, {\"id\": \"BBa_J176033\", \"type\": \"Temporary\", \"description\": \"DPRE\", \"info\": \"DPRE HoxD 11-12 PRE element from human ESC's . s.d mut\"}, {\"id\": \"BBa_J176034\", \"type\": \"Temporary\", \"description\": \"Gluc\", \"info\": \"Gluc excreted gaussia luciferase (from phGluc, addgen\"}, {\"id\": \"BBa_J176035\", \"type\": \"Temporary\", \"description\": \"p65\", \"info\": \"p65 activation domain BioBrick is derived from amino acids 288 (Tyr, Y\"}, {\"id\": \"BBa_J176036\", \"type\": \"Temporary\", \"description\": \"SP1A\", \"info\": \"SP1A activation domain A from SP1; Emamai et al. 1995 sequence and features assembly\"}, {\"id\": \"BBa_J176037\", \"type\": \"Protein_Domain\", \"description\": \"Sp1B\", \"info\": \"SP1B activation domain B from SP1; Emamai et al. 1995 sequence and features assembly\"}, {\"id\": \"BBa_J18958\", \"type\": \"Coding\", \"description\": \"eYFP\", \"info\": \"eYFP Enhanced Yellow Fluorescence Protein Sequence and Features Assembly Compatibility: 10COMPAT\"}, {\"id\": \"BBa_J18960\", \"type\": \"Coding\", \"description\": \"eCFP\", \"info\": \"eCFP Enhanced Cyan Fluorescent Protein Sequence and Features Assembly Compatibility: 10COMPA\"}, {\"id\": \"BBa_J212099\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test this is a test . sequence and features assembly compatibility: 10COMPATIBLE WITH RFC\"}, {\"id\": \"BBa_J212100\", \"type\": \"Regulatory\", \"description\": \"test\", \"info\": \"test This is test only . sequence and features assembly compatibility: 10INCOMPATIBLE WITH RFC\"}, {\"id\": \"BBa_J212103\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_J22051\", \"type\": \"Regulatory\", \"description\": \"Pcya\", \"info\": \"this is adenylate cyclase promoter that has been reported to oscillate in cell cycle\"}, {\"id\": \"BBa_J22052\", \"type\": \"Regulatory\", \"description\": \"Pcya\", \"info\": \"adenylate cyclase promoter has been reported to oscillate in cell cycle dependant manner\"}, {\"id\": \"BBa_J29000\", \"type\": \"Coding\", \"description\": \"CrtE\", \"info\": \"CrtE is the first of 3 enzymes that are used to produce lycopene (tomato pigment\"}, {\"id\": \"BBa_J29001\", \"type\": \"Coding\", \"description\": \"CrtB\", \"info\": \"CrtB is the second of 3 an enzyme that is use to produce a lycopene(t\"}, {\"id\": \"BBa_J29002\", \"type\": \"Coding\", \"description\": \"CrtI\", \"info\": \"CrtI is the third of 3 enzyme that is used to produce lycopene (tomato pigment)\"}, {\"id\": \"BBa_J290045\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_J29026\", \"type\": \"Coding\", \"description\": \"KaiA\", \"info\": \"KaiA I added stop codons \\\"TAATAA\\\" to KaiA gene . assembly compatibility:\"}, {\"id\": \"BBa_J29027\", \"type\": \"Coding\", \"description\": \"KaiB\", \"info\": \"KaiB Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_J29029\", \"type\": \"Coding\", \"description\": \"pbpA\", \"info\": \"pbp2 is a penicillin-binding protein . sequence and features assembly compatibility:\"}, {\"id\": \"BBa_J29030\", \"type\": \"Coding\", \"description\": \"CrtY\", \"info\": \"CrtY is the last of 4 enzymes that is used to produce a beta-carotene \"}, {\"id\": \"BBa_J29032\", \"type\": \"Inverter\", \"description\": \"LacI\", \"info\": \"lacI is a lactose operon repressor . sequence and features assembly compatibility\"}, {\"id\": \"BBa_J29033\", \"type\": \"Coding\", \"description\": \"KaiC\", \"info\": \"KaiC a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_J29037\", \"type\": \"Coding\", \"description\": \"SasA\", \"info\": \"SasA is activated by interaction with KaiC . rc site found at 373 .\"}, {\"id\": \"BBa_J29038\", \"type\": \"Coding\", \"description\": \"CheZ\", \"info\": \"CheZ chemotactic response, CheY protein phophatase Sequence and Features Assembly\"}, {\"id\": \"BBa_J29039\", \"type\": \"Coding\", \"description\": \"MinE\", \"info\": \"minE reverses minC inhibition of ftsz ring formation . sequence and features assembly compat\"}, {\"id\": \"BBa_J29040\", \"type\": \"Coding\", \"description\": \"MinC\", \"info\": \"minC is cell division inhibitor, inhibits ftsz ring formation . assembly compatibility:\"}, {\"id\": \"BBa_J29041\", \"type\": \"Coding\", \"description\": \"MinD\", \"info\": \"minD is a cell division inhibitor, a membrane ATPase, activates minC .\"}, {\"id\": \"BBa_J29042\", \"type\": \"Coding\", \"description\": \"FtsZ\", \"info\": \"FtsZ is a tubulin-like cell division protein . sequence and features assembly compatibility\"}, {\"id\": \"BBa_J29043\", \"type\": \"Reporter\", \"description\": \"a\", \"info\": \"a a Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_J29044\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]I\"}, {\"id\": \"BBa_J29045\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_J29048\", \"type\": \"RBS\", \"description\": \"RBS\", \"info\": \"RBS strong rbs Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC\"}, {\"id\": \"BBa_J29052\", \"type\": \"Coding\", \"description\": \"idi\", \"info\": \"idi This part encodes isopentenyl pyrophosphate which stimulates cartenogen\"}, {\"id\": \"BBa_J32004\", \"type\": \"Coding\", \"description\": \"CcdA\", \"info\": \"Ccda control cell death a sequence and features assembly compatibility: 10COMPATIBLE WITH R\"}, {\"id\": \"BBa_J32010\", \"type\": \"Coding\", \"description\": \"ccdB\", \"info\": \"iGEM HQ CcdB without truncated ccdA clon\"}, {\"id\": \"BBa_J32020\", \"type\": \"Coding\", \"description\": \"AmpR\", \"info\": \"AmpR a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_J32021\", \"type\": \"Coding\", \"description\": \"CmR\", \"info\": \"Cmr a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_J32023\", \"type\": \"Coding\", \"description\": \"BLIP\", \"info\": \"BLIP beta lactamase inhibitory protein which makes ampR containing cells suceptible to death\"}, {\"id\": \"BBa_J33202\", \"type\": \"Reporter\", \"description\": \"lacZ\", \"info\": \"lacZ encodes the N-terminal 76 amino acid residues of lacZ . lacZ-delt\"}, {\"id\": \"BBa_J37013\", \"type\": \"Temporary\", \"description\": \"iGEM\", \"info\": \"igem sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_J40002\", \"type\": \"Temporary\", \"description\": \"hihi\", \"info\": \"hihi jy Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_J45987\", \"type\": \"Temporary\", \"description\": \"tyrB\", \"info\": \"tyrB dd Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH\"}, {\"id\": \"BBa_J45991\", \"type\": \"Temporary\", \"description\": \"fd\", \"info\": \"fd dfa Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC\"}, {\"id\": \"BBa_J47500\", \"type\": \"Regulatory\", \"description\": \"XylR\", \"info\": \"XylR atgTTTACTA AACGTCACCG CATCACATTA CTGT\"}, {\"id\": \"BBa_J51000\", \"type\": \"Coding\", \"description\": \"ComP\", \"info\": \"ComP is a transmembrane protein from B. subtilis . Upon binding to ComX\"}, {\"id\": \"BBa_J51001\", \"type\": \"Coding\", \"description\": \"ComA\", \"info\": \"ComA is the response regulator for the ComQXPA quorum-sensing system of B.\"}, {\"id\": \"BBa_J52001\", \"type\": \"Temporary\", \"description\": \"rluc\", \"info\": \"rluc renilla luciferase sequence and features assembly Compatibility: 10COMPA\"}, {\"id\": \"BBa_J52002\", \"type\": \"Temporary\", \"description\": \"Ota\", \"info\": \"Ota dominant negative TRIF Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH R\"}, {\"id\": \"BBa_J52025\", \"type\": \"Reporter\", \"description\": \"rLUC\", \"info\": \"rLUC - Renilla luciferase (light is emitted when luci\"}, {\"id\": \"BBa_J52990\", \"type\": \"Temporary\", \"description\": \"alja\", \"info\": \"alja alja Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_J52996\", \"type\": \"Plasmid\", \"description\": \"jksd\", \"info\": \"jksd kjsdhf Sequence and Features Assembly Compatibility: 10COMPA\"}, {\"id\": \"BBa_J54001\", \"type\": \"Coding\", \"description\": \"cytR\", \"info\": \"cytR transcriptional dual regulator,regulator for deo operon, udp,\"}, {\"id\": \"BBa_J54002\", \"type\": \"Coding\", \"description\": \"galS\", \"info\": \"galS is a isorepressor of galR . assembly compatibility: 10COMPAT\"}, {\"id\": \"BBa_J54004\", \"type\": \"Coding\", \"description\": \"galR\", \"info\": \"galR is a repressor of galETK operon . sequence and features assembly compatibility\"}, {\"id\": \"BBa_J54011\", \"type\": \"Coding\", \"description\": \"glpR\", \"info\": \"glpR ATGAAACACAACGTCACAACGGTATTATCGAACTGGTT\"}, {\"id\": \"BBa_J54012\", \"type\": \"Coding\", \"description\": \"glpR\", \"info\": \"glp repressor sequence and features assembly Compatibility: 10COMPATIBLE WITH RFC\"}, {\"id\": \"BBa_J5515\", \"type\": \"Temporary\", \"description\": \"dsf\", \"info\": \"dsf sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_J5532\", \"type\": \"Inverter\", \"description\": \"inv\", \"info\": \"inv inv Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_J5759\", \"type\": \"Temporary\", \"description\": \"Test\", \"info\": \"Test Test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_J58000\", \"type\": \"Temporary\", \"description\": \"Test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_J59001\", \"type\": \"RBS\", \"description\": \"tuba\", \"info\": \"tuba none Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_J64006\", \"type\": \"Coding\", \"description\": \"RocE\", \"info\": \"RocE from b. subtilis, BG10933 Sequence and Features Assembly Compatibility\"}, {\"id\": \"BBa_J64007\", \"type\": \"Coding\", \"description\": \"TEVr\", \"info\": \"this sequence encodes an amino acid sequence recognized by TEV protease (ENLYFQS) for\"}, {\"id\": \"BBa_J64805\", \"type\": \"Coding\", \"description\": \"RocD\", \"info\": \"RocD from the RocDEF promoter, . subtilis sequence and features assembly .\"}, {\"id\": \"BBa_J64806\", \"type\": \"Coding\", \"description\": \"RocE\", \"info\": \"RocE from b. subtilis sequence and features assembly Compatibility: 10INCOMPAT\"}, {\"id\": \"BBa_J64991\", \"type\": \"Regulatory\", \"description\": \"TetR\", \"info\": \"TetR Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_J69998\", \"type\": \"Temporary\", \"description\": \"Temp\", \"info\": \"Temp r0062 b0034 Sequence and Features Assembly Compatibility: 10COMPATIBLE\"}, {\"id\": \"BBa_J69999\", \"type\": \"Temporary\", \"description\": \"Temp\", \"info\": \"Temp Temp Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_J70578\", \"type\": \"RNA\", \"description\": \"pylT\", \"info\": \"pylT: ggaaacctgatcatgtagatggactctaaat\"}, {\"id\": \"BBa_J70598\", \"type\": \"Coding\", \"description\": \"VioA\", \"info\": \"VioA designed from Cambridge part Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC\"}, {\"id\": \"BBa_J70599\", \"type\": \"Coding\", \"description\": \"VioA\", \"info\": \"VioA designed from Cambridge part K274002 Converted to biobrick part by converting TGA to\"}, {\"id\": \"BBa_J70600\", \"type\": \"Coding\", \"description\": \"VioB\", \"info\": \"VioB designed from Cambridge part K274002 Converted to BioBrick part by converting TAA to\"}, {\"id\": \"BBa_J70601\", \"type\": \"Coding\", \"description\": \"VioC\", \"info\": \"VioC designed from Cambridge part K274002 Converted to BioBrick part by converting TGA to\"}, {\"id\": \"BBa_J70602\", \"type\": \"Coding\", \"description\": \"VioD\", \"info\": \"VioD Designed from Cambridge part K274002 Converted to BioBrick form by converting TG\"}, {\"id\": \"BBa_J70603\", \"type\": \"Coding\", \"description\": \"VioE\", \"info\": \"VioE Designed from Cambridge part BBa_K274002 Converted to BioBrick form by\"}, {\"id\": \"BBa_J72139\", \"type\": \"Regulatory\", \"description\": \"Pcon\", \"info\": \"Pcon constitutive promoter sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_J92213\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_J96013\", \"type\": \"Protein_Domain\", \"description\": \"HSTK\", \"info\": \"HSTK herpes simplex thymidine kinase conferring toxicity to \"}, {\"id\": \"BBa_J96017\", \"type\": \"Protein_Domain\", \"description\": \"loxP\", \"info\": \"loxP sequence Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_J96023\", \"type\": \"Protein_Domain\", \"description\": \"MS2\", \"info\": \"MS2 MS2 phage coat domain binding to RNA at the MS2 binding site sequence . MS2\"}, {\"id\": \"BBa_J96026\", \"type\": \"Protein_Domain\", \"description\": \"BoxB\", \"info\": \"boxb lambda n peptide binding site sequence sequence . boxb n-peptide is\"}, {\"id\": \"BBa_J96031\", \"type\": \"Protein_Domain\", \"description\": \"EGFP\", \"info\": \"EGFP green fluorescent protein derived from jellyfish aequeora victoria wild-type\"}, {\"id\": \"BBa_J96035\", \"type\": \"Protein_Domain\", \"description\": \"FLAG\", \"info\": \"affinity tag Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_J96036\", \"type\": \"Protein_Domain\", \"description\": \"HA\", \"info\": \"HA HA affinity tag Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_J96037\", \"type\": \"Protein_Domain\", \"description\": \"His\", \"info\": \"His affinity tag Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_J96039\", \"type\": \"Protein_Domain\", \"description\": \"GST\", \"info\": \"GST GST affinity tag Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_J96040\", \"type\": \"RBS\", \"description\": \"IRES\", \"info\": \"IRES Internal Ribosomal Entry Site Sequence and Features Assembly Compatibility: 10COMPATIBLE\"}, {\"id\": \"BBa_J96041\", \"type\": \"Protein_Domain\", \"description\": \"P2A\", \"info\": \"P2A 2A self cleaving peptide sequence and features assembly compatibility: 10COMPA\"}, {\"id\": \"BBa_J96042\", \"type\": \"Protein_Domain\", \"description\": \"T2A\", \"info\": \"T2A 2A self cleaving peptide sequence and features assembly compatibility: 10COMPA\"}, {\"id\": \"BBa_J96043\", \"type\": \"RBS\", \"description\": \"PS3\", \"info\": \"PS3 Short Dna sequence with ribosome recruitment properties (mini-IRES) sequence and features assembly\"}, {\"id\": \"BBa_J96044\", \"type\": \"RBS\", \"description\": \"PS4\", \"info\": \"PS4 Short Dna sequence with ribosome recruitment properties (mini-IRES) sequence and features assembly\"}, {\"id\": \"BBa_J96045\", \"type\": \"Regulatory\", \"description\": \"CMV\", \"info\": \"CMV promoter sequence sequence Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_K076002\", \"type\": \"Coding\", \"description\": \"Ngn1\", \"info\": \"Ngn1 is a transcription factor that promotes the differentiation of embryonic stem cells into particular types of neuro\"}, {\"id\": \"BBa_K076004\", \"type\": \"Reporter\", \"description\": \"EYFP\", \"info\": \"EYFP is an enhanced yellow fluorescent reporter protein . assembly compatibility: 10INCOMPATIBLE WITH\"}, {\"id\": \"BBa_K076009\", \"type\": \"Coding\", \"description\": \"Lbx1\", \"info\": \"Lbx1 codes for a cell fate regulator that allows cells to express GABAergic inhibitory neurotrans\"}, {\"id\": \"BBa_K078102\", \"type\": \"Coding\", \"description\": \"dxnB\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_K079012\", \"type\": \"Inverter\", \"description\": \"mbv \", \"info\": \"mbvmb Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_K079013\", \"type\": \"RBS\", \"description\": \"fs\", \"info\": \"fs sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K079022\", \"type\": \"Generator\", \"description\": \"..\", \"info\": \"... Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12IN\"}, {\"id\": \"BBa_K079025\", \"type\": \"Intermediate\", \"description\": \"..\", \"info\": \".. assembly Compatibility: 10COMPATIBLE WITH RFC[10] . . 12\"}, {\"id\": \"BBa_K079027\", \"type\": \"Reporter\", \"description\": \"...\", \"info\": \".... Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12IN\"}, {\"id\": \"BBa_K079028\", \"type\": \"Reporter\", \"description\": \"...\", \"info\": \".... Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12IN\"}, {\"id\": \"BBa_K079033\", \"type\": \"Generator\", \"description\": \"...\", \"info\": \"... Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12IN\"}, {\"id\": \"BBa_K079034\", \"type\": \"Generator\", \"description\": \"..\", \"info\": \".. assembly Compatibility: 10COMPATIBLE WITH RFC[10] . . 12\"}, {\"id\": \"BBa_K079035\", \"type\": \"Generator\", \"description\": \"..\", \"info\": \".. assembly Compatibility: 10COMPATIBLE WITH RFC[10] . . 12\"}, {\"id\": \"BBa_K091109\", \"type\": \"Coding\", \"description\": \"LuxS\", \"info\": \"LuxS is a synthase that produces DPD, which spontaneously forms the AI-2 signaling \"}, {\"id\": \"BBa_K091156\", \"type\": \"Regulatory\", \"description\": \"pLux\", \"info\": \"pLux is a modified version of BBa_R0062 containing the -35 region\"}, {\"id\": \"BBa_K092902\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K094001\", \"type\": \"Coding\", \"description\": \"CheZ\", \"info\": \"10Compatible with RFC[10] 12INCOMPATIBLE WITH rfc[12]\"}, {\"id\": \"BBa_K094113\", \"type\": \"Coding\", \"description\": \"lacZ\", \"info\": \"lacZ the cheY* gene is installed in front of a lacI operon . this lacI\"}, {\"id\": \"BBa_K103010\", \"type\": \"Coding\", \"description\": \"OmpA\", \"info\": \"Ompa Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_K104000\", \"type\": \"Coding\", \"description\": \"tp53\", \"info\": \"tp53 Tumour protein p53 - Guardian of the Genome Sequence and Features Assembly Comp\"}, {\"id\": \"BBa_K1051501\", \"type\": \"DNA\", \"description\": \"Cln3\", \"info\": \"Cln3 Cln3, prolong the cell cycle . assembly compatibility: 10COMPATIBLE WITH R\"}, {\"id\": \"BBa_K106026\", \"type\": \"Coding\", \"description\": \"Sir3\", \"info\": \"Sir3 is a protein that interacts with sir4 and sir2 to silence DNA . assembly comp\"}, {\"id\": \"BBa_K108000\", \"type\": \"Coding\", \"description\": \"MutS\", \"info\": \"MutS methyl-directed mismatch repair protein of e.coli sequence and features assembly compatibility: 10\"}, {\"id\": \"BBa_K108001\", \"type\": \"Coding\", \"description\": \"SRRz\", \"info\": \"SRRz enterobacteria phage lambda lysis genes sequence and features assembly compatibility\"}, {\"id\": \"BBa_K108002\", \"type\": \"Coding\", \"description\": \"FlgA\", \"info\": \"flaga assembly protein for flagellar basal-body periplasmic P ring of e.\"}, {\"id\": \"BBa_K108003\", \"type\": \"Coding\", \"description\": \"FlgB\", \"info\": \"flagellar component of cell-proximal portion of basal-body rod of e.coli .\"}, {\"id\": \"BBa_K108004\", \"type\": \"Coding\", \"description\": \"FlgC\", \"info\": \"flagellar component of cell-proximal portion of basal-body rod of e.coli .\"}, {\"id\": \"BBa_K108005\", \"type\": \"Coding\", \"description\": \"FlgH\", \"info\": \"flagellar protein of basal-body outer-membrane l ring of e.coli\"}, {\"id\": \"BBa_K108006\", \"type\": \"Coding\", \"description\": \"FlgI\", \"info\": \"FlgI flagellar basal body protein of e.coli Sequence and Features Assembly Compatibility:\"}, {\"id\": \"BBa_K108007\", \"type\": \"Coding\", \"description\": \"FliD\", \"info\": \"flagellar filament capping protein of e.coli Sequence and Features Assembly Compatibility: 10COMPA\"}, {\"id\": \"BBa_K108008\", \"type\": \"Coding\", \"description\": \"FliI\", \"info\": \"flagellum-specific ATP synthase of e.coli sequence and features assembly Compatibility:\"}, {\"id\": \"BBa_K108009\", \"type\": \"Coding\", \"description\": \"FliK\", \"info\": \"flagellar hook-length control protein of e.coli Sequence and Features Assembly Compatibility: 10COM\"}, {\"id\": \"BBa_K108010\", \"type\": \"Coding\", \"description\": \"FliM\", \"info\": \"flagellar motor switching and energizing component of e.coli sequence and features assembly compatibility\"}, {\"id\": \"BBa_K108011\", \"type\": \"Coding\", \"description\": \"FliN\", \"info\": \"flagellar motor switching and energizing component of e.coli Sequence and Features Assembly Compat\"}, {\"id\": \"BBa_K108012\", \"type\": \"Coding\", \"description\": \"MotA\", \"info\": \"motA proton conductor component of flagella motor of e.coli Sequence and Features Assembly Compat\"}, {\"id\": \"BBa_K108013\", \"type\": \"Coding\", \"description\": \"YcgR\", \"info\": \"ycgr protein involved in flagellar function of e.coli Sequence and Features Assembly Compat\"}, {\"id\": \"BBa_K108014\", \"type\": \"Regulatory\", \"description\": \"PR\", \"info\": \"PR promoter of alcaligenes eutrophus phar gene Sequence and Features Assembly Comp\"}, {\"id\": \"BBa_K108015\", \"type\": \"Coding\", \"description\": \"PhaR\", \"info\": \"PhaR polyhydroxyalkanoate synthesis repressor of alcaligenes eu\"}, {\"id\": \"BBa_K108016\", \"type\": \"Regulatory\", \"description\": \"PP\", \"info\": \"PP promoter of alcaligenes eutrophus PhaP gene sequence and features assembly comp\"}, {\"id\": \"BBa_K108017\", \"type\": \"Coding\", \"description\": \"PhaP\", \"info\": \"phasin protein of alcaligenes eutrophus sequence and features assembly compatibility:\"}, {\"id\": \"BBa_K108019\", \"type\": \"Coding\", \"description\": \"PhbC\", \"info\": \"PhbC poly-beta-hydroxybutyrate polymerase of wautersta eutroph\"}, {\"id\": \"BBa_K108020\", \"type\": \"Coding\", \"description\": \"Dam\", \"info\": \"dam causes DNA methylation within the sequence GATC, preventing cleavage by the MboI\"}, {\"id\": \"BBa_K108021\", \"type\": \"Coding\", \"description\": \"Fis\", \"info\": \"fis is an activator of ribosomal RNA transcription as well as other genes . it \"}, {\"id\": \"BBa_K108022\", \"type\": \"Coding\", \"description\": \"RuvA\", \"info\": \"part information is collated here to help future users of the BioBrick registry . in the presence of ATP\"}, {\"id\": \"BBa_K108023\", \"type\": \"Coding\", \"description\": \"RuvB\", \"info\": \"RuvB ATP-dependent DNA helicase, component of resolvasome, of e.\"}, {\"id\": \"BBa_K108024\", \"type\": \"Coding\", \"description\": \"RuvC\", \"info\": \"RuvC is a nuclease that resolves Holliday junction intermediates in genetic re\"}, {\"id\": \"BBa_K108025\", \"type\": \"Regulatory\", \"description\": \"Pu\", \"info\": \"pu promoter of pseudomonas putida XylUWCMA\"}, {\"id\": \"BBa_K108026\", \"type\": \"Coding\", \"description\": \"XylA\", \"info\": \"XylA xylose isomerase of pseudomonas puti\"}, {\"id\": \"BBa_K108027\", \"type\": \"Coding\", \"description\": \"XylM\", \"info\": \"XylM xylene monooxygenase of pseudomona\"}, {\"id\": \"BBa_K108028\", \"type\": \"Coding\", \"description\": \"XylB\", \"info\": \"XylB xylulokinase of pseudomona\"}, {\"id\": \"BBa_K108029\", \"type\": \"Coding\", \"description\": \"XylS\", \"info\": \"XylS regulatory protein of pseudomonas putida xy\"}, {\"id\": \"BBa_K112900\", \"type\": \"Regulatory\", \"description\": \"Pbad\", \"info\": \"this part is in BBb Format . it is flanked by BamHI and BglI\"}, {\"id\": \"BBa_K112901\", \"type\": \"Coding\", \"description\": \"ccdB\", \"info\": \"iGEM HQ This part is in BBb Format. it is flanked by BamHI\"}, {\"id\": \"BBa_K112907\", \"type\": \"Regulatory\", \"description\": \"Pcon\", \"info\": \"Pcon a constitutive promoter Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH R\"}, {\"id\": \"BBa_K113006\", \"type\": \"Coding\", \"description\": \"RFP\", \"info\": \"RFP RFP Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K113020\", \"type\": \"Reporter\", \"description\": \"GFP\", \"info\": \"GFP We cannot detect green signal by using BBa_I719015, so we decided to adapt the\"}, {\"id\": \"BBa_K121000\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K121005\", \"type\": \"Reporter\", \"description\": \"test\", \"info\": \"test This is test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K121006\", \"type\": \"Coding\", \"description\": \"test\", \"info\": \"test teast Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K121097\", \"type\": \"Composite\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K121098\", \"type\": \"Composite\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K121099\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K121998\", \"type\": \"Composite\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K123003\", \"type\": \"Regulatory\", \"description\": \"ER\", \"info\": \"when estrogen is present the receptor binds to it and forms a homodimer . this homod\"}, {\"id\": \"BBa_K125505\", \"type\": \"Coding\", \"description\": \"sE\", \"info\": \"sE se master switch Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH R\"}, {\"id\": \"BBa_K130000\", \"type\": \"Translational_Unit\", \"description\": \"srlD\", \"info\": \"srlD ORF encoding for sorbitol dehydrogenase .\"}, {\"id\": \"BBa_K130001\", \"type\": \"Coding\", \"description\": \"lipD\", \"info\": \"lipD from white rot fungus (Phanerochaete chrysospor\"}, {\"id\": \"BBa_K132018\", \"type\": \"Generator\", \"description\": \"araC\", \"info\": \"arac araC+B0010+b0012 Sequence and Features Assembly Compatibility: 10\"}, {\"id\": \"BBa_K133016\", \"type\": \"Coding\", \"description\": \"CF\", \"info\": \"CF \\u2013 chimeric fusion protein, which retains the central, most antigenic segment of H.\"}, {\"id\": \"BBa_K133025\", \"type\": \"Coding\", \"description\": \"LPP\", \"info\": \"LPP is a lipopolypeptide that activates TLR1, TLR2, TLR6 \"}, {\"id\": \"BBa_K133052\", \"type\": \"Coding\", \"description\": \"UB33\", \"info\": \"urease epitope UB33 is a peptide derived from the catalytic site of\"}, {\"id\": \"BBa_K133057\", \"type\": \"Coding\", \"description\": \"HpaA\", \"info\": \"neuraminyllactose-binding hemagglutinin from helicobacter\"}, {\"id\": \"BBa_K133059\", \"type\": \"Coding\", \"description\": \"RGD\", \"info\": \"RGD is arginine-glycine-aspartic amino acid sequence, present on several extra\"}, {\"id\": \"BBa_K133066\", \"type\": \"Reporter\", \"description\": \"GFP\", \"info\": \"GFP green fluorescence protein (mCerulean) WITHOUT stop codon .\"}, {\"id\": \"BBa_K133071\", \"type\": \"Coding\", \"description\": \"UreB\", \"info\": \"UreB is a subunit of enzyme urease, composed of A and B subunit . application\"}, {\"id\": \"BBa_K133140\", \"type\": \"Coding\", \"description\": \"GpA\", \"info\": \"glycophorin transmembrane region was used as a membrane anchor and dimerization domain . sequence\"}, {\"id\": \"BBa_K134900\", \"type\": \"Reporter\", \"description\": \"GFP\", \"info\": \"GFP this is the gfp protein sequence and features assembly compatibility: 10COMPATIBLE WITH\"}, {\"id\": \"BBa_K137000\", \"type\": \"Coding\", \"description\": \"katE\", \"info\": \"katE catalase information is collated here to help future users of the BioBrick registry . cat\"}, {\"id\": \"BBa_K137001\", \"type\": \"Coding\", \"description\": \"LacY\", \"info\": \"lacY codes for beta-galactoside permease which regulates the transport of lactose into\"}, {\"id\": \"BBa_K137007\", \"type\": \"Coding\", \"description\": \"fimE\", \"info\": \"fimE gene sequence and features assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_K137015\", \"type\": \"Coding\", \"description\": \"LacY\", \"info\": \"lacY lactose permease Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH\"}, {\"id\": \"BBa_K137052\", \"type\": \"Coding\", \"description\": \"tetA\", \"info\": \"tetA Sequence codes only for resistance cassette . assembly compatibility: 10COMPATIBLE\"}, {\"id\": \"BBa_K137067\", \"type\": \"Coding\", \"description\": \"katG\", \"info\": \"katG is a bifunctional enzyme, displaying both catalase activity and broad-spectrum peroxid\"}, {\"id\": \"BBa_K137111\", \"type\": \"Coding\", \"description\": \"lamB\", \"info\": \"lamB Assembly Compatibility: 10compatible with rfc[10] 12compatible\"}, {\"id\": \"BBa_K137112\", \"type\": \"Coding\", \"description\": \"lamB\", \"info\": \"lamB is the a porin protein which is part of the maltose pathway . it is\"}, {\"id\": \"BBa_K137113\", \"type\": \"Coding\", \"description\": \"rcsA\", \"info\": \"rcsA is a gene responsible for regulating capsule synthesis . it has also been shown to\"}, {\"id\": \"BBa_K141000\", \"type\": \"Coding\", \"description\": \"Ucp1\", \"info\": \"the uncoupling protein UCP1 is a proton carrier characteristic of brown adipose tissue\"}, {\"id\": \"BBa_K141001\", \"type\": \"Coding\", \"description\": \"Ucp-\", \"info\": \"our mutant strains do not have the same growing rate as Ucp+ when they are expressing the protein \"}, {\"id\": \"BBa_K142077\", \"type\": \"Plasmid\", \"description\": \"pMA\", \"info\": \"pMA amp resistance plasmid . sequence and features assembly compatibility: 10INCOMPA\"}, {\"id\": \"BBa_K147000\", \"type\": \"Coding\", \"description\": \"cheZ\", \"info\": \"cheZ motility protein is a protein kinase which dephosphorylates cheY \"}, {\"id\": \"BBa_K147002\", \"type\": \"Coding\", \"description\": \"xylE\", \"info\": \"xylE encodes the enzyme catechol 2,3-dioxygenase . cat\"}, {\"id\": \"BBa_K147003\", \"type\": \"Coding\", \"description\": \"ohbA\", \"info\": \"ohbA is a subunit of the ortho-halobenzoate 1,2-dioxy\"}, {\"id\": \"BBa_K149000\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test asfasf Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_K150006\", \"type\": \"Conjugation\", \"description\": \"oriT\", \"info\": \"oriT - Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K150108\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K153006\", \"type\": \"Project\", \"description\": \"BarA\", \"info\": \"10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 132\"}, {\"id\": \"BBa_K157043\", \"type\": \"Coding\", \"description\": \"CFP\", \"info\": \"CFP CFP under the control of a CMV promoter . sequence and features assembly compatibility:\"}, {\"id\": \"BBa_K174010\", \"type\": \"Coding\", \"description\": \"KinA\", \"info\": \"spo0A is the master regulator of sporulation in B. subtilis . activation of spo\"}, {\"id\": \"BBa_K177045\", \"type\": \"Temporary\", \"description\": \"temp\", \"info\": \"temp temp Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K185013\", \"type\": \"Coding\", \"description\": \"SmpB\", \"info\": \"SmpB is an essential part of e. coli rescue system, together with tmRNA .\"}, {\"id\": \"BBa_K185021\", \"type\": \"Composite\", \"description\": \"xxx\", \"info\": \"xxx None Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K187028\", \"type\": \"Coding\", \"description\": \"trpA\", \"info\": \"trpA encodes the alpha subunit of tryptophan synthase . it\"}, {\"id\": \"BBa_K187030\", \"type\": \"Coding\", \"description\": \"trpC\", \"info\": \"trpC is a bifunction enzyme that serves as both indole-3-glyce\"}, {\"id\": \"BBa_K187031\", \"type\": \"Coding\", \"description\": \"trpD\", \"info\": \"trpD encodes anthranilate synthase component II . it cataly\"}, {\"id\": \"BBa_K187032\", \"type\": \"Coding\", \"description\": \"trpE\", \"info\": \"trpE encodes anthranilate synthase component I, in the trypto\"}, {\"id\": \"BBa_K188004\", \"type\": \"Temporary\", \"description\": \"fsfa\", \"info\": \"fsfa afasf Sequence and Features Assembly Compatibility: 10COMPAT\"}, {\"id\": \"BBa_K188009\", \"type\": \"Temporary\", \"description\": \"sa\", \"info\": \"sa asdf sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_K188027\", \"type\": \"Composite\", \"description\": \"luxI\", \"info\": \"luxi luxI Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_K188028\", \"type\": \"Regulatory\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K188341\", \"type\": \"Temporary\", \"description\": \"tetR\", \"info\": \"tetR x Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC\"}, {\"id\": \"BBa_K188661\", \"type\": \"Temporary\", \"description\": \"ccdB\", \"info\": \"ccdb all parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K188774\", \"type\": \"Generator\", \"description\": \"no.1\", \"info\": \"lacI protein can bind to pLacI and repress the expression, but lactose\"}, {\"id\": \"BBa_K188777\", \"type\": \"Conjugation\", \"description\": \"aka\", \"info\": \"aka zx Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_K188778\", \"type\": \"Conjugation\", \"description\": \"as\", \"info\": \"as as Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K188779\", \"type\": \"Other\", \"description\": \"no.6\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_K188900\", \"type\": \"Device\", \"description\": \"1234\", \"info\": \"1234 1234 Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K188901\", \"type\": \"Reporter\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K188902\", \"type\": \"Reporter\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K188903\", \"type\": \"Generator\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K188904\", \"type\": \"Reporter\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K188905\", \"type\": \"Measurement\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K190001\", \"type\": \"Coding\", \"description\": \"gvpA\", \"info\": \"gvpA is a gas vesicle gene identified in bacillus megaterium\"}, {\"id\": \"BBa_K190004\", \"type\": \"Coding\", \"description\": \"gvpB\", \"info\": \"gvpB is thought to be one of the proteins forming the vesicle itself .\"}, {\"id\": \"BBa_K190014\", \"type\": \"Coding\", \"description\": \"gvpU\", \"info\": \"gas vesicle gene identified in bacillus megaterium . forms part of the g\"}, {\"id\": \"BBa_K190018\", \"type\": \"Coding\", \"description\": \"HmtA\", \"info\": \"HmtA Heavy Metal Transporter A is able to transport copper ions across the membrane (and to \"}, {\"id\": \"BBa_K190019\", \"type\": \"Coding\", \"description\": \"fMT \", \"info\": \"fMT is a metallothionein, binding arsenite(III) and ars\"}, {\"id\": \"BBa_K190020\", \"type\": \"Coding\", \"description\": \"MymT\", \"info\": \"MymT is a methallothionein binding copper (II) ions . it is\"}, {\"id\": \"BBa_K190021\", \"type\": \"Coding\", \"description\": \"SmtA\", \"info\": \"SmtA is a metallothionein that binds Zn (II) \"}, {\"id\": \"BBa_K190028\", \"type\": \"Coding\", \"description\": \"GlpF\", \"info\": \"GlpF is an aquaglycerol porin of E. coli which facilitates the transport of\"}, {\"id\": \"BBa_K191000\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K194999\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K197021\", \"type\": \"Coding\", \"description\": \"EILD\", \"info\": \"leucine zippers are short peptides which form alpha helices that compliment each other .\"}, {\"id\": \"BBa_K197022\", \"type\": \"Coding\", \"description\": \"KILR\", \"info\": \"leucine zippers are short peptides which form alpha helices that compliment each other .\"}, {\"id\": \"BBa_K197023\", \"type\": \"Coding\", \"description\": \"Ag4\", \"info\": \"peptides have been shown to mediate inorganic crystal growth and shape . the Ag4 \"}, {\"id\": \"BBa_K200003\", \"type\": \"Coding\", \"description\": \"Rfal\", \"info\": \"Rfal is an enzyme responsible for the ligation of an O-antigen to the core oligo\"}, {\"id\": \"BBa_K200004\", \"type\": \"Coding\", \"description\": \"TaqI\", \"info\": \"TaqI is a type II restriction enzyme that recognises the sequence TCGA . its activity can be\"}, {\"id\": \"BBa_K206108\", \"type\": \"Temporary\", \"description\": \"421\", \"info\": \"421 ? Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K208000\", \"type\": \"Coding\", \"description\": \"GFP\", \"info\": \"GFP was previously mutated for improved fluorescence photostability . the cycle 3 mutant produces a\"}, {\"id\": \"BBa_K211001\", \"type\": \"Coding\", \"description\": \"RI7\", \"info\": \"RI7 encodes the rat olfactory GPCR receptor, clone I7 \"}, {\"id\": \"BBa_K223038\", \"type\": \"Signalling\", \"description\": \"HlyA\", \"info\": \"HlyA gaattcggccgcttctagATGCCAACAATAACCACTGC\"}, {\"id\": \"BBa_K237007\", \"type\": \"Primer\", \"description\": \"VR2\", \"info\": \"BBa_G00101(VR) was modified to achieve a higher GC content, so that it\"}, {\"id\": \"BBa_K238008\", \"type\": \"Coding\", \"description\": \"VirA\", \"info\": \"VirA is a histidine kinase sensor originally found in agrobacterium \"}, {\"id\": \"BBa_K238009\", \"type\": \"Coding\", \"description\": \"VirG\", \"info\": \"VirG is the transcriptional activator of the virA/virg two-component signaling system\"}, {\"id\": \"BBa_K238010\", \"type\": \"Coding\", \"description\": \"RpoA\", \"info\": \"RpoA encodes the alfa subunit of the RNA polymerase . it has illegal\"}, {\"id\": \"BBa_K238024\", \"type\": \"RNA\", \"description\": \"lock\", \"info\": \"this device was originally designed by John Anderson of berkeley iGEM team 2006 (BBa_J\"}, {\"id\": \"BBa_K243030\", \"type\": \"Protein_Domain\", \"description\": \"SEG\", \"info\": \"the SEG linker was created to combine our protein domains fok_a and foki_i to \"}, {\"id\": \"BBa_K243031\", \"type\": \"Plasmid\", \"description\": \"pMA \", \"info\": \"plasmid was used by the Freiburg team for construction and cloning of parts according to the BioB\"}, {\"id\": \"BBa_K243033\", \"type\": \"Plasmid\", \"description\": \"pEX\", \"info\": \"pEX is our main E. coli protein expression vector . it possesses the restriction sites X\"}, {\"id\": \"BBa_K243037\", \"type\": \"Plasmid\", \"description\": \"pBAD\", \"info\": \"pBAD cloning vector carries the restriction sites and an ampicilin resistance . expression\"}, {\"id\": \"BBa_K245001\", \"type\": \"Coding\", \"description\": \"X2\", \"info\": \"X2 coiled-coil... Sequence and Features Assembly Compatibility: 10COMPATIBLE\"}, {\"id\": \"BBa_K245021\", \"type\": \"Coding\", \"description\": \"cYFP\", \"info\": \"cYFP codes for the c-terminal of yellow flourescent protein (yfp) flourescence\"}, {\"id\": \"BBa_K245022\", \"type\": \"Coding\", \"description\": \"nYFP\", \"info\": \"the sequence of this part codes N-terminal of yellow flourescent protein (yfp) flourescence can only\"}, {\"id\": \"BBa_K245024\", \"type\": \"Coding\", \"description\": \"Z1\", \"info\": \"sequence encodes a short zinc binding peptide . assembly compatibility: 10COMPATIBLE WITH\"}, {\"id\": \"BBa_K245025\", \"type\": \"Coding\", \"description\": \"AUP\", \"info\": \"sequence encodes a short peptide for binding gold nanoparticles . assembly compatibility: 10\"}, {\"id\": \"BBa_K245026\", \"type\": \"Coding\", \"description\": \"TA\", \"info\": \"this part is the coding sequence for a synthetic trimerization domain TA . together with TB and\"}, {\"id\": \"BBa_K245027\", \"type\": \"Coding\", \"description\": \"TB\", \"info\": \"this part is the coding sequence for a synthetic trimerization domain TB . together with TA and\"}, {\"id\": \"BBa_K245028\", \"type\": \"Coding\", \"description\": \"TC\", \"info\": \"TC is the coding sequence for a synthetic trimerization domain TC . together with TA and\"}, {\"id\": \"BBa_K245029\", \"type\": \"Coding\", \"description\": \"DDD\", \"info\": \"trimerization coiled-coil sequence is composed of three segments that are combined to form a stagg\"}, {\"id\": \"BBa_K245030\", \"type\": \"Coding\", \"description\": \"KKK\", \"info\": \"trimerization coiled coil sequence, composed of three segments that are combined to form a staggered hetero\"}, {\"id\": \"BBa_K245031\", \"type\": \"Coding\", \"description\": \"EEE\", \"info\": \"trimerization coiled coil sequence is composed of three segments that are combined to form a staggered hetero\"}, {\"id\": \"BBa_K245038\", \"type\": \"Coding\", \"description\": \"NZ\", \"info\": \"NZ forms coiled coiles with CZ that can also be found in registry: BBa_\"}, {\"id\": \"BBa_K245039\", \"type\": \"Coding\", \"description\": \"CZ\", \"info\": \"CZ forms coiled coiles with NZ that can also be found in registry: BBa_\"}, {\"id\": \"BBa_K245042\", \"type\": \"Coding\", \"description\": \"VASP\", \"info\": \"the vasodilator-stimulated phosphoprotein (VASP) is a key regulator of\"}, {\"id\": \"BBa_K245046\", \"type\": \"Coding\", \"description\": \"ccdB\", \"info\": \"ccdb parts have been withdrawn from the registry . samples of parts containing the . \"}, {\"id\": \"BBa_K245114\", \"type\": \"Coding\", \"description\": \"LL37\", \"info\": \"sequence encodes an antimicrobial peptide cathelicidin ll-37 . assembly compatibility\"}, {\"id\": \"BBa_K245116\", \"type\": \"Coding\", \"description\": \"GyrB\", \"info\": \"sequence encodes a 24 kda fragment of gyrase subunit B . when an amino\"}, {\"id\": \"BBa_K245118\", \"type\": \"Coding\", \"description\": \"P1\", \"info\": \"sequence encodes coiled-coil segment that forms parallel heterodimer with P2 that can also be\"}, {\"id\": \"BBa_K245119\", \"type\": \"Coding\", \"description\": \"P2\", \"info\": \"sequence encodes coiled-coil segment that forms parallel heterodimer with P1 that can also be\"}, {\"id\": \"BBa_K245120\", \"type\": \"Coding\", \"description\": \"P3\", \"info\": \"sequence encodes coiled-coil segment that forms parallel heterodimer with P4 that can also be\"}, {\"id\": \"BBa_K245121\", \"type\": \"Coding\", \"description\": \"P4\", \"info\": \"sequence encodes coiled-coil segment that forms parallel heterodimer with P3 that can also be\"}, {\"id\": \"BBa_K245122\", \"type\": \"Coding\", \"description\": \"P5\", \"info\": \"sequence encodes coiled-coil segment that forms parallel heterodimer with P6 that can also be\"}, {\"id\": \"BBa_K245123\", \"type\": \"Coding\", \"description\": \"P6\", \"info\": \"sequence encodes coiled-coil segment that forms parallel heterodimer with P5 that can also be\"}, {\"id\": \"BBa_K245124\", \"type\": \"Coding\", \"description\": \"P7\", \"info\": \"sequence encodes coiled-coil segment that forms parallel heterodimer with P8 that can also be\"}, {\"id\": \"BBa_K245125\", \"type\": \"Coding\", \"description\": \"P8\", \"info\": \"sequence encodes coiled-coil segment that forms parallel heterodimer with P7 that can also be\"}, {\"id\": \"BBa_K245126\", \"type\": \"Coding\", \"description\": \"H1\", \"info\": \"sequence encodes homodimeric parallel coiled-coil segment . assembly compatibility: 10COM\"}, {\"id\": \"BBa_K245127\", \"type\": \"Coding\", \"description\": \"GCN\", \"info\": \"sequence encodes a homodimeric parallel coiled-coil segment GNC-p1(I\"}, {\"id\": \"BBa_K245128\", \"type\": \"Coding\", \"description\": \"p53\", \"info\": \"this part is the coding sequence for the tetramerization domain of the transcription factor p53 \"}, {\"id\": \"BBa_K245130\", \"type\": \"Coding\", \"description\": \"AEA\", \"info\": \"sequence encodes trimerization coiled coil sequence . composed of three segments that are combined to form a\"}, {\"id\": \"BBa_K245131\", \"type\": \"Coding\", \"description\": \"ELST\", \"info\": \"ELST The sequence encodes elastin-like segment . assembly compatibility: 10COMPA\"}, {\"id\": \"BBa_K245132\", \"type\": \"Coding\", \"description\": \"APH1\", \"info\": \"sequence encodes coiled-coil segment that forms antiparallel homodimer . similar to\"}, {\"id\": \"BBa_K245133\", \"type\": \"Coding\", \"description\": \"APH\", \"info\": \"sequence encodes coiled-coil segment that forms antiparallel homodimer . similar to\"}, {\"id\": \"BBa_K245134\", \"type\": \"Coding\", \"description\": \"BCR\", \"info\": \"sequence encodes coiled-coil segment that forms antiparallel homodimer . assembly comp\"}, {\"id\": \"BBa_K245135\", \"type\": \"Coding\", \"description\": \"APHE\", \"info\": \"sequence encodes coiled-coil segment that forms antiparallel homodimer . assembly comp\"}, {\"id\": \"BBa_K245138\", \"type\": \"Coding\", \"description\": \"x\", \"info\": \"x x Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K245139\", \"type\": \"Coding\", \"description\": \"RADA\", \"info\": \"sequence of this part codes a peptide comprised of four repeats of R-A-D-A\"}, {\"id\": \"BBa_K245140\", \"type\": \"Coding\", \"description\": \"mNGF\", \"info\": \"sequence encodes mouse nerve growts factor (mNGF) which causes diferentiation in neurons .\"}, {\"id\": \"BBa_K249016\", \"type\": \"Coding\", \"description\": \"mms6\", \"info\": \"mms6 is an enzyme derived from the Magnespirllum Magneticum bacteria . it utilize\"}, {\"id\": \"BBa_K252015\", \"type\": \"RBS\", \"description\": \"f\", \"info\": \"f ff Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_K256004\", \"type\": \"Coding\", \"description\": \"NorR\", \"info\": \"nitric oxide (NO) induces NO-detoxifying enzymes in e. coli\"}, {\"id\": \"BBa_K266013\", \"type\": \"Reporter\", \"description\": \"luxA\", \"info\": \"luxA Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K269000\", \"type\": \"Protein_Domain\", \"description\": \"OmcB\", \"info\": \"this gene is the first in the electron transport chain and works in concert with OmcE, OmcS, and\"}, {\"id\": \"BBa_K269001\", \"type\": \"Protein_Domain\", \"description\": \"OmcE\", \"info\": \"this gene is the first in the electron transport chain and works in concert with OmcB, OmcS, and\"}, {\"id\": \"BBa_K269002\", \"type\": \"Protein_Domain\", \"description\": \"OmcS\", \"info\": \"this gene is the first in the electron transport chain and works in concert with OmcE, OmcT, and\"}, {\"id\": \"BBa_K269003\", \"type\": \"Protein_Domain\", \"description\": \"OmcT\", \"info\": \"this gene is the first in the electron transport chain and works in concert with OmcE, OmcS, and\"}, {\"id\": \"BBa_K270005\", \"type\": \"Coding\", \"description\": \"XylR\", \"info\": \"XylR is a regulatory protien that is under constitutive expression of the pr promoter .\"}, {\"id\": \"BBa_K273020\", \"type\": \"RNA\", \"description\": \"E1A1\", \"info\": \"Antisense RNA against the formation of pyruvate dehydrogenase complex (PDC\"}, {\"id\": \"BBa_K273021\", \"type\": \"RNA\", \"description\": \"E1A2\", \"info\": \"E1A2 Antisense RNA against the formation of pyruvate dehydrogenase\"}, {\"id\": \"BBa_K273022\", \"type\": \"RNA\", \"description\": \"E1A3\", \"info\": \"E1A3 Antisense RNA against the formation of pyruvate dehydrogenase\"}, {\"id\": \"BBa_K273023\", \"type\": \"RNA\", \"description\": \"E1A4\", \"info\": \"E1A4 Antisense RNA against the formation of pyruvate dehydrogenase\"}, {\"id\": \"BBa_K273024\", \"type\": \"RNA\", \"description\": \"E1B1\", \"info\": \"Antisense RNA against the formation of pyruvate dehydrogenase complex (PDC\"}, {\"id\": \"BBa_K273025\", \"type\": \"RNA\", \"description\": \"E1B2\", \"info\": \"E1B2 Antisense RNA against the formation of pyruvate dehydrogenase\"}, {\"id\": \"BBa_K273026\", \"type\": \"RNA\", \"description\": \"E1B3\", \"info\": \"E1B3 Antisense RNA against the formation of pyruvate dehydrogenase\"}, {\"id\": \"BBa_K273027\", \"type\": \"RNA\", \"description\": \"E1B4\", \"info\": \"Antisense RNA against the formation of pyruvate dehydrogenase complex (PDC\"}, {\"id\": \"BBa_K273028\", \"type\": \"RNA\", \"description\": \"E21\", \"info\": \"E21 Antisense RNA against the formation of pyruvate dehydrogenase complex (\"}, {\"id\": \"BBa_K273029\", \"type\": \"RNA\", \"description\": \"E22\", \"info\": \"E22 Antisense RNA against the formation of pyruvate dehydrogenase complex (\"}, {\"id\": \"BBa_K273030\", \"type\": \"RNA\", \"description\": \"E23\", \"info\": \"E23 Antisense RNA against the formation of pyruvate dehydrogenase complex (\"}, {\"id\": \"BBa_K273031\", \"type\": \"RNA\", \"description\": \"E24\", \"info\": \"E24 Antisense RNA against the formation of pyruvate dehydrogenase complex (\"}, {\"id\": \"BBa_K289002\", \"type\": \"Coding\", \"description\": \"GSH\", \"info\": \"april 1 marks the first day of a three-day holiday in switzerland .\"}, {\"id\": \"BBa_K289003\", \"type\": \"Coding\", \"description\": \"GSH\", \"info\": \"GSH has a strong affinity to the lyophobic groove of PP1 . MCs\"}, {\"id\": \"BBa_K289005\", \"type\": \"Coding\", \"description\": \"PDC\", \"info\": \"PDC is a homotetrameric enzyme Pyruvate decarboxylase which can \"}, {\"id\": \"BBa_K289007\", \"type\": \"Other\", \"description\": \"Rbc\", \"info\": \"synechocystis sp. PCC6803 is a cyanobacteria\"}, {\"id\": \"BBa_K294060\", \"type\": \"Regulatory\", \"description\": \"test\", \"info\": \"test test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_K294120\", \"type\": \"RBS\", \"description\": \"nasa\", \"info\": \"nasa sequence and features assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K294206\", \"type\": \"Generator\", \"description\": \"sss\", \"info\": \"compatibility: 10compatible with rfc[10] 12compatible with RFC[\"}, {\"id\": \"BBa_K294354\", \"type\": \"Regulatory\", \"description\": \"test\", \"info\": \"test test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_K294898\", \"type\": \"Coding\", \"description\": \"GFP\", \"info\": \"GFP test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_K294902\", \"type\": \"Reporter\", \"description\": \"test\", \"info\": \"test test long Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K302006\", \"type\": \"Coding\", \"description\": \"spaI\", \"info\": \"spaI binds subtilin and prevents it from penetrating the cell membrane to form pores .\"}, {\"id\": \"BBa_K302007\", \"type\": \"Coding\", \"description\": \"spaF\", \"info\": \"spaF forms a membrane transporter that removes subtilin from the membrane, preventing it from forming pores\"}, {\"id\": \"BBa_K302008\", \"type\": \"Coding\", \"description\": \"spaE\", \"info\": \"spaE forms a membrane transporter that removes subtilin from the membrane, preventing it from forming pores\"}, {\"id\": \"BBa_K302009\", \"type\": \"Coding\", \"description\": \"spaG\", \"info\": \"spaG is one of three proteins from B. subtilis which form a membrane transporter that removes subtilin\"}, {\"id\": \"BBa_K302010\", \"type\": \"Coding\", \"description\": \"sfp\", \"info\": \"svp encodes for a 4'-Phosphopanthetheinyl-transfer\"}, {\"id\": \"BBa_K302011\", \"type\": \"Coding\", \"description\": \"swrA\", \"info\": \"swrA bacillus subtilis 168 is unable to biosynthesise flagella .\"}, {\"id\": \"BBa_K302019\", \"type\": \"Coding\", \"description\": \"spaB\", \"info\": \"10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 11\"}, {\"id\": \"BBa_K302023\", \"type\": \"Coding\", \"description\": \"spaS\", \"info\": \"spaS codes for the subtilin precursor peptide . assembly compatibility: 10COMPATIBLE WITH\"}, {\"id\": \"BBa_K302024\", \"type\": \"Coding\", \"description\": \"spaT\", \"info\": \"sequence and features assembly compatibility: 10compatible with RFC[10] 12compatibility with R\"}, {\"id\": \"BBa_K302025\", \"type\": \"Coding\", \"description\": \"spaB\", \"info\": \"10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 11\"}, {\"id\": \"BBa_K302026\", \"type\": \"Coding\", \"description\": \"spaC\", \"info\": \"spaC is a modifier of the subtilin precursor encoded by spaS . sequence and features assembly compat\"}, {\"id\": \"BBa_K302027\", \"type\": \"Coding\", \"description\": \"spaT\", \"info\": \"spaT codes for a subtilin transporter . assembly compatibility: 10COMPATIBLE WITH R\"}, {\"id\": \"BBa_K302028\", \"type\": \"Coding\", \"description\": \"spaB\", \"info\": \"spaB is a modifier of the subtilin precursor encoded by spaS . sequence and features assembly compat\"}, {\"id\": \"BBa_K302029\", \"type\": \"Coding\", \"description\": \"sacB\", \"info\": \"sacB encodes the enzyme levansucrase that catalyses the conversion of extracellular suc\"}, {\"id\": \"BBa_K302032\", \"type\": \"Coding\", \"description\": \"mazE\", \"info\": \"mazE Encodes the liable antitoxin to mazF in Bacillus Subtil\"}, {\"id\": \"BBa_K302033\", \"type\": \"Coding\", \"description\": \"mazF\", \"info\": \"BBa_K302033 encodes an endoribonuclease that cleaves \"}, {\"id\": \"BBa_K305000\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COMPA\"}, {\"id\": \"BBa_K307101\", \"type\": \"Other\", \"description\": \"parS\", \"info\": \"this part is parb protein binding site. it is involed in partition system . assembly compatibility:\"}, {\"id\": \"BBa_K307102\", \"type\": \"Other\", \"description\": \"dif\", \"info\": \"dif replication terminus of vibrio cholerae chromosome II sequence and features assembly comp\"}, {\"id\": \"BBa_K307105\", \"type\": \"Coding\", \"description\": \"rctB\", \"info\": \"rctB the Replication Initiator gene of vibrio cholerae chromos\"}, {\"id\": \"BBa_K307106\", \"type\": \"Coding\", \"description\": \"parB\", \"info\": \"parB is a chromosomeII partitioning protein from vibrio cholerae .\"}, {\"id\": \"BBa_K309099\", \"type\": \"Composite\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K310018\", \"type\": \"Regulatory\", \"description\": \"Hfq\", \"info\": \"Hfq coming soon Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_K314011\", \"type\": \"Coding\", \"description\": \"CapD\", \"info\": \"CapD is a protein native to bacillus anthracis . it cleaves poly-\"}, {\"id\": \"BBa_K314444\", \"type\": \"Coding\", \"description\": \"test\", \"info\": \"composite parts using this part will include the barcode . barcodes are discontinued, but one was appended to\"}, {\"id\": \"BBa_K314560\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test test part Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_K317035\", \"type\": \"Coding\", \"description\": \"pduP\", \"info\": \"pduP this part is enzyme relating to propandiol metabolization . localize at\"}, {\"id\": \"BBa_K317998\", \"type\": \"Coding\", \"description\": \"RhlA\", \"info\": \"Pseudomonas aeruginosa produces rhamnose-containing glycolipid bio\"}, {\"id\": \"BBa_K317999\", \"type\": \"Coding\", \"description\": \"RhlB\", \"info\": \"RhlB Pseudomonas aeruginosa produces rhamnose-containing\"}, {\"id\": \"BBa_K318516\", \"type\": \"Coding\", \"description\": \"RamA\", \"info\": \"10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 116\"}, {\"id\": \"BBa_K319033\", \"type\": \"Plasmid_Backbone\", \"description\": \"ESV\", \"info\": \"this plasmid can be used to eliminate an upstream PstI restriction site and a downstream B\"}, {\"id\": \"BBa_K320015\", \"type\": \"Protein_Domain\", \"description\": \"P25\", \"info\": \"IGEM EPFL team's was interested in the ookinete surface membrane proteins Pfs\"}, {\"id\": \"BBa_K320016\", \"type\": \"Protein_Domain\", \"description\": \"p28\", \"info\": \"IGEM EPFL team's was interested in the ookinete surface membrane proteins Pfs\"}, {\"id\": \"BBa_K320999\", \"type\": \"Protein_Domain\", \"description\": \"P25\", \"info\": \"P25 t Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K323104\", \"type\": \"Temporary\", \"description\": \"105\", \"info\": \"105 a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K323129\", \"type\": \"Temporary\", \"description\": \"130\", \"info\": \"130 a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_K323137\", \"type\": \"Temporary\", \"description\": \"138\", \"info\": \"138 a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K323140\", \"type\": \"Temporary\", \"description\": \"141\", \"info\": \"141 a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K323141\", \"type\": \"Temporary\", \"description\": \"142\", \"info\": \"142 a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K323142\", \"type\": \"Temporary\", \"description\": \"143\", \"info\": \"143 a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K323143\", \"type\": \"Temporary\", \"description\": \"144\", \"info\": \"144 a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K323144\", \"type\": \"Temporary\", \"description\": \"145\", \"info\": \"145 a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K336054\", \"type\": \"Composite\", \"description\": \"kkk\", \"info\": \"kkk kk Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_K341453\", \"type\": \"Coding\", \"description\": \"lacI\", \"info\": \"lacI is a member of the lacI-galr family of bacterial transcription regulators . lacI\"}, {\"id\": \"BBa_K341717\", \"type\": \"Coding\", \"description\": \"ToxR\", \"info\": \"ToxR cholera toxin transcriptional activator sequence and features assembly Compatibility: 10COMPA\"}, {\"id\": \"BBa_K341718\", \"type\": \"Coding\", \"description\": \"VH\", \"info\": \"VH is the heavy chain of antibody . we want to link it behind the toxR gene .\"}, {\"id\": \"BBa_K341719\", \"type\": \"Coding\", \"description\": \"VL\", \"info\": \"VL is the light chain of antibody . we also connect it after the toxR gene .\"}, {\"id\": \"BBa_K341720\", \"type\": \"Coding\", \"description\": \"pCTX\", \"info\": \"pCTX is a promoter recognized by toxr . sequence and features assembly compatibility:\"}, {\"id\": \"BBa_K361010\", \"type\": \"Regulatory\", \"description\": \" \", \"info\": \"Sequence and Features Assembly Compatibility: 10Compatible WITH RFC[10] 12COMPATIBLE\"}, {\"id\": \"BBa_K364202\", \"type\": \"Coding\", \"description\": \"hBAX\", \"info\": \"hBAX is a pro-apoptotic member of the Bcl-2 protein family .\"}, {\"id\": \"BBa_K364300\", \"type\": \"Coding\", \"description\": \"hVDR\", \"info\": \"... Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]I\"}, {\"id\": \"BBa_K371037\", \"type\": \"Coding\", \"description\": \"pduA\", \"info\": \"pduA at each end is special DNA sequence that make this parts compatible to BBF RFC 53 .\"}, {\"id\": \"BBa_K371037\", \"type\": \"Coding\", \"description\": \"pduA\", \"info\": \"pduA at each end is special DNA sequence that make this parts compatible to BBF RFC 53 .\"}, {\"id\": \"BBa_K371039\", \"type\": \"Coding\", \"description\": \"pduU\", \"info\": \"this part encodes pdu J proterin, which is a shell protein of Citrobactor fr\"}, {\"id\": \"BBa_K371040\", \"type\": \"Coding\", \"description\": \"pduB\", \"info\": \"this part encodes pduB, which is a shell protein of pDU . it is \"}, {\"id\": \"BBa_K371056\", \"type\": \"Protein_Domain\", \"description\": \"ATG\", \"info\": \"ATG ATG Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K371060\", \"type\": \"Protein_Domain\", \"description\": \"GGT\", \"info\": \"codon for glycine . assembly compatibility: 10COMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_K377700\", \"type\": \"Temporary\", \"description\": \"blah\", \"info\": \"april 1 marks the first day of a three-day holiday in switzerland .\"}, {\"id\": \"BBa_K377703\", \"type\": \"RBS\", \"description\": \"Temp\", \"info\": \"Flu operon/ Ag43 NOTHING Sequence and Features Assembly Compatibility: 10INCOMPATIBLE\"}, {\"id\": \"BBa_K377704\", \"type\": \"Inverter\", \"description\": \"FimB\", \"info\": \"fimB inverts an invertible DNA region containing the promoter for the fim operon \"}, {\"id\": \"BBa_K387008\", \"type\": \"Coding\", \"description\": \"Oct4\", \"info\": \"Oct4 human transcriptional factor that can induce iPSCs (induce Pluripotent Stem Cell\"}, {\"id\": \"BBa_K392029\", \"type\": \"Intermediate\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K398100\", \"type\": \"Coding\", \"description\": \"bbc1\", \"info\": \"bbc1 protein from chlamydomonas sp. W-80 that enhance\"}, {\"id\": \"BBa_K398200\", \"type\": \"Coding\", \"description\": \"AlnA\", \"info\": \"AlnA is an emulsifying protein present in the alasan complex which naturally occurs in \"}, {\"id\": \"BBa_K398201\", \"type\": \"Coding\", \"description\": \"OprG\", \"info\": \"outer membrane emulsifying protein from pseudomonas putida \"}, {\"id\": \"BBa_K398300\", \"type\": \"Coding\", \"description\": \"AlkS\", \"info\": \"Transcription factor involved in the expression of alkane-degrading genes in pseudom\"}, {\"id\": \"BBa_K404245\", \"type\": \"Project\", \"description\": \" \", \"info\": \"Sequence and Features Assembly Compatibility: 10Compatible WITH RFC[10] 12COMPATIBLE\"}, {\"id\": \"BBa_K404249\", \"type\": \"Project\", \"description\": \" \", \"info\": \"Sequence and Features Assembly Compatibility: 10Compatible WITH RFC[10] 12COMPATIBLE\"}, {\"id\": \"BBa_K404307\", \"type\": \"Composite\", \"description\": \" \", \"info\": \"x Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K404316\", \"type\": \"Project\", \"description\": \"EGFP\", \"info\": \"EGFP was improved by the iGEM team Freiburg_Bioware 2010 by converting it into RFC\"}, {\"id\": \"BBa_K419007\", \"type\": \"DNA\", \"description\": \"alkG\", \"info\": \"alkG sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K419009\", \"type\": \"DNA\", \"description\": \"alkH\", \"info\": \"alkH sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K426003\", \"type\": \"Coding\", \"description\": \"tn5\", \"info\": \"tn5 encodes a DNA modifying enzyme . comes from enterobacterial tranposons .\"}, {\"id\": \"BBa_K426006\", \"type\": \"Coding\", \"description\": \"zf+\", \"info\": \"DNA binding domains are proteins that bind to a specific DNA sequences . zinc finger nucleas\"}, {\"id\": \"BBa_K426007\", \"type\": \"Coding\", \"description\": \"zf-\", \"info\": \"DNA binding domains are proteins that bind to a specific DNA sequences . zinc finger nucleas\"}, {\"id\": \"BBa_K500005\", \"type\": \"DNA\", \"description\": \"Luc1\", \"info\": \"Luc1 N-terminal of luciferase contains 1-436aa of 550a\"}, {\"id\": \"BBa_K500006\", \"type\": \"DNA\", \"description\": \"Luc2\", \"info\": \"luciferase contains 440-550aa sequence . assembly compatibility: 10COMPA\"}, {\"id\": \"BBa_K500007\", \"type\": \"DNA\", \"description\": \"MBP\", \"info\": \"conformation of this protein will change when maltose combine with MBP . MBP is a mal\"}, {\"id\": \"BBa_K500008\", \"type\": \"DNA\", \"description\": \"Nub\", \"info\": \"Nub N-terminal of ubiquitin contains 1-35aa of 76aa sequence and features\"}, {\"id\": \"BBa_K509005\", \"type\": \"Reporter\", \"description\": \"GLuc\", \"info\": \"Gluc is a bioluminescent luciferase protein that emits green light . it\"}, {\"id\": \"BBa_K510034\", \"type\": \"Coding\", \"description\": \"Swi6\", \"info\": \"Swi6 is a critical protein for heterochromatin assembly in fission yeast . it contains a\"}, {\"id\": \"BBa_K510035\", \"type\": \"Coding\", \"description\": \"Swi6\", \"info\": \"Swi6 is a critical protein for heterochromatin assembly in fission yeast Schizosaccharo\"}, {\"id\": \"BBa_K512000\", \"type\": \"Coding\", \"description\": \"cas3\", \"info\": \"cas3 belongs to a series of genes responsible for CRISPR interference to work . cas3 has been described\"}, {\"id\": \"BBa_K518005\", \"type\": \"Coding\", \"description\": \"cheZ\", \"info\": \"cheZ is responsible for the dephosphorylation of flagellum-regulating protein CheY . che\"}, {\"id\": \"BBa_K519004\", \"type\": \"Composite\", \"description\": \"a\", \"info\": \"a a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K519005\", \"type\": \"Composite\", \"description\": \"a\", \"info\": \"a a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K519010\", \"type\": \"Protein_Domain\", \"description\": \"SmtA\", \"info\": \"SmtA is a type II metallothionein with a reduced cys content\"}, {\"id\": \"BBa_K524204\", \"type\": \"Plasmid\", \"description\": \"pTE\", \"info\": \"pTE is a template plasmid for generating linear DNA substrate for lambda RED \"}, {\"id\": \"BBa_K530001\", \"type\": \"Coding\", \"description\": \"CRTE\", \"info\": \"part has been improved by the DTU-Denmark 2016 team by removing the illegal restriction site AgeI at\"}, {\"id\": \"BBa_K530002\", \"type\": \"Coding\", \"description\": \"CRTI\", \"info\": \"part has been improved by the DTU-Denmark 2016 team by removing the illegal restriction site BgIII\"}, {\"id\": \"BBa_K530025\", \"type\": \"Coding\", \"description\": \"Vtc2\", \"info\": \"Vtc2 catalyzes the conversion of GDP-L-Galactose to L\"}, {\"id\": \"BBa_K530026\", \"type\": \"Coding\", \"description\": \"GME\", \"info\": \"GME catalyzes the conversion of GDP-D-mannose to GDP-L-Galac\"}, {\"id\": \"BBa_K530027\", \"type\": \"Coding\", \"description\": \"Vtc4\", \"info\": \"Vtc4 catalyzes the conversion of L-Galactose-1-P to\"}, {\"id\": \"BBa_K539413\", \"type\": \"Coding\", \"description\": \"vioD\", \"info\": \"vioD gene codes for the fourth enzyme in the violacein biosynthetic pathway - an\"}, {\"id\": \"BBa_K539513\", \"type\": \"Coding\", \"description\": \"vioC\", \"info\": \"vioC codes for the last enzyme in the violacein biosynthetic pathway - an F\"}, {\"id\": \"BBa_K545005\", \"type\": \"RBS\", \"description\": \"fha \", \"info\": \"fha is a RBS containing a binding site for the rsmA protein .\"}, {\"id\": \"BBa_K545006\", \"type\": \"RBS\", \"description\": \"mag \", \"info\": \"mag is a RBS containing a binding site for the rsmA protein . r\"}, {\"id\": \"BBa_K549010\", \"type\": \"Intermediate\", \"description\": \"LuxE\", \"info\": \"LuxE contains only the coding sequence of the gene luxE from photorhabdus luminescence .\"}, {\"id\": \"BBa_K554003\", \"type\": \"Coding\", \"description\": \"SoxR\", \"info\": \"SoxR is a transcription factor found in bacteria and is activated during superoxide or nitric\"}, {\"id\": \"BBa_K554004\", \"type\": \"Coding\", \"description\": \"IL10\", \"info\": \"IL-10 is an anti-inflammatory interleukin, produced mainly by monocytes . IL\"}, {\"id\": \"BBa_K554005\", \"type\": \"Coding\", \"description\": \"IL12\", \"info\": \"IL-12 is a pro-inflammatory type-1 cytokine which bridges the innate resistance and adapt\"}, {\"id\": \"BBa_K554009\", \"type\": \"Coding\", \"description\": \"TolC\", \"info\": \"TolC is part of the hemolysin secretion system, very important to export the proteins produced inside\"}, {\"id\": \"BBa_K564000\", \"type\": \"RNA\", \"description\": \"ChiX\", \"info\": \"ChiX is 84 bp long Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH\"}, {\"id\": \"BBa_K566027\", \"type\": \"Coding\", \"description\": \"CcaS\", \"info\": \"Ccas is a member of cyanobacteriochrome family of proteins . phycocyanobi\"}, {\"id\": \"BBa_K566028\", \"type\": \"Coding\", \"description\": \"CcaR\", \"info\": \"CcaR is the response regulator of CcaS, wich is a member of cyanobacter\"}, {\"id\": \"BBa_K567020\", \"type\": \"Reporter\", \"description\": \"KanR\", \"info\": \"KanR The start codon of KanR gene is mutated from ATG to CGA . PT\"}, {\"id\": \"BBa_K569011\", \"type\": \"Coding\", \"description\": \"FGFR\", \"info\": \"FGFR is a membrane-bound receptor that dimerizes in response to the ligand FGF\"}, {\"id\": \"BBa_K569017\", \"type\": \"Coding\", \"description\": \"CheY\", \"info\": \"CheY is a chemotaxis protein that is activated by the protein CheA . after Che\"}, {\"id\": \"BBa_K575003\", \"type\": \"Coding\", \"description\": \"LasR\", \"info\": \"LasR was sequenced from the genome Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH\"}, {\"id\": \"BBa_K584017\", \"type\": \"Composite\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K587000\", \"type\": \"Other\", \"description\": \"RecA\", \"info\": \"RecA complete sequence: GAATTCGCGGCCGCTTCTAGATGGCTATCGAAAACAAACA\"}, {\"id\": \"BBa_K588000\", \"type\": \"Coding\", \"description\": \"trpR\", \"info\": \"trpR is a transcription repressor that binds to the rp operator as\"}, {\"id\": \"BBa_K588001\", \"type\": \"Regulatory\", \"description\": \"ptrp\", \"info\": \"ptrp is a tryptophan promoter and operator . it will be repressed\"}, {\"id\": \"BBa_K590080\", \"type\": \"Coding\", \"description\": \"mamK\", \"info\": \"mamK is a filamentous, actin-like protein that creates a scaffold for magnetosome\"}, {\"id\": \"BBa_K590081\", \"type\": \"Coding\", \"description\": \"mamI\", \"info\": \"mamI is required for vesicle formation for later magnetosome growth in AMB-1 .\"}, {\"id\": \"BBa_K592002\", \"type\": \"Coding\", \"description\": \"ccaR\", \"info\": \"ccaR functions as a photoreversible switch between green (535nm) and red (672n\"}, {\"id\": \"BBa_K607015\", \"type\": \"Intermediate\", \"description\": \"cI \", \"info\": \"cI gene codes for the bacteriophage  repressor from phage lambd\"}, {\"id\": \"BBa_K628004\", \"type\": \"Composite\", \"description\": \"tba\", \"info\": \"tba sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_K631039\", \"type\": \"Coding\", \"description\": \"nahD\", \"info\": \"nahd test sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_K634000\", \"type\": \"Coding\", \"description\": \"exaD\", \"info\": \"exaD is a sensor kinase which (in the presence of ethanol) phosphoryl\"}, {\"id\": \"BBa_K634001\", \"type\": \"Coding\", \"description\": \"exaE\", \"info\": \"exaE is a transcription factor that is activated by phosphorylation from exaD . it\"}, {\"id\": \"BBa_K641000\", \"type\": \"Regulatory\", \"description\": \"Pctx\", \"info\": \"Pctx is a promoter activated by ToxR dimers . toxr dimers\"}, {\"id\": \"BBa_K648035\", \"type\": \"Regulatory\", \"description\": \"RecA\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_K648036\", \"type\": \"Regulatory\", \"description\": \"RecA\", \"info\": \"RecA is a protein used by E. coli to repair and maintain DNA . many normal laboratory strains\"}, {\"id\": \"BBa_K648037\", \"type\": \"Regulatory\", \"description\": \"RecA\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_K648038\", \"type\": \"Regulatory\", \"description\": \"RecA\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_K648124\", \"type\": \"Regulatory\", \"description\": \"RecA\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_K649010\", \"type\": \"Regulatory\", \"description\": \"test\", \"info\": \"test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COMPA\"}, {\"id\": \"BBa_K649901\", \"type\": \"Reporter\", \"description\": \"test\", \"info\": \"test x Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_K660004\", \"type\": \"Reporter\", \"description\": \"iLOV\", \"info\": \"iLOV is a variant of LOV2 (http://parts.igem.org/Part\"}, {\"id\": \"BBa_K669000\", \"type\": \"Coding\", \"description\": \"chiS\", \"info\": \"chiS belongs to a signal transduction systems specific for chitin oligosaccharides\"}, {\"id\": \"BBa_K669001\", \"type\": \"Coding\", \"description\": \"chiP\", \"info\": \"chiP is a chitin oligosaccharide specific porin of vibrio\"}, {\"id\": \"BBa_K669002\", \"type\": \"Coding\", \"description\": \"CBP\", \"info\": \"chitooligosaccharide-binding protein (cbp) is a cytoplasm\"}, {\"id\": \"BBa_K678070\", \"type\": \"Plasmid\", \"description\": \"p68\", \"info\": \"p68 is a plasmid that can be used to assay promoter activity in asperg\"}, {\"id\": \"BBa_K726004\", \"type\": \"Coding\", \"description\": \"RelB\", \"info\": \"RelB part of a toxin-antitoxin system . Compatibility: 10COM\"}, {\"id\": \"BBa_K726006\", \"type\": \"Coding\", \"description\": \"YefM\", \"info\": \"antitoxin of the yefM-yoeB toxin-antitoxin\"}, {\"id\": \"BBa_K726013\", \"type\": \"DNA\", \"description\": \"YoeB\", \"info\": \"YoeB, Toxic component of a toxin-antitoxin (TA) module \"}, {\"id\": \"BBa_K764002\", \"type\": \"Coding\", \"description\": \"WbnK\", \"info\": \"fucosyltransferase wbnK adds a branched -L\"}, {\"id\": \"BBa_K764003\", \"type\": \"Coding\", \"description\": \"WfcA\", \"info\": \"close relatives include: wfeE from Escherichia coli O32, WfaO\"}, {\"id\": \"BBa_K764004\", \"type\": \"Coding\", \"description\": \"WclY\", \"info\": \"wclY is a glycosyltransferase from e. coli O\"}, {\"id\": \"BBa_K764007\", \"type\": \"Coding\", \"description\": \"WbiP\", \"info\": \"wbiP adds a -D-Galactose donor sugar onto an\"}, {\"id\": \"BBa_K769100\", \"type\": \"Coding\", \"description\": \"luxA\", \"info\": \"luxA Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_K769101\", \"type\": \"Coding\", \"description\": \"luxD\", \"info\": \"luxD Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_K769200\", \"type\": \"Coding\", \"description\": \"ribA\", \"info\": \"this gene is from BL21(DE3) It is coding a protein \\\"GTP cyclohydr\"}, {\"id\": \"BBa_K769201\", \"type\": \"Coding\", \"description\": \"ribB\", \"info\": \"this gene is from BL21(DE3) it is coding protein \\\"3,4-dihydroxy-2-\"}, {\"id\": \"BBa_K769203\", \"type\": \"Coding\", \"description\": \"ribC\", \"info\": \"ribc is coding for a protein \\\"riboflavin synthase subunit alpha\\\"\"}, {\"id\": \"BBa_K769205\", \"type\": \"Coding\", \"description\": \"ribF\", \"info\": \"ribf This gene is from BL21(DE3) This is coding a protein\\\"regulator\"}, {\"id\": \"BBa_K771301\", \"type\": \"Coding\", \"description\": \"TesA\", \"info\": \"TesA is involved in the biosynthesis of fatty acids in e.coli . the full-length\"}, {\"id\": \"BBa_K771302\", \"type\": \"Coding\", \"description\": \"FabG\", \"info\": \"FabG involves in the biosynthesis of fatty acids in E.coli . fatty acid synthesis initiated\"}, {\"id\": \"BBa_K771303\", \"type\": \"Coding\", \"description\": \"FabI\", \"info\": \"FabI involves in the biosynthesis of fatty acids in E.coli . the fatty acid synthesis\"}, {\"id\": \"BBa_K771304\", \"type\": \"Coding\", \"description\": \"FabZ\", \"info\": \"FabZ involves in the biosynthesis of fatty acids in E.coli . fatty acid synthesis initiated\"}, {\"id\": \"BBa_K776004\", \"type\": \"Coding\", \"description\": \"PrrC\", \"info\": \"PrrC is involved in transducing signal from cbb3 cytochrome c oxid\"}, {\"id\": \"BBa_K776005\", \"type\": \"Coding\", \"description\": \"PpsR\", \"info\": \"PpsR funcion is repression of pigment biosynthesis . psr funcion inhibits\"}, {\"id\": \"BBa_K777109\", \"type\": \"Coding\", \"description\": \"fliC\", \"info\": \"fliC gene codes for flagellin, the subunit that forms the flagellar filament of \"}, {\"id\": \"BBa_K777113\", \"type\": \"Coding\", \"description\": \"motA\", \"info\": \"motA codes for a part of the flagellar motor complex . motA proteins represent the proton conducting\"}, {\"id\": \"BBa_K777117\", \"type\": \"Coding\", \"description\": \"motB\", \"info\": \"this gene codes for motB, a part of the flagellar motor . motA and motB\"}, {\"id\": \"BBa_K777121\", \"type\": \"Coding\", \"description\": \"yhjH\", \"info\": \"yhjH is a phosphodiesterase involved in regulating the levels of c-d\"}, {\"id\": \"BBa_K787001\", \"type\": \"Coding\", \"description\": \"Ter \", \"info\": \"Ter NADH-dependent crotonyl-CoA Ter from treponema dent\"}, {\"id\": \"BBa_K798018\", \"type\": \"Coding\", \"description\": \"TRP1\", \"info\": \"TRP1 encodes phosphoribosylanthranilate isomerase that catalyze\"}, {\"id\": \"BBa_K805013\", \"type\": \"Coding\", \"description\": \"CcdB\", \"info\": \"ccdB (control of cell death) gene cannot be requested due to patent issues . ige\"}, {\"id\": \"BBa_K805014\", \"type\": \"Coding\", \"description\": \"LuxI\", \"info\": \"Luxi test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_K805016\", \"type\": \"Composite\", \"description\": \"LuxI\", \"info\": \"Luxi BBa_B0034,bba_c0061,bby_b0015\"}, {\"id\": \"BBa_K817001\", \"type\": \"Coding\", \"description\": \"FadR\", \"info\": \"FadR is a construct encoding natural repressor for pfad, a\"}, {\"id\": \"BBa_K817004\", \"type\": \"Coding\", \"description\": \"SP1\", \"info\": \"modified pCI-1 (design1) helps to deliver other peptide out of the bacteria . sequence and features\"}, {\"id\": \"BBa_K817005\", \"type\": \"Regulatory\", \"description\": \"SP2\", \"info\": \"modified pCI-1 (design1) helps to deliver other peptide out of the bacteria . sequence and features\"}, {\"id\": \"BBa_K817006\", \"type\": \"Coding\", \"description\": \"SP3\", \"info\": \"SP3 is a signal peptide that helps to deliver other signals out of the bacteria . it is \"}, {\"id\": \"BBa_K821000\", \"type\": \"Plasmid\", \"description\": \"Test\", \"info\": \"Test Test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K821999\", \"type\": \"Plasmid\", \"description\": \"Test\", \"info\": \"Test Test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_K826008\", \"type\": \"Coding\", \"description\": \"fdr\", \"info\": \"fdr acts on iron-sulfur proteins as donors, with NAD+ or NADP+ as\"}, {\"id\": \"BBa_K826009\", \"type\": \"Coding\", \"description\": \"ruba\", \"info\": \"ruba rubredoxin sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_K826010\", \"type\": \"Coding\", \"description\": \"aldH\", \"info\": \"aldH catalyzes the aldehydes to CO2 at the same time, another enzyme\"}, {\"id\": \"BBa_K835001\", \"type\": \"Protein_Domain\", \"description\": \"EnvZ\", \"info\": \"EnvZ perceive osmolality shift, and control expression of membrane protein OmpF and OmpC\"}, {\"id\": \"BBa_K838004\", \"type\": \"Regulatory\", \"description\": \"mCMV\", \"info\": \"mCMV is a minimal promoter for mammalian cells . this part is included in the\"}, {\"id\": \"BBa_K842000\", \"type\": \"Coding\", \"description\": \"flhB\", \"info\": \"flhB is one of three flagella genes responsible for the generation of proteins that export flagellin to\"}, {\"id\": \"BBa_K842001\", \"type\": \"Coding\", \"description\": \"flhD\", \"info\": \"flhD is directly induced by several separate systems, among these is the two-component quo\"}, {\"id\": \"BBa_K842002\", \"type\": \"Coding\", \"description\": \"flgJ\", \"info\": \"flgJ transcribes a flagellum specific muramidase which hydrolyzes\"}, {\"id\": \"BBa_K842003\", \"type\": \"Coding\", \"description\": \"fliA\", \"info\": \"fliA is an alternate sigma factor for the class 3 flagella operons . when\"}, {\"id\": \"BBa_K842004\", \"type\": \"Coding\", \"description\": \"fliC\", \"info\": \"used for reconstitution of flagella apparatus in E. coli B strains . cloned into\"}, {\"id\": \"BBa_K842005\", \"type\": \"Coding\", \"description\": \"fliH\", \"info\": \"fliH functions as part of the flagella specific export system and is necessary for flageller growth and assembly\"}, {\"id\": \"BBa_K842006\", \"type\": \"Coding\", \"description\": \"cheA\", \"info\": \"activated cheA self-phosphorylates itself by hydrolyzing ATP in order to gain a \"}, {\"id\": \"BBa_K842007\", \"type\": \"Coding\", \"description\": \"cheB\", \"info\": \"cheB removes the methyl group that are attached to the gamma-glutamyl \"}, {\"id\": \"BBa_K842008\", \"type\": \"Coding\", \"description\": \"cheW\", \"info\": \"cheW is involved in the transmission of sensory signals from the chemoreceptors to the flagellar\"}, {\"id\": \"BBa_K842009\", \"type\": \"Coding\", \"description\": \"cheY\", \"info\": \"cheY is a regulatory protein that reverses the direction of flagella rotation from counter-clockwise to clock\"}, {\"id\": \"BBa_K842010\", \"type\": \"Coding\", \"description\": \"cheZ\", \"info\": \"cheZ is a regulatory protein that constantly dephosphorylates cheY that is attached to a flag\"}, {\"id\": \"BBa_K842011\", \"type\": \"Coding\", \"description\": \"motA\", \"info\": \"motA is a structural protein for the stationary element of the flagella motor . used for reconstitution of flag\"}, {\"id\": \"BBa_K842012\", \"type\": \"Coding\", \"description\": \"motB\", \"info\": \"motB is a structural protein for the stationary element of the flagella motor . the protein works in conjunction with\"}, {\"id\": \"BBa_K851003\", \"type\": \"Coding\", \"description\": \"XylR\", \"info\": \"XylR is the regulatory protein of the xylose operon in B. subtilis .\"}, {\"id\": \"BBa_K858000\", \"type\": \"Signalling\", \"description\": \"SdiA\", \"info\": \"LuxR ortholog is found in the LT2 strain of salmonella . dimerizes and activates\"}, {\"id\": \"BBa_K858004\", \"type\": \"Coding\", \"description\": \"NucB\", \"info\": \"NucB is a nuclease that was taken from the Bacillus subtilis strain 168\"}, {\"id\": \"BBa_K864204\", \"type\": \"Coding\", \"description\": \"OmpF\", \"info\": \"OmpF forms cell pores facilitating passive diffusion of small molecules across the outer cell membrane . forms a mixed\"}, {\"id\": \"BBa_K864680\", \"type\": \"Coding\", \"description\": \"tetM\", \"info\": \"this gene confers tetracycline resistance (at least 12 g/ml to E \"}, {\"id\": \"BBa_K875003\", \"type\": \"Composite\", \"description\": \"CymR\", \"info\": \"composite produces constitutively the CymR regulator protein, that binds the cumate operator repressing\"}, {\"id\": \"BBa_K879011\", \"type\": \"Coding\", \"description\": \"RFP\", \"info\": \"RFP The part contains sequence from E1010 with removal of Kpn I site . this was done to\"}, {\"id\": \"BBa_K879017\", \"type\": \"Coding\", \"description\": \"LacI\", \"info\": \"lacI lacI Sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K879018\", \"type\": \"Coding\", \"description\": \"TetR\", \"info\": \"TetR Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_K879927\", \"type\": \"Plasmid\", \"description\": \" \", \"info\": \"this plasmid was designed to have its copy number controlled by the presence or absence of the inducer molecule\"}, {\"id\": \"BBa_K879928\", \"type\": \"Plasmid\", \"description\": \" \", \"info\": \"this plasmid was designed to have its copy number controlled by the presence or absence of the inducer molecule\"}, {\"id\": \"BBa_K892008\", \"type\": \"Coding\", \"description\": \"osmY\", \"info\": \"osmY codes for the Osmotically induced protein y which has been shown to have export\"}, {\"id\": \"BBa_K892009\", \"type\": \"Composite\", \"description\": \"fucO\", \"info\": \"fucO is required for e. coli to utilize ethylene glycol as a food source .\"}, {\"id\": \"BBa_K892010\", \"type\": \"Composite\", \"description\": \"aldA\", \"info\": \"aldA is one of the genes required for e. coli to utilize ethylene glycol as a\"}, {\"id\": \"BBa_K892016\", \"type\": \"Signalling\", \"description\": \"Cph8\", \"info\": \"Cph8 red light sensor (cph1/envz chimera) sequence and features assembly comp\"}, {\"id\": \"BBa_K892101\", \"type\": \"Temporary\", \"description\": \"fdsa\", \"info\": \"fdsa sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K902010\", \"type\": \"Coding\", \"description\": \"PhoP\", \"info\": \"PhoP is a transcription factor which is phosphorylated by PhoQ BBa_K90\"}, {\"id\": \"BBa_K902011\", \"type\": \"Coding\", \"description\": \"PhoQ\", \"info\": \"PhoQ is part of the PhoPQ two component regulatory system . it acts as a transme\"}, {\"id\": \"BBa_K902068\", \"type\": \"Coding\", \"description\": \"RhaS\", \"info\": \"RhaS is a transcription factor which is part of the rhaSR operon . it activates\"}, {\"id\": \"BBa_K902069\", \"type\": \"Coding\", \"description\": \"RhaR\", \"info\": \"in the presence of rhamnose, it complexes with the sugar to upregulate the r\"}, {\"id\": \"BBa_K918012\", \"type\": \"DNA\", \"description\": \"ADH2\", \"info\": \"ADH2 s Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_K934027\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test z Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_K950005\", \"type\": \"Reporter\", \"description\": \"lacZ\", \"info\": \"lacZ lacZ can be used as reporter gene sequence and features assembly compatibility: 10COMPATIBLE WITH\"}, {\"id\": \"BBa_M1011\", \"type\": \"Protein_Domain\", \"description\": \"phaP\", \"info\": \"noggin is a protein involved at multiple stages of vertebrate embryonic development including neural induction and bone\"}, {\"id\": \"BBa_M11301\", \"type\": \"Coding\", \"description\": \"OxyA\", \"info\": \"OxyA streptomyces rimosus oxytetracycline gene cluster, complete\"}, {\"id\": \"BBa_M11302\", \"type\": \"Coding\", \"description\": \"OxyB\", \"info\": \"OxyB streptomyces rimosus oxytetracycline gene cluster, complete\"}, {\"id\": \"BBa_M11304\", \"type\": \"Coding\", \"description\": \"OxyK\", \"info\": \"OxyK streptomyces rimosus oxytetracycline gene cluster, complete\"}, {\"id\": \"BBa_M11305\", \"type\": \"Coding\", \"description\": \"OxyF\", \"info\": \"OxyF streptomyces rimosus oxytetracycline gene cluster, complete\"}, {\"id\": \"BBa_M11306\", \"type\": \"Coding\", \"description\": \"oxyL\", \"info\": \"oxyL OxyL Streptomyces rimosus Sequence and Features Assembly Compatibility\"}, {\"id\": \"BBa_M11307\", \"type\": \"Coding\", \"description\": \"OxyR\", \"info\": \"OxyR streptomyces coelicolor a3(2) AhpD (ahp\"}, {\"id\": \"BBa_M11308\", \"type\": \"Coding\", \"description\": \"OxyQ\", \"info\": \"Oxyq OxyQ Streptomyces rimosus sequence and features assembly Compatibility:\"}, {\"id\": \"BBa_M11309\", \"type\": \"Coding\", \"description\": \"OxyT\", \"info\": \"OxyT Streptomyces rimosus sequence and features assembly Compatibility: 10COMPA\"}, {\"id\": \"BBa_M11310\", \"type\": \"Coding\", \"description\": \"OleY\", \"info\": \"OleY oleY streptomyces antibioticus sequence and features assembly Compatibility: 10COM\"}, {\"id\": \"BBa_M11311\", \"type\": \"Coding\", \"description\": \"OleV\", \"info\": \"OleV streptomyces antibioticus 2,3-dehydratase (oleV) sequence\"}, {\"id\": \"BBa_M11312\", \"type\": \"Coding\", \"description\": \"OleW\", \"info\": \"OleW putative 3-ketoreductase streptomyces antibioticus sequence and features assembly\"}, {\"id\": \"BBa_M11313\", \"type\": \"Coding\", \"description\": \"urdR\", \"info\": \"urdR NDP-hexose 4-ketoreductase UrdR sequence\"}, {\"id\": \"BBa_M11314\", \"type\": \"Coding\", \"description\": \"oleL\", \"info\": \"oleL dTDP-4-keto-6-deoxyglucose 3,5-ep\"}, {\"id\": \"BBa_M11315\", \"type\": \"Coding\", \"description\": \"oleS\", \"info\": \"oleS dTDP-D-glucose synthase [Streptomy\"}, {\"id\": \"BBa_M11316\", \"type\": \"Coding\", \"description\": \"oleE\", \"info\": \"oleE dehydratase [Streptomyces antibioticus] sequence and features assembly compat\"}, {\"id\": \"BBa_M11317\", \"type\": \"Coding\", \"description\": \"oxyN\", \"info\": \"oxyN streptomyces rimosus oxytetracycline gene cluster, complete\"}, {\"id\": \"BBa_M11318\", \"type\": \"Coding\", \"description\": \"OxyD\", \"info\": \"OxyD [Streptomyces rimosus]. Sequence and Features Assembly Compatibility:\"}, {\"id\": \"BBa_M1145\", \"type\": \"Coding\", \"description\": \"part\", \"info\": \"part ad Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_M1147\", \"type\": \"Temporary\", \"description\": \"PhaP\", \"info\": \"PhaP asgasgf Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC\"}, {\"id\": \"BBa_M11560\", \"type\": \"Coding\", \"description\": \"CUP2\", \"info\": \"CUP2 - copper-binding transcription factor; activates transcription of the metallothionein genes\"}, {\"id\": \"BBa_M11561\", \"type\": \"Coding\", \"description\": \"CAD1\", \"info\": \"CAD1 calmium induced transcriptional activator sequence and features assembly Compatibility: 10COMPA\"}, {\"id\": \"BBa_M11563\", \"type\": \"Temporary\", \"description\": \"cole\", \"info\": \"cole cole sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_M11564\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]I\"}, {\"id\": \"BBa_M11565\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]I\"}, {\"id\": \"BBa_M11566\", \"type\": \"Temporary\", \"description\": \"test\", \"info\": \"test test Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]I\"}, {\"id\": \"BBa_M11567\", \"type\": \"Temporary\", \"description\": \"phaC\", \"info\": \"phaC gkjfglkdjsglpdsf Sequence and Features\"}, {\"id\": \"BBa_M1160\", \"type\": \"Composite\", \"description\": \"Test\", \"info\": \"Test Sample Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]I\"}, {\"id\": \"BBa_M1161\", \"type\": \"Temporary\", \"description\": \"Test\", \"info\": \"Test Check 1 2 Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_M1166\", \"type\": \"Coding\", \"description\": \"PhaP\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_M1167\", \"type\": \"Temporary\", \"description\": \"ssn\", \"info\": \"ssn protein sequence Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC\"}, {\"id\": \"BBa_M1173\", \"type\": \"Temporary\", \"description\": \"asdf\", \"info\": \"asdf ads;flj as Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH\"}, {\"id\": \"BBa_M1176\", \"type\": \"Coding\", \"description\": \"part\", \"info\": \"part ad Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_M1177\", \"type\": \"Temporary\", \"description\": \"HK\", \"info\": \"HK HK Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_M1182\", \"type\": \"Composite\", \"description\": \"PhaP\", \"info\": \"PhaP HK Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_M1185\", \"type\": \"Coding\", \"description\": \"phB\", \"info\": \"phB a;sldfsd;j Sequence and Features Assembly Compatibility:\"}, {\"id\": \"BBa_M1188\", \"type\": \"Coding\", \"description\": \"PhaP\", \"info\": \"PhaP HK Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_M1189\", \"type\": \"Temporary\", \"description\": \"ssn\", \"info\": \"ssn Protein sequence Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_M1190\", \"type\": \"Coding\", \"description\": \"PhaP\", \"info\": \"PhaP fhh Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC\"}, {\"id\": \"BBa_M1191\", \"type\": \"Temporary\", \"description\": \"Ryan\", \"info\": \"Ryan eug Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_M1199\", \"type\": \"Coding\", \"description\": \"PhaP\", \"info\": \"PhaP Polyhydroxyalkanoates (PHAs) are polyoxoesters that are produced\"}, {\"id\": \"BBa_M12067\", \"type\": \"Coding\", \"description\": \"E1\", \"info\": \"the receptors on the liver recognize this protein, which leads to endocytosis of the particle displaying the\"}, {\"id\": \"BBa_M1298\", \"type\": \"Coding\", \"description\": \"phaP\", \"info\": \"phaP This part is used in polyhydroxyalkanoic acid granule binding . it is\"}, {\"id\": \"BBa_M1299\", \"type\": \"Coding\", \"description\": \"PhaP\", \"info\": \"-See Blackboard Attachment Sequence and Features . assembly compatibility: 10INCOMPATIBLE\"}, {\"id\": \"BBa_M1300\", \"type\": \"Coding\", \"description\": \"Phap\", \"info\": \"10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 112\"}, {\"id\": \"BBa_M1311\", \"type\": \"Coding\", \"description\": \"bcd\", \"info\": \"bcd enzyme open reading frame coding sequence . 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_M1355\", \"type\": \"Conjugation\", \"description\": \"RS1\", \"info\": \"RS1 homology region for recombination into synechococcus PCC 7002 sequence\"}, {\"id\": \"BBa_M1356\", \"type\": \"Conjugation\", \"description\": \"RS2\", \"info\": \"RS2 right side homology region for recombination into synechococcus PCC 700\"}, {\"id\": \"BBa_M1398\", \"type\": \"Inverter\", \"description\": \"PhaP\", \"info\": \"Ralstonia eutropha phasin (phaP) mRNA, complete c\"}, {\"id\": \"BBa_M1399\", \"type\": \"Coding\", \"description\": \"PhaP\", \"info\": \"Ralstonia eutropha phasin gene coding region re-evaluated \"}, {\"id\": \"BBa_M1401\", \"type\": \"Coding\", \"description\": \"PhaP\", \"info\": \"Ralstonia eutropha phasin (phaP) mRNA, complete c\"}, {\"id\": \"BBa_M1402\", \"type\": \"Temporary\", \"description\": \"phaP\", \"info\": \"Ralstonia eutropha phasin (phaP) mRNA, complete c\"}, {\"id\": \"BBa_M1409\", \"type\": \"Coding\", \"description\": \"ribD\", \"info\": \"ribD gene for synthesizing riboflavin . sequence and features assembly compatibility:\"}, {\"id\": \"BBa_M1414\", \"type\": \"Coding\", \"description\": \"ribF\", \"info\": \"ribf gene for breaking down the riboflavin sequence and features assembly compatibility: 10compat\"}, {\"id\": \"BBa_M1440\", \"type\": \"Coding\", \"description\": \"ribB\", \"info\": \"ribB catalyzes the synthesis of the 4-carbon compound 3,4-dihydroxy-2-\"}, {\"id\": \"BBa_M1526\", \"type\": \"Composite\", \"description\": \"sgd1\", \"info\": \"sgd1 sequence and features assembly Compatibility: 10INCOMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_M1527\", \"type\": \"Temporary\", \"description\": \"sgd\", \"info\": \"10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 112\"}, {\"id\": \"BBa_M1619\", \"type\": \"Temporary\", \"description\": \"loxr\", \"info\": \"loxr Reverse compliment for lox Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH\"}, {\"id\": \"BBa_M1699\", \"type\": \"Coding\", \"description\": \"scrT\", \"info\": \"scrT is a protein which serves as a symporter for sucrose into the cell \"}, {\"id\": \"BBa_M1839\", \"type\": \"Composite\", \"description\": \"gfgf\", \"info\": \"gfg sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_M1843\", \"type\": \"Composite\", \"description\": \"His\", \"info\": \"His His Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]I\"}, {\"id\": \"BBa_M1845\", \"type\": \"Composite\", \"description\": \"His6\", \"info\": \"His6 sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12COMPA\"}, {\"id\": \"BBa_M1871\", \"type\": \"Temporary\", \"description\": \"GFP\", \"info\": \"GFP sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12COMPA\"}, {\"id\": \"BBa_M1872\", \"type\": \"Temporary\", \"description\": \"GFP\", \"info\": \"GFP ampicilin sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10\"}, {\"id\": \"BBa_M1887\", \"type\": \"Composite\", \"description\": \"fgf\", \"info\": \"fgf sequence and features assembly compatibility: 10INCOMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_M1888\", \"type\": \"Composite\", \"description\": \"fdf\", \"info\": \"fdf sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12\"}, {\"id\": \"BBa_M1989\", \"type\": \"Composite\", \"description\": \"aa\", \"info\": \"10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 192\"}, {\"id\": \"BBa_M1990\", \"type\": \"Temporary\", \"description\": \"Aaaa\", \"info\": \"Aaaa Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_M1991\", \"type\": \"Temporary\", \"description\": \"aa\", \"info\": \"10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 112\"}, {\"id\": \"BBa_M1998\", \"type\": \"Temporary\", \"description\": \"blah\", \"info\": \"10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 112\"}, {\"id\": \"BBa_M300067\", \"type\": \"Other\", \"description\": \"misc\", \"info\": \"compatibility: 10COMPATIBLE WITH RFC[10] . 12Compatible with RFC\"}, {\"id\": \"BBa_M300068\", \"type\": \"Other\", \"description\": \"misc\", \"info\": \"compatibility: 10COMPATIBLE WITH RFC[10] . 12Compatible with RFC\"}, {\"id\": \"BBa_M36005\", \"type\": \"Coding\", \"description\": \"ASDF\", \"info\": \"ASDF ASD Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_M36113\", \"type\": \"Regulatory\", \"description\": \"asdf\", \"info\": \"asdf sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12COM\"}, {\"id\": \"BBa_M36123\", \"type\": \"RBS\", \"description\": \"sdfa\", \"info\": \"sdfa adffafadg Sequence and Features Assembly Compatibility:\"}, {\"id\": \"BBa_M36711\", \"type\": \"Coding\", \"description\": \"rubA\", \"info\": \"rubA codes for a protein that supplies reducing electrons to an alkane hydroxylating reaction \"}, {\"id\": \"BBa_M39008\", \"type\": \"Coding\", \"description\": \"NanR\", \"info\": \"this is the repressor for the Nan Operon and is turned off by the presence of sialic\"}, {\"id\": \"BBa_M39009\", \"type\": \"Coding\", \"description\": \"NanT\", \"info\": \"NanT allows the transport of Sialic Acid into the cell . assembly Compatibility: 10INCOMPA\"}, {\"id\": \"BBa_M39013\", \"type\": \"Coding\", \"description\": \"LasR\", \"info\": \"LasL is used in quorum sensing in p. aeruginosa . it is\"}, {\"id\": \"BBa_M39015\", \"type\": \"Coding\", \"description\": \"HrpR\", \"info\": \"this is one of two proteins (HrpS and HrpR) needed for the hrp\"}, {\"id\": \"BBa_M39017\", \"type\": \"Coding\", \"description\": \"TetR\", \"info\": \"TetR is the coding region for the repressor . assembly compatibility: 10INCOM\"}, {\"id\": \"BBa_M39903\", \"type\": \"Other\", \"description\": \"foo\", \"info\": \"foo foo Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]\"}, {\"id\": \"BBa_Q00121\", \"type\": \"Inverter\", \"description\": \"LacI\", \"info\": \"lacI lacI QPI with B0030 which according to preliminary experiments is a \\\"medium\\\" strength R\"}, {\"id\": \"BBa_Q00400\", \"type\": \"Inverter\", \"description\": \"Tet\", \"info\": \"Tet Tet QPI with B0030 which according to preliminary experiments is a \\\"strong\\\" strength RBS\"}, {\"id\": \"BBa_Q02121\", \"type\": \"Inverter\", \"description\": \"LacI\", \"info\": \"lacI lacI QPI with B0032 which according to preliminary experiments is a \\\"medium\\\" strength R\"}, {\"id\": \"BBa_Q02400\", \"type\": \"Inverter\", \"description\": \"Tet\", \"info\": \"Tet Tet QPI with B0032 which according to preliminary experiments is a \\\"medium\\\" strength R\"}, {\"id\": \"BBa_T3000\", \"type\": \"Temporary\", \"description\": \"OK\", \"info\": \"sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] . 12COMPA\"}, {\"id\": \"BBa_T4000\", \"type\": \"Coding\", \"description\": \"luxC\", \"info\": \"luxC is useful for producing light in bacteria from endogenous substrates . it is the first enzyme in\"}, {\"id\": \"BBa_V1001\", \"type\": \"Cell\", \"description\": \"DH5a\", \"info\": \"DH5a F- endA1 glnV44 thi-1 recA1 relA1\"}, {\"id\": \"BBa_Y1005\", \"type\": \"Other\", \"description\": \"2u\", \"info\": \"2u Yeast origin Usage and biology Replicates many times in a cell Sequence and Features Assembly\"}, {\"id\": \"BBa_Z52934\", \"type\": \"Coding\", \"description\": \"vdh\", \"info\": \"origin is from pseudomonas aeruginosa . vdh\"}]\n",
      "\n",
      "[{\"id\": \"BBa_C0060\", \"type\": \"Coding\", \"description\": \"autoinducer inactivation enzyme from Bacillus%3B hydrolyzes acetyl homoserine lactone\", \"info\": \"BBa_C0060 encodes an enzyme that hydrolyzes acetyl homoser\"}, {\"id\": \"BBa_C0080\", \"type\": \"Coding\", \"description\": \"araC arabinose operon regulatory protein (repressor/activator) from E. coli (+LVA)\", \"info\": \"araC arabinose operon regulatory protein (repressor/activator) from e. coli\"}, {\"id\": \"BBa_E0033\", \"type\": \"Reporter\", \"description\": \"LacZ alpha fragment%3B complements matching N-terminal deletion mutant (lacZ-omega)\", \"info\": \"lacZ-alpha fragment can be used as a detection system with N-terminal deletion mutants of lac\"}, {\"id\": \"BBa_E0035\", \"type\": \"Reporter\", \"description\": \"LacZ alpha fragment%3B complements matching N-terminal deletion mutant (lacZ-omega)\", \"info\": \"this part encodes the alpha fragment of the lacZ gene . it can be used as a detection system\"}, {\"id\": \"BBa_E0040\", \"type\": \"Coding\", \"description\": \" green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt%3A P42212\", \"info\": \"BBa_E0040 is a plasmid encoding a green fluorescent protein .\"}, {\"id\": \"BBa_E0044\", \"type\": \"Reporter\", \"description\": \"green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt%3A P42212)\", \"info\": \"green fluorescent protein derived from jellyfish aequeora victoria wild-type GFP (\"}, {\"id\": \"BBa_E1010\", \"type\": \"Coding\", \"description\": \" %2A%2Ahighly%2A%2A engineered mutant of red fluorescent protein from Discosoma striata (coral)\", \"info\": \"BBa_E1010 is a strong reporter that can be detected with a fluorescent plate reader .\"}, {\"id\": \"BBa_G00200\", \"type\": \"Primer\", \"description\": \"Forward primer for sequencing composite parts%3B binds to CFP/YFP (BBa_E0020/22, BBa_E0030/32)\", \"info\": \"forward primer for sequencing composite parts; binds to CFP/YFP . BBa_E00\"}, {\"id\": \"BBa_I12040\", \"type\": \"Regulatory\", \"description\": \"Modified lambda P(RM) promoter%3A -10 region from P(L) and cooperatively repressed by 434 cI\", \"info\": \"two operator sites are used for both activation and repression to enhance cooperativity . the -10 region\"}, {\"id\": \"BBa_I12046\", \"type\": \"Regulatory\", \"description\": \"Activator for BL oscillator with reporter protein, (cooperativity and L-strain -10 region)\", \"info\": \"this part forms the activator part of the Barkai-Leibler oscillator . it has cooper\"}, {\"id\": \"BBa_I12047\", \"type\": \"Regulatory\", \"description\": \"BL oscillator, cooperativity + replaced -10 region (Llac), reporter protein, kickstart\", \"info\": \"this part is a Barkai-Leibler oscillator with cooperativity for the repress\"}, {\"id\": \"BBa_I13035\", \"type\": \"Signalling\", \"description\": \"3OC%3Csub%3E6%3C/sub%3EHSL Receiver Device with Inducible Control of LuxR and a YFP Output device\", \"info\": \"3OC6HSL receiver device with inducible control of LuxR and a yfp output device\"}, {\"id\": \"BBa_I13940\", \"type\": \"Project\", \"description\": \"Exogenous LuxI Relaxation Oscillator Test Construct Intermediate (I0500.C0261.E0434)\", \"info\": \"intermediate construct for Chris' relaxation oscillator test construct . compatibility: 10COMPATIBLE WITH R\"}, {\"id\": \"BBa_I13941\", \"type\": \"Project\", \"description\": \"Exogenous LuxI Relaxation Oscillator Test Construct Intermediate (R0062.C0260.E0424)\", \"info\": \"intermediate construct for chris' relaxation oscillator test constructs . sequence and features assembly compatibility\"}, {\"id\": \"BBa_I13942\", \"type\": \"Project\", \"description\": \"Exogenous AiiA Relaxation Oscillator Test Construct Intermediate (I0500.C0260.E0424)\", \"info\": \"intermediate construct for chris' relaxation oscillator test constructs . compatibility: 10COMPA\"}, {\"id\": \"BBa_I13943\", \"type\": \"Project\", \"description\": \"Exogenous AiiA Relaxation Oscillator Test Construct Intermediate (R0062.B0034.C0061.E0434)\", \"info\": \"relaxation oscillator test construct intermediate (r0062.b0034.c0061.e0434)\"}, {\"id\": \"BBa_I20248\", \"type\": \"Measurement\", \"description\": \"Device used to characterize Ribosome Binding Sites through measurement of GFP expression\", \"info\": \"device is based on I2055 and contains a partial biobrick site (EcoR1, Not1,\"}, {\"id\": \"BBa_I20249\", \"type\": \"Measurement\", \"description\": \"Device used to characterize Ribosome Binding Sites through measurement of GFP expression\", \"info\": \"device is based on I2055 and contains a partial biobrick site (Spe1, Not1, \"}, {\"id\": \"BBa_I20250\", \"type\": \"Measurement\", \"description\": \"Device used to characterize Ribosome Binding Sites through measurement of RFP expression\", \"info\": \"device is based on I2056 and contains a partial biobrick site (EcoR1, Not1,\"}, {\"id\": \"BBa_I20251\", \"type\": \"Measurement\", \"description\": \"Device used to characterize Ribosome Binding Sites through measurement of RFP expression\", \"info\": \"device is based on I2056 and contains a partial biobrick site (Spe1, Not1, \"}, {\"id\": \"BBa_I20257\", \"type\": \"Composite\", \"description\": \"Autoregulated synthesis of T7 RNAP with lacI negative feedback (orthogonal translation)\", \"info\": \"autoregulated synthesis of T7 RNAP with lacI negative feedback loop . basal amount of e\"}, {\"id\": \"BBa_I3000\", \"type\": \"Project\", \"description\": \"E. colibrator design 1, Polkadorks (I3410.I3200.E0422.I3510.I3401.I3411.B0015.I3100.I3400.I3300.I340\", \"info\": \"E. colibrator system is designed to create dynamic polkadots in e. \"}, {\"id\": \"BBa_I3001\", \"type\": \"Project\", \"description\": \"E. colibrator design 2, Polkadorks (I3410.I3200.E0422.I3510.I3401.I3411.B0015.I3100.I3701.I3300.I370\", \"info\": \"E. colibrator system is designed to create dynamic polkadots in e. \"}, {\"id\": \"BBa_I3002\", \"type\": \"Project\", \"description\": \"E. colibrator design 3, Polkadorks (I3410.I3200.E0422.I3510.I3401.I3411.I0460.I3100.I3400.I3300.I340\", \"info\": \"E. colibrator system is designed to create dynamic polkadots in e. \"}, {\"id\": \"BBa_I3420\", \"type\": \"Project\", \"description\": \"Test%3A Switch functionality and bistability (I3410.E0422.I3411.E0432.I3100.I3400.I3101.I3400.I3102.I3\", \"info\": \"switch has three independently controllable trigger inputs and two reporter outputs, ON and OFF . switch has\"}, {\"id\": \"BBa_I3421\", \"type\": \"Project\", \"description\": \"Test%3A Switch response to aspartate input (I3410.E0422.I3411.E0432.I3100.I3400.I3300.I3400.I3102.I340\", \"info\": \"test: ability of switch to respond to aspartate input by connecting the Tar-EnvZ receptor (I3\"}, {\"id\": \"BBa_I3422\", \"type\": \"Project\", \"description\": \"Test%3A Switch response to aspartate input (I3410.E0422.I3411.E0432.I3100.I3400.I3301.I3400.I3102.I340\", \"info\": \"test: ability of switch to respond to aspartate input by connecting the Tar-EnvZ receptor (I330\"}, {\"id\": \"BBa_I3423\", \"type\": \"Project\", \"description\": \"Test%3A Switch response to aspartate input (I3410.E0422.I3411.E0432.I3100.I3400.I3302.I3400.I3102.I340\", \"info\": \"test: ability of switch to respond to aspartate input by connecting the Tar-EnvZ receptor (I330\"}, {\"id\": \"BBa_I3424\", \"type\": \"Project\", \"description\": \"Test%3A Switch response to quorum (I3410.E0422.I3411.E0432.I3100.I3400.I3101.I3400.I3510.I3401)\", \"info\": \"test: switch response to quorum (I3410.E0422.I3411.E0432.I\"}, {\"id\": \"BBa_I3425\", \"type\": \"Project\", \"description\": \"Test%3A Switch aspartate excretion (I3410.I3200.I3411.E0432.I3100.I3400.I3101.I3400.I3102.I3401)\", \"info\": \"switch aspartate excretion (I3410.I3200.I3411.E0432.I3\"}, {\"id\": \"BBa_I3521\", \"type\": \"Project\", \"description\": \"Test%3A Quorum threshold level and chemotaxis response, sender cells (I3600.I3520.I3500)\", \"info\": \"test: cellular density of asparate-secreting cells needed to induce quorum threshold response . send\"}, {\"id\": \"BBa_I3522\", \"type\": \"Project\", \"description\": \"Test%3A Quorum threshold level and chemotaxis response, receiver cells (I3601.I3520.I3500)\", \"info\": \"test: cellular density of asparate-secreting cells needed to induce quorum threshold response . send\"}, {\"id\": \"BBa_I3600\", \"type\": \"Project\", \"description\": \"Test%3A Chemotaxis response to secreted aspartate, sender cells (I3100.I3200.E0422)\", \"info\": \"Tests the chemotaxis cell-cell signalling machinery based on aspartate secretions .\"}, {\"id\": \"BBa_I711022\", \"type\": \"DNA\", \"description\": \"Acetoacetyl-CoA -%3E beta-hydroxybutyryl-CoA (beta-hydroxybutyryl-CoA dehydrogenase)\", \"info\": \"this enzyme is responsible for making beta-hydroxybutyryl-CoA from Acetoacetyl-Co\"}, {\"id\": \"BBa_I711034\", \"type\": \"Generator\", \"description\": \" atoA, atoD generator (acetoacetyl-CoA%3Aacyl-CoA transferase) (butyric acid -%3E butyryl-CoA)\", \"info\": \"this part generates the two enzymes necessary to create butyrl-CoA from acetoacet\"}, {\"id\": \"BBa_I712016\", \"type\": \"Tag\", \"description\": \"myristoilation signal sequence fused to Tobacco Etch Virus (TEV) protease cleavage site\", \"info\": \"myristoilation signal sequence fused to Tobacco Etch Virus (TEV) protease\"}, {\"id\": \"BBa_I712028\", \"type\": \"Coding\", \"description\": \"CherryNLS - synthetic construct monomeric red fluorescent protein with nuclear localization sequence\", \"info\": \"protein is used to show that T7 polymerase is actually going into the nucleolus, where it can\"}, {\"id\": \"BBa_I716183\", \"type\": \"Composite\", \"description\": \"%5BT7%5D%5Brbs%5D%5BhemA from Rcap%5D%5Brbs%5D%5BhemB%5D%5Brbs%5D%5BhemC%5D%5Brbs%5D%5BhemD%5D\", \"info\": \"T7 promoter + library RBS + hemA from rcap + library rbs + \"}, {\"id\": \"BBa_I716184\", \"type\": \"Composite\", \"description\": \"%5BT7%5D%5Brbs%5D%5BhemA %5D%5Brbs%5D%5BhemB%5D%5Brbs%5D%5BhemC%5D%5Brbs%5D%5BhemD%5D%5Bterm%5D\", \"info\": \"T7 promoter + library RBS + hemA from r.capsulatus + library rb\"}, {\"id\": \"BBa_I716377\", \"type\": \"Composite\", \"description\": \"Biobricked Mutant Hemoglobin Cassette in petDUET format with hemABCD with cytochromes\", \"info\": \"beta and alpha subunits of human hemoglobin are mutants with the following mutations: beta providence\"}, {\"id\": \"BBa_I716378\", \"type\": \"Composite\", \"description\": \"Biobricked Unmodified Hemoglobin Cassette in petDUET format with hemABCD with AHSP\", \"info\": \"biobricked unmodified hemoglobin cassette in petDUET format with hemABCD with AH\"}, {\"id\": \"BBa_I716380\", \"type\": \"Composite\", \"description\": \"Biobricked Unmodified Hemoglobin Cassette in petDUET format with hemABCD with antioxidants\", \"info\": \"biobricked unmodified hemoglobin cassette in petDUET format with hemABCD with antioxidants\"}, {\"id\": \"BBa_I716381\", \"type\": \"Composite\", \"description\": \"Biobricked Mutant Hemoglobin Cassette in petDUET format with hemABCD with antioxidants\", \"info\": \"beta and alpha subunits of human hemoglobin are mutants with the following mutations: beta providence\"}, {\"id\": \"BBa_I731014\", \"type\": \"Signalling\", \"description\": \"The luxR based receiver, F2620 (formerly I13270), controls the production of mCherry\", \"info\": \"the luxR based receiver, F2620 (formerly I13270), controls the production of mCh\"}, {\"id\": \"BBa_I735010\", \"type\": \"Regulatory\", \"description\": \"This promoter encoding for a  thiolase involved in beta-oxidation of fatty acids.\", \"info\": \"this promoter encoding for a thiolase involved in beta-oxidation of fatty acids\"}, {\"id\": \"BBa_I739007\", \"type\": \"Generator\", \"description\": \"Double regulated expression cassette for P22 cII +LVA (I739105.B0034.C0053.B0015)\", \"info\": \"P22 cII production can be induced by LuxR/HSL and repressed by c\"}, {\"id\": \"BBa_I741016\", \"type\": \"Generator\", \"description\": \"Reverse Total XylR Transcriptional Regulator Left Facing (I741011 reverse complement\", \"info\": \"this particular part includes the natural promoter, the natural RBS, and the natural terminator without biobrick scar\"}, {\"id\": \"BBa_I741017\", \"type\": \"Regulatory\", \"description\": \"dual facing promoter controlled by xylR and CRP-cAMP (I741015 reverse complement)\", \"info\": \"dual facing promoter controlled by xylr and cRP-cAMP (i741015 reverse\"}, {\"id\": \"BBa_I741107\", \"type\": \"Coding\", \"description\": \"xylA and xylB metabolizing proteins plus region inbetween (with silent mutations)\", \"info\": \"xylA is a subunit of Xylose isomerase . xxlB\"}, {\"id\": \"BBa_I746008\", \"type\": \"Signalling\", \"description\": \"I0500 (Inducible pBad/araC) + I746001 (AIP generator - agrB + agrD with RBSes + Terminator)\", \"info\": \"this part is the AIP generator (I746001) from the agr system . it contains the\"}, {\"id\": \"BBa_I746101\", \"type\": \"Signalling\", \"description\": \"I746100 (AIP sensor infrastructure - agrC + agrA with RBSes) + B0015 (Terminator)\", \"info\": \"original part was made in order to transfer the oligopeptide-based quorum sensing system into \"}, {\"id\": \"BBa_I746103\", \"type\": \"Signalling\", \"description\": \"I746101 (AIP sensor infrastructure - agrC + agrA with RBSes + Terminator) + I746104 (Inducible P2)\", \"info\": \"this part is the AIP sensor infrastructure from the agr system with an AIP-inducible promote\"}, {\"id\": \"BBa_I765002\", \"type\": \"Coding\", \"description\": \"ExbB membrane spanning protein in TonB-ExbB-ExbD complex %5B Escherichia coli K12 %5D\", \"info\": \"this part codifies for a membran localized protein that transduces energy from the proton motive force\"}, {\"id\": \"BBa_I765003\", \"type\": \"Coding\", \"description\": \"TonB ferric siderophore transport system, periplasmic binding protein TonB %5B Pseudomonas entomophila\", \"info\": \"TonB is a transmembranal iron channel that transduces energy between the cytoplasmic and\"}, {\"id\": \"BBa_J01025\", \"type\": \"Intermediate\", \"description\": \"Non mobilizable TraJR, OnRFP, Key1 %3D %5BpRM TraJR%5D%5BDblTerminator%5D%5BOnRFP%5D%5BOnKey1%5D\", \"info\": \"Non mobilizable TraJR, OnRFP, Key1 = [pRM][StrRBS][\"}, {\"id\": \"BBa_J01056\", \"type\": \"Intermediate\", \"description\": \"Non mobilizable TraJF, OnCFP, Key2 %3D %5BpBad/araC TraJF%5D%5BDblTerminator%5D%5BOnCFP%5D%5BOnKey2%5D\", \"info\": \"non mobilizable TraJF, OnCFP, Key2 = [pBad/araC TraJ\"}, {\"id\": \"BBa_J01062\", \"type\": \"Intermediate\", \"description\": \"Mobilized OriTF with Lock1ed cI --%3E pRM --%3E GFP %3D %5BOriTF%5D%5BOnLock1%5D%5BcI%5D%5BDblTerminator%5D%5BpRM GFP%5D\", \"info\": \"Mobilized OriTF with Lock1ed cI--> pRM --> GFP\"}, {\"id\": \"BBa_J01102\", \"type\": \"Intermediate\", \"description\": \"TEST %5BpBad/araC%5D%5BStrRBS%5D%5BTraJF%5D%5BDblTerm%5D%5BpTet%5D%5BStrRBS%5D%5BcI%5D%5BDblTerm%5D\", \"info\": \"TEST [pBad/araC][StrRBS][TraJF][Db\"}, {\"id\": \"BBa_J01105\", \"type\": \"Intermediate\", \"description\": \"TEST %5BOriTF%5D%5BpLam cI -%5D%5Bstr RBS%5D%5BTraJR%5D%5Bstr RBS%5D%5BGFP%5D%5BDbl Term%5D\", \"info\": \"TEST [pLam cI -][str RBS][TraJR]\"}, {\"id\": \"BBa_J04700\", \"type\": \"Regulatory\", \"description\": \" Part containing promoter, riboswitch mTCT8-4 theophylline aptamer (J04705), and RBS\", \"info\": \"riboswitch J04705 is designed to make or break a \\\"kink\\\" in the\"}, {\"id\": \"BBa_J04800\", \"type\": \"Regulatory\", \"description\": \"J04800 (RevAptRibo) contains a theophylline aptamer upstream of the RBS that should act as a riboswi\", \"info\": \"J04800 (RevAptRibo) contains a theophylline apt\"}, {\"id\": \"BBa_J04900\", \"type\": \"Regulatory\", \"description\": \"Part containing promoter, 8 bp, RBS, and riboswitch mTCT8-4 theophylline aptamer (J04705)\", \"info\": \"riboswitch J04705 is designed to make or break a \\\"kink\\\" in the\"}, {\"id\": \"BBa_J06551\", \"type\": \"Intermediate\", \"description\": \"Construction intermediate%3A lambda cI with RBS and hybrid LacI promoter (R0011.B0034.C0051)\", \"info\": \"construction intermediate: lambda cI with RBS and hybrid lacI promoter (R0011.B00\"}, {\"id\": \"BBa_J06571\", \"type\": \"Intermediate\", \"description\": \"Construction intermediate%3A 434 cI with RBS and lambda cI promoter (R0051.J06570)\", \"info\": \"construction intermediate: 434 cI with rbs and lambda ci promoter (R\"}, {\"id\": \"BBa_J06574\", \"type\": \"Intermediate\", \"description\": \"Construction intermediate%3A cI857 (Lamda II) with RBS and forward terminator (B0034.J06503.B0014)\", \"info\": \"construction intermediate: cI857 (lamda II) with rbs and forward terminator\"}, {\"id\": \"BBa_J06610\", \"type\": \"Intermediate\", \"description\": \"Construction intermediate%3A LacI QPI with Lambda cI regulated promoter (R0051.Q04121)\", \"info\": \"BBa_R0051 promoter (lambda cI regulated) with BB\"}, {\"id\": \"BBa_J06611\", \"type\": \"Intermediate\", \"description\": \"Construction intermediate%3A LacI ts (mut 241) QPI with Lambda cI regulated promoter (R0051.J06800)\", \"info\": \"BBa_R0051 promoter (lambda cI regulated) with BB\"}, {\"id\": \"BBa_J06612\", \"type\": \"Intermediate\", \"description\": \"Construction intermediate%3A LacI ts (mut 265) QPI with Lambda cI regulated promoter (R0051.J06801)\", \"info\": \"LacI ts (mut 265) QPI with Lambda cI regulated promoter .\"}, {\"id\": \"BBa_J06628\", \"type\": \"Intermediate\", \"description\": \"Construction intermediate%3A Lambda cI QPI with mCherry, bact (LVA+) (Q04510.J06703)\", \"info\": \"BBa_Q04510 QPI with mCherry, bact (LVA+)\"}, {\"id\": \"BBa_J06629\", \"type\": \"Intermediate\", \"description\": \"Construction intermediate%3A 434 cI QPI with mCherry, bact (LVA+) (Q04520.J06703)\", \"info\": \"construction intermediate: 434 cI QPI with mCherry, bact (LVA+\"}, {\"id\": \"BBa_J120014\", \"type\": \"Composite\", \"description\": \"Binding sites for Pax3 and Sox10 with GFP selectable marker and double terminator\", \"info\": \"Binding sites for pax3 and sox10 with GFP selectable marker and double terminator .\"}, {\"id\": \"BBa_J120024\", \"type\": \"Protein_Domain\", \"description\": \"Anti-ADAM 17 antibody variable region of heavy chain (Unknown nucleotide sequence)\", \"info\": \"anti-ADAM 17 antibody variable region of heavy chain (unknown nucleotide sequence) when sequence is\"}, {\"id\": \"BBa_J120025\", \"type\": \"Coding\", \"description\": \"TACE(Tumor necrosis factor-%26%23945%3B-converting enzyme) aka ADAM17 endopepsidase (H. sapiens)\", \"info\": \"ADAM17, also known as tumor necrosis factor alpha; converting enzyme (TACE) is activate\"}, {\"id\": \"BBa_J120029\", \"type\": \"Composite\", \"description\": \"Composite part consisting of yeast promoter, CH1 domain of human antibody and GFP.\", \"info\": \"composite part consisting of yeast promoter, CH1 domain of human antibody and GFP . this part is built\"}, {\"id\": \"BBa_J120030\", \"type\": \"Composite\", \"description\": \"Composite part with Yeast promoter,CH1 domain of human Ab, ADAM17 cleavage sequence %26 Phoratoxin.\", \"info\": \"composite part with Yeast promoter,CH1 domain of human Ab, ADAM17 cleavage sequence\"}, {\"id\": \"BBa_J120031\", \"type\": \"Protein_Domain\", \"description\": \"Anti-ADAM 17 antibody variable region of light chain (Unknown nucleotide sequence)\", \"info\": \"it is a variable region of light chain of ADAM 17 antibody (M01) whose sequence is unknown \"}, {\"id\": \"BBa_J23040\", \"type\": \"Signalling\", \"description\": \"%5BTetR%5D%5Brbs%5D%5BLuxR%5D%5BdblTerm%5D%5BLuxPR%5D+%5Brbs%5D%5BLacI%5D%5BdblTerm%5D  %22AHL-dependent inverter%22\", \"info\": \"F2620+P0412 sequence and features assembly Compatibility: 10COMPATIBLE WITH RFC[\"}, {\"id\": \"BBa_J23120\", \"type\": \"Signalling\", \"description\": \"Locked RFP (J23077) with OriT (J01003). Lock that can be transferred via conjugation\", \"info\": \"lock that can be transferred via conjugation . should conjugate into a donor cell and cause fluorescence \"}, {\"id\": \"BBa_J24717\", \"type\": \"Composite\", \"description\": \"37. pLacI%3DM RBS%3DAraC%3DW RBS%3DTetR%3DStrong RBS%3DmCherry(+LVA)%3Dterminator\", \"info\": \"37. pLacI=M RBS=AraC=W rbs=t\"}, {\"id\": \"BBa_J24718\", \"type\": \"Composite\", \"description\": \"38. pLacI%3DM RBS%3DAraC%3DM RBS%3DTetR%3DStrong RBS%3DmCherry(+LVA)%3Dterminator\", \"info\": \"38. pLacI=M RBS=AraC=M rbs=t\"}, {\"id\": \"BBa_J24719\", \"type\": \"Composite\", \"description\": \"39. pLacI%3DM RBS%3DAraC%3DS RBS%3DTetR%3DStrong RBS%3DmCherry(+LVA)%3Dterminator\", \"info\": \"39. pLacI=M RBS=AraC=S rbs=t\"}, {\"id\": \"BBa_J24823\", \"type\": \"Reporter\", \"description\": \"same as J24819 but with ACCACC Euk RBS removed and problem solved via J24822 removed\", \"info\": \"same as J24819 but with ACCACC Euk RBS removed and problem solved via J24822\"}, {\"id\": \"BBa_J31016\", \"type\": \"Reporter\", \"description\": \"part produces the RNA construct crRNA-RBS-GFPLVA-tt that can only be translated in the presence of t\", \"info\": \"part produces the RNA construct crRNA-RBS-GFPLVA-tt . the crRNA blocks\"}, {\"id\": \"BBa_J36849\", \"type\": \"Generator\", \"description\": \"Lac-inducible generator of Lpp-OmpA(46-66)-Streptavidin single-chain dimeric + His6 tag\", \"info\": \"this device contains a lac promoter and strong ribosome binding site for lac-inducible expression of\"}, {\"id\": \"BBa_J36851\", \"type\": \"Generator\", \"description\": \"Lac-inducible generator of Lpp-OmpA(46-159)-Streptavidin single-chain dimeric + His6 tag\", \"info\": \"this device contains a lac promoter and strong ribosome binding site for lac-inducible expression of\"}, {\"id\": \"BBa_J37017\", \"type\": \"Project\", \"description\": \"AiiA Expression Assay (can be used in conjunction with AHL assay to detect activity)\", \"info\": \"AiiA Expression Assay by coupling to GFP . can be used in conjunction with AHL as\"}, {\"id\": \"BBa_J45001\", \"type\": \"Coding\", \"description\": \" SAM%3Asalicylic acid carboxyl methyltransferase%3B converts salicylic acid to methyl salicylate (winter\", \"info\": \"BBa_J45001 encodes SAM salicylic acid carboxyl methyltransferas\"}, {\"id\": \"BBa_J45002\", \"type\": \"Coding\", \"description\": \"SAM%3Abenzoic acid carboxyl methyltransferase%3B converts benzoic acid to methyl benzoate (floral odor)\", \"info\": \"BBa_J45002 encodes SAM benzoic acid carboxyl methyltransferas\"}, {\"id\": \"BBa_J45003\", \"type\": \"Coding\", \"description\": \"SAM%3Ajasmonic acid carboxyl methyltransferase%3B converts jasmonic acid to jasmine odor\", \"info\": \"BBa_J45003 encodes jasmonic acid carboxyl methyltransferase\"}, {\"id\": \"BBa_J45004\", \"type\": \"Coding\", \"description\": \"SAM%3Abenzoic acid/salicylic acid carboxyl methyltransferase I%3B converts salicylic acid to methyl sali\", \"info\": \"BBa_J45004 encodes benzoic acid/salicylic acid carboxyl methyl\"}, {\"id\": \"BBa_J45005\", \"type\": \"Coding\", \"description\": \"SAM%3Asalicylic acid carboxyl methyltransferase%3B converts salicylic acid to methyl salicylate (winterg\", \"info\": \"BBa_J45005 encodes salicylic acid carboxyl methyltransferase \"}, {\"id\": \"BBa_J45007\", \"type\": \"Coding\", \"description\": \"SAM%3Abenzoic acid/salicylic acid carboxyl methyltransferase II%3B converts salicylic acid to methyl sal\", \"info\": \"BBa_J45007 encodes benzoic acid/salicylic acid carboxyl methyl\"}, {\"id\": \"BBa_J45008\", \"type\": \"Coding\", \"description\": \"branched-chain amino acid transaminase (BAT2)%3B converts leucine to alpha-ketoisocaproate\", \"info\": \"BBa_J45008 encodes a branched-chain amino acid transaminase\"}, {\"id\": \"BBa_J45009\", \"type\": \"Coding\", \"description\": \"ketoisocaproate decarboxylase (THI3)%3B converts alpha-ketoisocaproate to 3-methylbutanal\", \"info\": \"BBa_J45009 encodes a branched-chain amino acid transaminase\"}, {\"id\": \"BBa_J45011\", \"type\": \"Coding\", \"description\": \"PAL (Phenylalanine Ammonia-lyase) catalyzes the conversion of phenylalanine to cinnamic acid\", \"info\": \"PAL catalyzes the conversion of phenylalanine to cinnamic acid\"}, {\"id\": \"BBa_J45013\", \"type\": \"Coding\", \"description\": \" %09PAL (Phenylalanine Ammonia-lyase) catalyzes the conversion of phenylalanine to cinnamic acid\", \"info\": \"PAL catalyzes the conversion of phenylalanine to cinnamic acid\"}, {\"id\": \"BBa_J45014\", \"type\": \"Coding\", \"description\": \"alcohol acetyltransferase I%3B converts isoamyl alcohol to isoamyl acetate (banana odor)\", \"info\": \"BBa_K4278717 encodes alcohol acetyltransferase I \"}, {\"id\": \"BBa_J45017\", \"type\": \"Coding\", \"description\": \"isochorismate pyruvate-lyase and isochorismate synthase (pchBA)%3B converts chorismate to salicylate\", \"info\": \"BBa_J45017 encodes isochorismate pyruvate-lyase\"}, {\"id\": \"BBa_J48104\", \"type\": \"Regulatory\", \"description\": \"NikR promoter, a protein of the ribbon helix-helix family of trancription factors that repress expre\", \"info\": \"NikR promoter is a protein of the ribbon helix-helix family of trancripti\"}, {\"id\": \"BBa_J52008\", \"type\": \"Reporter\", \"description\": \" luciferase%3A luciferin 2-monooxygenase from Renilla reniformis (EC 1.13.12.5%3B SwissProt%3A%3A P27652)\", \"info\": \"luciferin 2-monooxygenase from renilla reniformis is \"}, {\"id\": \"BBa_J52028\", \"type\": \"Reporter\", \"description\": \"green fluorescent protein derived from A. victoria GFP (SwissProt%3A P42212) with PEST191 tag\", \"info\": \"GFP-linker-PEST191 is a part composed of GFP (as a reporter\"}, {\"id\": \"BBa_J58011\", \"type\": \"Regulatory\", \"description\": \"Promoter which is activated by cI and CRP, using a transcription logic function type AND\", \"info\": \"bacteriophage lambda cI protein, and the e. coli cyclic \"}, {\"id\": \"BBa_J64713\", \"type\": \"Project\", \"description\": \"LasR/LasI Inducible (RHLR/RHLI repressible) positive feedback production of 3OC12 HSL\", \"info\": \"LasR/LasI Inducible (RHLR/RHLI repressible) positive feedback\"}, {\"id\": \"BBa_J64714\", \"type\": \"Project\", \"description\": \"RHLR/RHLI Inducible (LasR/LasI repressible) positive feedback production of C4 HSL\", \"info\": \"RHLR/RHLI inducible positive feedback production of C4 HSL This construct will produce more C\"}, {\"id\": \"BBa_J64804\", \"type\": \"Regulatory\", \"description\": \"The promoter region (inclusive of regulator binding sites) of the B. subtilis RocDEF operon\", \"info\": \"base 1 to base 21 contains the binding site for the binding factor, RocR . base 42 to base \"}, {\"id\": \"BBa_J70032\", \"type\": \"DNA\", \"description\": \"A Composite BioScaffold Part (PpiI and PsrI) for Protein Fusions (see Design Page)\", \"info\": \"Composite BioScaffold part (PpiI and PsrI) for protein fusions \"}, {\"id\": \"BBa_J70034\", \"type\": \"DNA\", \"description\": \"A BioScaffold Part (Uses AarI) for Library Vector Preparation (see Part Design page) \", \"info\": \"when placed in a BioBrick assembly and cut with the restriction enzyme AarI, this part will direct the\"}, {\"id\": \"BBa_J70036\", \"type\": \"DNA\", \"description\": \"A BioScaffold Part (Uses AarI) for Library Insert Preparation (see Part Design page)\", \"info\": \"a BioScaffold part (Uses AarI) for library insert preparation . when placed in\"}, {\"id\": \"BBa_J70040\", \"type\": \"DNA\", \"description\": \"A BioScaffold Part (Uses AarI, MabI) for Library Vector Preparation (see Part Design page)\", \"info\": \"a BioScaffold part (uses AarI, MabI) for library vector preparation \"}, {\"id\": \"BBa_J70604\", \"type\": \"Measurement\", \"description\": \" J70589 cut with BsaXI and with rbs, 6his inserts (J70559-f1i,f2i,r2i,r2i) added \", \"info\": \"J70589 cut with BsaXI and with rbs, 6his inserts (j\"}, {\"id\": \"BBa_J70635\", \"type\": \"Other\", \"description\": \"Downstream genomic DNA fragment of Mesoplasma florum for recombination experiment\", \"info\": \"downstream genomic DNA fragment of mesoplasma florum for recombination experiment . 700 \"}, {\"id\": \"BBa_J72096\", \"type\": \"Composite\", \"description\": \"%7BaraC-Pbad%7D%7Brbs.coi%7D%7Bdouble terminator%7D%7BrepL no start%7D%7BLPsit%7D%7Brbs.pacA%7D%7BTrnpB%7D\", \"info\": \"this part is in BBb Format . it is flanked by BglII and Bam\"}, {\"id\": \"BBa_J72099\", \"type\": \"Composite\", \"description\": \"%7BaraC-Pbad%7D%7Brbs.coi%7D%7Bdouble terminator%7D%7BLPsit%7D%7Brbs.pacA%7D%7Brbs.repL%7D\", \"info\": \"this part is in BBb Format . it is flanked by BglII and Bam\"}, {\"id\": \"BBa_J72101\", \"type\": \"Composite\", \"description\": \"%7BaraC-Pbad%7D%7Brbs.coi%7D%7Bdouble terminator%7D%7BLPsit%7D%7Brbs.pacA%7D%7BTrnpB%7D\", \"info\": \"araC-Pbadrbs.coidouble terminatorLPsitr\"}, {\"id\": \"BBa_J72102\", \"type\": \"Composite\", \"description\": \"%7BaraC-Pbad%7D%7Brbs.coi%7D%7Bdouble terminator%7D%7Bcin, no start, frameshift%7D\", \"info\": \"araC-Pbadrbs.coidouble terminatorcin, no start\"}, {\"id\": \"BBa_J72103\", \"type\": \"Composite\", \"description\": \"%7BaraC-Pbad%7D%7Brbs.coi%7D%7Bdouble terminator%7D%7Bcin, no start, frameshift%7D%7BrepL no start%7D%7BLPsit%7D%7Brbs.pacA%7D%7BT\", \"info\": \"this part is in BBb Format . it is flanked by BglII and Bam\"}, {\"id\": \"BBa_J72104\", \"type\": \"Composite\", \"description\": \"%7BrhaRS_PrhaB%7D%7BluxCDABE%7D%7BvioABCDE%7D%7Bdouble terminator%7D%7BPcon-C5%7D%7Brbs.lacZ%7D\", \"info\": \"this part is in BBb Format . it is flanked by BglII and Bam\"}, {\"id\": \"BBa_J72106\", \"type\": \"Composite\", \"description\": \"%7BaraC-Pbad%7D%7Brbs.coi%7D%7Bdouble terminator%7D%7BPtet%7D%7Brbs.mRFP-3%2A%7D%7Bdouble terminator%7D\", \"info\": \"this part is in BBb Format . it is flanked by BglII and Bam\"}, {\"id\": \"BBa_J72115\", \"type\": \"Composite\", \"description\": \"%7BaraC-Pbad%7D%7Brbs.coi%7D%7Bdouble terminator%7D%7Bcin, no start, frameshift%7D%7BrepL no start%7D\", \"info\": \"this part is in BBb Format . it is flanked by BglII and Bam\"}, {\"id\": \"BBa_J72116\", \"type\": \"Composite\", \"description\": \"%7BaraC-Pbad%7D%7Brbs.coi%7D%7Bdouble terminator%7D%7Bcin, no start, frameshift%7D%7BLPsit%7D%7Brbs.pacA%7D%7BTrnpB%7D\", \"info\": \"this part is in BBb Format . it is flanked by BglII and Bam\"}, {\"id\": \"BBa_K078004\", \"type\": \"Coding\", \"description\": \"2%26%2365292%3B2%91%26%2365292%3B3-Trihydroxybiphenyl 1,2-dioxygenase. The second step enzyme in dixon degradation\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_K078005\", \"type\": \"Coding\", \"description\": \"2%26%2365292%3B2%91%26%2365292%3B3-Trihydroxybiphenyl 1,2-dioxygenase. The second step enzyme in dixon degradation\", \"info\": \"2,2\\u2018,3-trihydroxybiphenyl 1,2-dioxygenase is one\"}, {\"id\": \"BBa_K078007\", \"type\": \"Coding\", \"description\": \"2,3-dihydroxy-2,3-dihydrophenylpropionate dehydrogenase, the second step enzyme in PCBs degradation \", \"info\": \"this is the second step enzyme of the PCBs deagradation pathway . it is coded by \"}, {\"id\": \"BBa_K079020\", \"type\": \"Generator\", \"description\": \"GFP reporter under the control of J23118 promoter and Lac 2 operator auto-regulated by LacI protein \", \"info\": \"GFP reporter under the control of J23118 promoter and lac 2 operator auto-regulated by lacI protein \"}, {\"id\": \"BBa_K079021\", \"type\": \"Generator\", \"description\": \"LacI repressor and GFP reporter proteins under the control of the J23118 costitutive promoter and La\", \"info\": \"lacI repressor and GFP reporter proteins under the control of the J23118 costitutive promote\"}, {\"id\": \"BBa_K079024\", \"type\": \"Intermediate\", \"description\": \"LacI repressor under the control of the J23118 costitutive promoter and Lac 1 operator\", \"info\": \"lacI repressor under the control of the J23118 costitutive promoter and lac 1 operator\"}, {\"id\": \"BBa_K079026\", \"type\": \"Measurement\", \"description\": \"GFP reporter protein and LacI gene sequence under the  control of J23118 constitutive promoter\", \"info\": \"GFP reporter protein was put under the control of the BBa_J23118 costitutive promoter\"}, {\"id\": \"BBa_K079049\", \"type\": \"Reporter\", \"description\": \"GFP reporter protein under the control of the J23118 constitutive promoter and LexA 2 operator\", \"info\": \"GFP reporter protein under the control of the J23118 constitutive promoter and LexA 2 operator This part is\"}, {\"id\": \"BBa_K079050\", \"type\": \"Reporter\", \"description\": \"GFP reporter protein under the control of the J23100 constitutive promoter and LexA 2 operator\", \"info\": \"Northwestern 2019 iGEM team provided novel characterization data to part BBa_K079050 .\"}, {\"id\": \"BBa_K079051\", \"type\": \"Generator\", \"description\": \"LacI repressor and GFP reporter proteins controlled by the J23118 promoter and Lac 1 operator \", \"info\": \"lacI repressor and GFP reporter proteins controlled by the J23118 promoter and lac 1 operator \"}, {\"id\": \"BBa_K079052\", \"type\": \"Generator\", \"description\": \"LacI repressor and GFP reporter proteins controlled by the J23118 promoter and Lac symmetric operato\", \"info\": \"lacI repressor and GFP reporter proteins controlled by the J23118 promoter and lac symmetric opera\"}, {\"id\": \"BBa_K086001\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B24 followed by YFP reporter\", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 24 followed by \"}, {\"id\": \"BBa_K086002\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B24 followed by YFP\", \"info\": \"modified Lutz-Bujard lacO promoter, with alternative sigma factor 24 followed by \"}, {\"id\": \"BBa_K086003\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B24 followed by YFP reporter\", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 24 followed by \"}, {\"id\": \"BBa_K086004\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B24  followed by YFP promoter\", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 24 followed by \"}, {\"id\": \"BBa_K086005\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B28  followed by YFP\", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 28 followed by \"}, {\"id\": \"BBa_K086006\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B28  followed by YFP\", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 28 followed by \"}, {\"id\": \"BBa_K086007\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B28  followed by YFP reporter\", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 28 followed by \"}, {\"id\": \"BBa_K086008\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B28  followed by YFP\", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 28 followed by \"}, {\"id\": \"BBa_K086009\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B32 followed by YFP  \", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 32 followed by \"}, {\"id\": \"BBa_K086010\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B32  followed by YFP reporter\", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 32 followed by \"}, {\"id\": \"BBa_K086011\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B32  followed by YFP reporter\", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 32 followed by \"}, {\"id\": \"BBa_K086012\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B32  followed by YFP reporter\", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 32 followed by \"}, {\"id\": \"BBa_K086013\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B38  followed by YFP reporter\", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 38 followed by \"}, {\"id\": \"BBa_K086014\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B38  followed by YFP reporter\", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 38 followed by \"}, {\"id\": \"BBa_K086015\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B38  followed by YFP reporter\", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 38 followed by \"}, {\"id\": \"BBa_K086016\", \"type\": \"Composite\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B38  followed by YFP reporter\", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 38 followed by \"}, {\"id\": \"BBa_K086020\", \"type\": \"Regulatory\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B24 \", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 24 .\"}, {\"id\": \"BBa_K086021\", \"type\": \"Regulatory\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B24 \", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 24 .\"}, {\"id\": \"BBa_K086022\", \"type\": \"Regulatory\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B28 \", \"info\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor 28 .\"}, {\"id\": \"BBa_K086023\", \"type\": \"Regulatory\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B28 \", \"info\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor 28 .\"}, {\"id\": \"BBa_K086024\", \"type\": \"Regulatory\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B28 \", \"info\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor 28 .\"}, {\"id\": \"BBa_K086025\", \"type\": \"Regulatory\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B28 \", \"info\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor 28 .\"}, {\"id\": \"BBa_K086026\", \"type\": \"Regulatory\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B32 \", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 32 .\"}, {\"id\": \"BBa_K086027\", \"type\": \"Regulatory\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B32 \", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 32 .\"}, {\"id\": \"BBa_K086028\", \"type\": \"Regulatory\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B32 \", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 32 .\"}, {\"id\": \"BBa_K086029\", \"type\": \"Regulatory\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B32 \", \"info\": \"modified Lutz-Bujard lacO promoter,with alternative sigma factor 32 .\"}, {\"id\": \"BBa_K086030\", \"type\": \"Regulatory\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B38 \", \"info\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor 38 .\"}, {\"id\": \"BBa_K086031\", \"type\": \"Regulatory\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B38 \", \"info\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor 38 .\"}, {\"id\": \"BBa_K086032\", \"type\": \"Regulatory\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B38 \", \"info\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor 38 .\"}, {\"id\": \"BBa_K086033\", \"type\": \"Regulatory\", \"description\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor  %26%23963%3B38 \", \"info\": \"modified Lutz-Bujard LacO promoter,with alternative sigma factor 38 .\"}, {\"id\": \"BBa_K092700\", \"type\": \"Composite\", \"description\": \"TetR cds with RBS and Terminator + pTetR, RFP with RBS + LuxI with RBS and terminator\", \"info\": \"TetR cds with ribosome binding site and terminator + pTetR\"}, {\"id\": \"BBa_K092800\", \"type\": \"Translational_Unit\", \"description\": \"Coding sequence for LacI modified with a different rate of translation than LacI, RBS\", \"info\": \"coding sequence for lacI modified with a different rate of translation than lacI, RBS Sequence and Features\"}, {\"id\": \"BBa_K092900\", \"type\": \"Composite\", \"description\": \"RhlR controlled by a constitutive promoter, and LacI modified with a Rhl R promoter\", \"info\": \"RhlR controlled by a constitutive promoter, and lacI modified with a Rhl R promoter\"}, {\"id\": \"BBa_K103006\", \"type\": \"Tag\", \"description\": \"OmpA outer membrane protein A fused to linker%3B displays proteins on cell surface\", \"info\": \"NEFU-China team modified signal peptide sequence to make it more conducive to direct our FABP to\"}, {\"id\": \"BBa_K1051350\", \"type\": \"Device\", \"description\": \"K1051300 (cln2 promoter) + K1051000 (non stop codon RFP) + K1051008 (Stop codon + CAA terminator)\", \"info\": \"K1051300 (cln2 promoter) + K1051000 (non stop codon RFP\"}, {\"id\": \"BBa_K1051351\", \"type\": \"Device\", \"description\": \"K1051301 (clb2 promoter) + K1051000 (non stop codon RFP) + K1051008 (Stop codon + CAA terminator)\", \"info\": \"K1051301 (clb2 promoter) + K1051000 (non stop codon RFP\"}, {\"id\": \"BBa_K1051352\", \"type\": \"Device\", \"description\": \"K1051302 (clb5 promoter) + K1051000 (non stop codon RFP) + K1051008 (Stop codon + CAA terminator)\", \"info\": \"K1051302 (clb5 promoter) + K1051000 (non stop codon RFP\"}, {\"id\": \"BBa_K1051353\", \"type\": \"Device\", \"description\": \"K1051303 (clb6 promoter) + K1051000 (non stop codon RFP) + K1051008 (Stop codon + CAA terminator)\", \"info\": \"K1051303 (clb6 promoter) + K1051000 (non stop codon RFP\"}, {\"id\": \"BBa_K1051354\", \"type\": \"Device\", \"description\": \"K1051304 (cln3 promoter) + K1051000 (non stop codon RFP) + K1051008 (Stop codon + CAA terminator)\", \"info\": \"K1051304 (cln3 promoter) + K1051000 (non stop codon RFP\"}, {\"id\": \"BBa_K1051355\", \"type\": \"Device\", \"description\": \"K1051300 (cln2 promoter) + K1051053(K1051001 (non stop codon ECFP + K1051006 (Stop codon + TBY-1 ter\", \"info\": \"K1051300 (cln2 promoter) + K1051053(k1051001 (n\"}, {\"id\": \"BBa_K1051356\", \"type\": \"Device\", \"description\": \"K1051301(clb2 promoter) + K1051053(K1051001 (non stop codon ECFP + K1051006 (Stop codon + TBY-1 term\", \"info\": \"K1051301(clb2 promoter) + K1051053(non stop codon \"}, {\"id\": \"BBa_K1051357\", \"type\": \"Device\", \"description\": \"K1051302 (clb5 promoter) + K1051053(K1051001 (non stop codon ECFP + K1051006 (Stop codon + TBY-1 ter\", \"info\": \"K1051302 (clb5 promoter) + K1051053 (non stop codon \"}, {\"id\": \"BBa_K1051358\", \"type\": \"Device\", \"description\": \"K1051303(clb6 promoter) + K1051053(K1051001 (non stop codon ECFP + K1051006 (Stop codon + TBY-1 term\", \"info\": \"K1051303(clb6 promoter) + K1051053(non stop codon \"}, {\"id\": \"BBa_K1051359\", \"type\": \"Device\", \"description\": \"K1051304(cln3 promoter) + K1051053(K1051001 (non stop codon ECFP + K1051006 (Stop codon + TBY-1 term\", \"info\": \"K1051304(cln3 promoter) + K1051053(k1051001 (n\"}, {\"id\": \"BBa_K1051360\", \"type\": \"Device\", \"description\": \"K1051300(cln2 promoter) + K1051002 (non stop codon EYFP) + K1051008 (Stop codon + CAA terminator)\", \"info\": \"K1051300(cln2 promoter) + K1051002 (non stop codon E\"}, {\"id\": \"BBa_K1051361\", \"type\": \"Device\", \"description\": \"K1051301(clb2 promoter) + K1051002 (non stop codon EYFP) + K1051008 (Stop codon + CAA terminator)\", \"info\": \"K1051301(clb2 promoter) + K1051002 (non stop codon E\"}, {\"id\": \"BBa_K1051362\", \"type\": \"Device\", \"description\": \"K1051302(clb5 promoter) + K1051002 (non stop codon EYFP) + K1051008 (Stop codon + CAA terminator)\", \"info\": \"K1051302(clb5 promoter) + K1051002 (non stop codon E\"}, {\"id\": \"BBa_K1051363\", \"type\": \"Device\", \"description\": \"K1051303 (clb6 promoter) + K1051002 (non stop codon EYFP) + K1051008 (Stop codon + CAA terminator)\", \"info\": \"K1051303 (clb6 promoter) + K1051002 (non stop codon E\"}, {\"id\": \"BBa_K1051364\", \"type\": \"Device\", \"description\": \"K1051304 (cln3 promoter) + K1051002 (non stop codon EYFP) + K1051008 (Stop codon + CAA terminator)\", \"info\": \"K1051304 (cln3 promoter) + K1051002 (non stop codon E\"}, {\"id\": \"BBa_K1051365\", \"type\": \"Device\", \"description\": \"K1051300 (cln2 promoter) + K1051003 (non stop codon GFP) + K1051008 (Stop codon + CAA terminator)\", \"info\": \"K1051300 (cln2 promoter) + K1051003 (non stop codon G\"}, {\"id\": \"BBa_K1051366\", \"type\": \"Device\", \"description\": \"K1051301 (clb2 promoter) + K1051003 (non stop codon GFP) + K1051008 (Stop codon + CAA terminator)\", \"info\": \"K1051301 (clb2 promoter) + K1051003 (non stop codon G\"}, {\"id\": \"BBa_K1051367\", \"type\": \"Device\", \"description\": \"K1051302 (clb5 promoter) + K1051003 (non stop codon GFP) + K1051008 (Stop codon + CAA terminator)\", \"info\": \"K1051302 (clb5 promoter) + K1051003 (non stop codon G\"}, {\"id\": \"BBa_K1051368\", \"type\": \"Device\", \"description\": \"K1051303 (clb6 promoter) + K1051003 (non stop codon GFP) + K1051008 (Stop codon + CAA terminator)\", \"info\": \"K1051303 (clb6 promoter) + K1051003 (non stop codon G\"}, {\"id\": \"BBa_K1051369\", \"type\": \"Device\", \"description\": \"K1051304 (cln3 promoter) + K1051003 (non stop codon GFP) + K1051008 (Stop codon + CAA terminator)\", \"info\": \"K1051304 (cln3 promoter) + K1051003 (non stop codon G\"}, {\"id\": \"BBa_K1051370\", \"type\": \"Device\", \"description\": \"K1051300 (cln2 promoter) + K1051004 (non stop codon mOrange) + K1051008 (Stop codon + CAA terminator\", \"info\": \"K1051300 (cln2 promoter) + K1051004 (non stop codon \"}, {\"id\": \"BBa_K1051371\", \"type\": \"Device\", \"description\": \"K1051301 (clb2 promoter) + K1051004 (non stop codon mOrange) + K1051008 (Stop codon + CAA terminator\", \"info\": \"K1051301 (clb2 promoter) + K1051004 (non stop codon \"}, {\"id\": \"BBa_K1051372\", \"type\": \"Device\", \"description\": \"K1051302 (clb5 promoter) + K1051004 (non stop codon mOrange) + K1051008 (Stop codon + CAA terminator\", \"info\": \"K1051302 (clb5 promoter) + K1051004 (non stop codon \"}, {\"id\": \"BBa_K1051373\", \"type\": \"Device\", \"description\": \"K1051303 (clb6 promoter) + K1051004 (non stop codon mOrange) + K1051008 (Stop codon + CAA terminator\", \"info\": \"K1051303 (clb6 promoter) + K1051004 (non stop codon \"}, {\"id\": \"BBa_K1051374\", \"type\": \"Device\", \"description\": \"K1051304 (cln3 promoter) + K1051004 (non stop codon mOrange) + K1051008 (Stop codon + CAA terminator\", \"info\": \"K1051304 (cln3 promoter) + K1051004 (non stop codon \"}, {\"id\": \"BBa_K1088000\", \"type\": \"Coding\", \"description\": \"1-deoxyxylulose-5-phosphate synthase (Dxs) enzyme from MEP pathway isolated from B. subtilis 168\", \"info\": \"1-deoxyxylulose-5-phosphate synthase (Dxs) enzyme from M\"}, {\"id\": \"BBa_K1088002\", \"type\": \"Reporter\", \"description\": \"Reporter system to quantify protein expression of B. sub 1-deoxyxylulose-5-phosphate synthase (Dxs)\", \"info\": \"april 1 marks the first day of a three-day holiday in switzerland .\"}, {\"id\": \"BBa_K112203\", \"type\": \"Protein_Domain\", \"description\": \"%7B%3C xis %3E%7D The bacteriophage lambda xis gene without start or stop codons%3B assembly standard 21\", \"info\": \" xis gene without start or stop codons; assembly standard 21 This part is in BBb\"}, {\"id\": \"BBa_K112204\", \"type\": \"Coding\", \"description\": \"%7Ba%7Exis%21%7D The bacteriophage lambda xis gene ready to have rbs attached and stop codon%3B assembly stand\", \"info\": \"xis is flanked by BamHI and BglII sites instead of Xba\"}, {\"id\": \"BBa_K112205\", \"type\": \"Translational_Unit\", \"description\": \"%7Brbs.xis%21%7D The xis gene with native rbs site and stop codon%3B assembly standard 21\", \"info\": \"xis gene with native rbs site and stop codon; assembly standard 21 This part is in \"}, {\"id\": \"BBa_K112211\", \"type\": \"Coding\", \"description\": \"%7Ba%7Eint%21%7D The integrase gene with rbs ready to be attached with stop codon, BBb format\", \"info\": \"it is flanked by BamHI and BglII sites instead of XbaI and\"}, {\"id\": \"BBa_K112212\", \"type\": \"Translational_Unit\", \"description\": \"%7Brbs.int%21%7D The integrase gene with native rbs site and stop codon, BBb format\", \"info\": \"integrase gene with native rbs site and stop codon, BBb format .\"}, {\"id\": \"BBa_K112217\", \"type\": \"Coding\", \"description\": \"%7Ba%7EihfA%21%7D The ihf alpha gene ready to have rbs attached with stop codon, BBb format\", \"info\": \"ihf alpha gene ready to have rbs attached with stop codon, BBb format\"}, {\"id\": \"BBa_K112223\", \"type\": \"Coding\", \"description\": \"%7Ba%7EihfB%21%7D The ihf beta gene ready to have rbs attached and stop codon, BBb format\", \"info\": \"ihf beta gene ready to have rbs attached and stop codon, BBb format \"}, {\"id\": \"BBa_K112234\", \"type\": \"Translational_Unit\", \"description\": \"%7Brbs.xis.int%21%7D The bacteriophage lambda xis/integrase gene with native rbs and stop codon%3B assembly \", \"info\": \"xis/integrase gene with native rbs and stop codon; assembly This part is\"}, {\"id\": \"BBa_K112246\", \"type\": \"Plasmid\", \"description\": \"%7BpAH57 promoter%7D%7Brbs.xis.int%21%7D%7Brbs.ihfA%21%7D%7Brbs.ihfB%21%7D inserted into K112995 plasmid\", \"info\": \"iGEM HQ This part is inserted into the K112995 plasmid between c\"}, {\"id\": \"BBa_K112248\", \"type\": \"Plasmid\", \"description\": \"%7BpAH57 promoter%7D%7Brbs.xis.int%21%7D%7Brbs.ihfA%21%7D%7Brbs.ihfB%21%7D inserted into K112950 plasmid\", \"info\": \"this part is in BBb Format. it is flanked by BamHI and BglII\"}, {\"id\": \"BBa_K112361\", \"type\": \"Composite\", \"description\": \"%7BPbad%7D%7Brbs_pelB%3E%7D %7B%3C ligase%3E%7D%7B%3C phoA%21%7D%7B%3C b1006%3E%7D\", \"info\": \"phoA! is flanked by BamHI and BglII sites instead of Xb\"}, {\"id\": \"BBa_K112362\", \"type\": \"Composite\", \"description\": \"%7BPbad%7D%7Brbs_phoApp%3E%7D%7B%3C r.BamHI%3E%7D%7B%3C phoA%21%7D%7B%3C b1006%3E%7D\", \"info\": \"phoA! is flanked by BamHI and BglII sites instead of Xb\"}, {\"id\": \"BBa_K112363\", \"type\": \"Composite\", \"description\": \"%7BPbad%7D%7Brbs_lamB%3E%7D %7B%3C r.BglII%3E%7D%7B%3C phoA%21%7D%7B%3C b1006%3E%7D\", \"info\": \"phoA! is flanked by BamHI and BglII sites instead of Xb\"}, {\"id\": \"BBa_K112369\", \"type\": \"Composite\", \"description\": \"%7BPbad%7D%7Brbs_pelB%3E%7D %7B%3C ligase%3E%7D%7B%3C S-Tag%21%7D%7B%3C b1006%3E%7D\", \"info\": \"this part is in BBb Format . it is flanked by BamHI and BglI\"}, {\"id\": \"BBa_K112370\", \"type\": \"Composite\", \"description\": \"%7BPbad%7D%7Brbs_phoApp%3E%7D%7B%3C r.BamHI%3E%7D%7B%3C S-Tag%21%7D%7B%3C b1006%3E%7D\", \"info\": \"this part is in BBb Format . it is flanked by BamHI and BglI\"}, {\"id\": \"BBa_K112371\", \"type\": \"Composite\", \"description\": \"%7BPbad%7D%7Brbs_lamB%3E%7D %7B%3C r.BglII%3E%7D%7B%3C S-Tag%21%7D%7B%3C b1006%3E%7D\", \"info\": \"this part is in BBb Format . it is flanked by BamHI and BglI\"}, {\"id\": \"BBa_K113021\", \"type\": \"Composite\", \"description\": \"Total construct%3A T7 polymerase + GFP/RFP + repressors + overlapping T7 promoter\", \"info\": \"sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12INCOMPATI\"}, {\"id\": \"BBa_K125000\", \"type\": \"Plasmid_Backbone\", \"description\": \"Broad host range BioBrick plasmid derived from pRL1383a with low to medium copy number\", \"info\": \"plasmid derived from pRL1383a with low to medium copy number RSF1010 \"}, {\"id\": \"BBa_K127003\", \"type\": \"Generator\", \"description\": \"Polystyrene binding peptide inserted CPX generated by qurum sensing and constitutive GFP genarator\", \"info\": \"polystyrene binding peptide inserted CPX generated by qurum sensing and constitutive\"}, {\"id\": \"BBa_K132025\", \"type\": \"Project\", \"description\": \"Plac+rfp+Ptet+luxR+Plux+rhlI+cmR-LVA+araC+terminator+Pbad/araC+cmR-LVA+aiiA+terminator\", \"info\": \"Plac+rfp+Ptet+luxR+Plux+rhlI+c\"}, {\"id\": \"BBa_K137083\", \"type\": \"Device\", \"description\": \"Strong promoter + strong RBS + GFP with (CT)21 repeat after start codon + double terminator \", \"info\": \"strong promoter + strong RBS + GFP with (CT)21 repeat after start codon + double terminator\"}, {\"id\": \"BBa_K137084\", \"type\": \"Device\", \"description\": \"Strong promoter + strong RBS + GFP with (CT)20 repeat after start codon + double terminator \", \"info\": \"strong promoter + strong RBS + strong GFP with (CT)20 repeat after start codon + double terminat\"}, {\"id\": \"BBa_K137085\", \"type\": \"Regulatory\", \"description\": \"optimized (TA) repeat constitutive promoter with 13 bp between -10 and -35 elements \", \"info\": \"repeat constitutive promoter with 13 bp between -10 and -35 elements . sequence and features assembly\"}, {\"id\": \"BBa_K137086\", \"type\": \"Regulatory\", \"description\": \"optimized (TA) repeat constitutive promoter with 15 bp between -10 and -35 elements \", \"info\": \"repeat constitutive promoter with 15 bp between -10 and -35 elements . sequence and features assembly\"}, {\"id\": \"BBa_K137087\", \"type\": \"Regulatory\", \"description\": \"optimized (TA) repeat constitutive promoter with 17 bp between -10 and -35 elements \", \"info\": \"repeat constitutive promoter with 17 bp between -10 and -35 elements . sequence and features assembly\"}, {\"id\": \"BBa_K137088\", \"type\": \"Regulatory\", \"description\": \"optimized (TA) repeat constitutive promoter with 19 bp between -10 and -35 elements \", \"info\": \"repeat constitutive promoter with 19 bp between -10 and -35 elements . sequence and features assembly\"}, {\"id\": \"BBa_K137089\", \"type\": \"Regulatory\", \"description\": \"optimized (TA) repeat constitutive promoter with 21 bp between -10 and -35 elements \", \"info\": \"repeat constitutive promoter with 21 bp between -10 and -35 elements . sequence and features assembly\"}, {\"id\": \"BBa_K137090\", \"type\": \"Regulatory\", \"description\": \"optimized (A) repeat constitutive promoter with 17 bp between -10 and -35 elements \", \"info\": \"repeat constitutive promoter with 17 bp between -10 and -35 elements optimized (a) repeat constitu\"}, {\"id\": \"BBa_K137091\", \"type\": \"Regulatory\", \"description\": \"optimized (A) repeat constitutive promoter with 18 bp between -10 and -35 elements \", \"info\": \"repeat constitutive promoter with 18 bp between -10 and -35 elements optimized (a) repeat constitu\"}, {\"id\": \"BBa_K137101\", \"type\": \"Device\", \"description\": \"Strong promoter + strong RBS + tetA with (AGTC)10 repeat after start codon + double terminator\", \"info\": \"strong promoter + strong RBS + tetA with (AGTC)10 repeat after start codon\"}, {\"id\": \"BBa_K137102\", \"type\": \"Device\", \"description\": \"Strong promoter + strong RBS + tetA with (AGTC)9 repeat after start codon + double terminator \", \"info\": \"strong promoter + strong RBS + tetA with (AGTC)9 repeat after start codon\"}, {\"id\": \"BBa_K137107\", \"type\": \"Device\", \"description\": \"Strong promoter + strong RBS + LacZ with (AGTC)10 repeat after start codon + double terminator \", \"info\": \"strong promoter + strong RBS + lacz with (AGTC)10 repeat after start codon + double terminat\"}, {\"id\": \"BBa_K137108\", \"type\": \"Device\", \"description\": \"Strong promoter + strong RBS + LacZ with (AGTC)9 repeat after start codon + double terminator \", \"info\": \"strong promoter + strong RBS + lacz with (AGTC)9 repeat after start codon + double terminat\"}, {\"id\": \"BBa_K142024\", \"type\": \"Device\", \"description\": \"IPTG-on tetracycline-off pulse generator with LacI mutant (R197A) and TetR expression cassette\", \"info\": \"lacI IS mutants are uninducible repressors of lac-controlled promotors . lac\"}, {\"id\": \"BBa_K142025\", \"type\": \"Device\", \"description\": \"IPTG-on tetracycline-off pulse generator with LacI mutant (R197F) and TetR expression cassette\", \"info\": \"lacI IS mutants are uninducible repressors of lac-controlled promotors . lac\"}, {\"id\": \"BBa_K142026\", \"type\": \"Device\", \"description\": \"IPTG-on tetracycline-off pulse generator with LacI mutant (T276A) and TetR expression cassette\", \"info\": \"lacI IS mutants are uninducible repressors of lac-controlled promotors . lac\"}, {\"id\": \"BBa_K142027\", \"type\": \"Device\", \"description\": \"IPTG-on tetracycline-off pulse generator with LacI mutant (T276F) and TetR expression cassette\", \"info\": \"lacI IS mutants are uninducible repressors of lac-controlled promotors . lac\"}, {\"id\": \"BBa_K142028\", \"type\": \"Device\", \"description\": \"IPTG-on tetracycline-off pulse generator with LacI mutant (R197A, T276A)/TetR expression cassette\", \"info\": \"lacI IS mutants are uninducible repressors of lac-controlled promotors . lac\"}, {\"id\": \"BBa_K142029\", \"type\": \"Device\", \"description\": \"IPTG-on tetracycline-off pulse generator with LacI mutant (R197A, T276F)/TetR expression cassette\", \"info\": \"lacI IS mutants are uninducible repressors of lac-controlled promotors . lac\"}, {\"id\": \"BBa_K142030\", \"type\": \"Device\", \"description\": \"IPTG-on tetracycline-off pulse generator with LacI mutant (R197F, T276A)/TetR expression cassette\", \"info\": \"lacI IS mutants are uninducible repressors of lac-controlled promotors . lac\"}, {\"id\": \"BBa_K142031\", \"type\": \"Device\", \"description\": \"IPTG-on tetracycline-off pulse generator with LacI mutant (R197F, T276F)/TetR expression cassette\", \"info\": \"lacI IS mutants are uninducible repressors of lac-controlled promotors . lac\"}, {\"id\": \"BBa_K142048\", \"type\": \"Intermediate\", \"description\": \"promotorless lacI expression cassette followed by constitutively active TetR generator\", \"info\": \"promotorless lacI expression cassette followed by constitutively active TetR generator . sequence and features assembly comp\"}, {\"id\": \"BBa_K157001\", \"type\": \"Protein_Domain\", \"description\": \"EGFR/ErbB1 signal peptide%3B mediates protein transport to a translocational pore\", \"info\": \"signal peptides mediate transport of the protein to a translocational pore . signal \"}, {\"id\": \"BBa_K157010\", \"type\": \"Protein_Domain\", \"description\": \"glycine-serine linker fused to B-cell receptor transmembrane region%3B displays protein on cell surfac\", \"info\": \"glycine-serine linker fused to B-cell receptor transmembrane region \"}, {\"id\": \"BBa_K165091\", \"type\": \"Device\", \"description\": \"Zif268-HIV bs + LexA bs + mCYC + Zif268-HIV repressor (mCherryx2 tagged) on pRS306 \", \"info\": \"Zif268-HIV bs + mCYC + repressor (mCher\"}, {\"id\": \"BBa_K165101\", \"type\": \"Device\", \"description\": \"Zif268-HIV bs + LexA bs + mCYC + Zif268-HIV repressor (mCherryx2 tagged) on pRS304%2A \", \"info\": \"Zif268-HIV bs + mCYC + repressor (mCher\"}, {\"id\": \"BBa_K175006\", \"type\": \"Device\", \"description\": \"%5BJ13002%5D%5BK175001%5D%5BE0840%5D%5BI714031%5D - constitutive trbK GFP and oriT-R\", \"info\": \"constitutive expression of trbK and GFP with oriT-R added to allow conjugative transfer by\"}, {\"id\": \"BBa_K175034\", \"type\": \"Project\", \"description\": \"Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock\", \"info\": \"Lock/key for weak RBS (B0031) has been used to test the functionality of the lock .\"}, {\"id\": \"BBa_K175035\", \"type\": \"Project\", \"description\": \"Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock\", \"info\": \"Lock/key for medium RBS (B0032) has been used to test the functionality of the lock .\"}, {\"id\": \"BBa_K175050\", \"type\": \"Device\", \"description\": \"aTc inducible GFP-LVA generator with integrated I-SceI RS + I-SceI RS + TetR generator\", \"info\": \"aTc inducible GFP-LVA generator with integrated I-SceI RS + I\"}, {\"id\": \"BBa_K176026\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EGFP Receiver (Very High LuxR)%3A pCon 0.70-%3EluxR+pLux/Tet-%3EGFP\", \"info\": \"K176126 is a detector to examing the AHL concentrations produced by constitutive promoters + \"}, {\"id\": \"BBa_K176028\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EPoPS Receiver (Very High LuxR)%3A pCon 0.70-%3EluxR+pLux/Tet-%3EPoPS\", \"info\": \"pCon 0.70->luxR+pLux/Tet->PoPS AHL ->\"}, {\"id\": \"BBa_K176029\", \"type\": \"Device\", \"description\": \"Repressible AHL-%3EGFP Receiver%3A PoPS-%3EtetR+pCon 0.70-%3EluxR+pLux/Tet-%3EGFP\", \"info\": \"hybrid promoter's response to aTc and aHL at different conditions . tet\"}, {\"id\": \"BBa_K176030\", \"type\": \"Device\", \"description\": \"Repressible AHL-%3EGFP Receiver%3A PoPS-%3EtetR-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EGFP\", \"info\": \"the hybrid promoter (K176000) responds to both aTc and aHL at definit time\"}, {\"id\": \"BBa_K176031\", \"type\": \"Device\", \"description\": \"Repressible AHL-%3EPoPS Receiver%3A PoPS-%3EtetR+pCon 0.70-%3EluxR+pLux/Tet-%3EPoPS\", \"info\": \"Repressible AHL->PoPS Receiver: PoPS->tetR+pCon 0.70\"}, {\"id\": \"BBa_K176032\", \"type\": \"Device\", \"description\": \"Repressible AHL-%3EPoPS Receiver%3A PoPS-%3EtetR-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EPoPS\", \"info\": \"Repressible AHL->PoPS Receiver: PoPS->tetR-LVA+p\"}, {\"id\": \"BBa_K176036\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EDeath Receiver%3A pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB\", \"info\": \"TetR repressible AHL->Death Receiver: pCon 0.70->luxR\"}, {\"id\": \"BBa_K176080\", \"type\": \"Device\", \"description\": \"PoPS%2Acell density-%3EPoPS%3A PoPS-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EPoPS\", \"info\": \"PoPS*cell density->PoPS: poPS*luxI-LVA+pCon 0.70->\"}, {\"id\": \"BBa_K176089\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EDeath Receiver%3A pCon 0.70-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"- iGEM HQ AHL -> Death Receiver: pCon 0.70->luxR\"}, {\"id\": \"BBa_K176090\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EDeath Receiver%3A pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"TetR repressible AHL -> Death Receiver: pCon 0.70->luxR+\"}, {\"id\": \"BBa_K176091\", \"type\": \"Device\", \"description\": \"Cell density controller%3A PoPS-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"Cell density controller: PoPS->luxI-LVA+pCon 0.70->luxR+pLux\"}, {\"id\": \"BBa_K176092\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon max-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"cell density controller: pCon max->luxI-LVA+pCon 0.70->luxR+p\"}, {\"id\": \"BBa_K176093\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 1.00-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"cell density controller: pCon 1.00->luxI-LVA+pCon 0.70->luxR+\"}, {\"id\": \"BBa_K176094\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.70-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"cell death = (Cell Density * pCon 0.70) + Input AHL Sequence and\"}, {\"id\": \"BBa_K176095\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.36-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"Cell death = (Cell Density * pCon 0.36) + Input AHL Sequence and\"}, {\"id\": \"BBa_K176096\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.15-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"cell death = (Cell Density * pCon 0.15) + Input AHL Sequence and\"}, {\"id\": \"BBa_K176097\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.04-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"cell death = (Cell Density * pCon 0.04) + Input AHL Sequence and\"}, {\"id\": \"BBa_K176098\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.01-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"Cell density controller: pCon 0.01->luxI-LVA+pCon 0.70->luxR\"}, {\"id\": \"BBa_K176115\", \"type\": \"Device\", \"description\": \"Cell density controller%3A PoPS-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"All ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176116\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon max-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"all ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176117\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 1.00-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"All ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176118\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.70-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"All ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176119\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.36-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"All ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176120\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.15-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"All ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176121\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.04-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"All ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176122\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.01-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"All ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176123\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EPoPS Receiver (PoPS-%3EluxR)%3A PoPS-%3EluxR+pLux/Tet-%3EPoPS\", \"info\": \"TetR repressible AHL->PoPS Receiver (pLux/Tet->\"}, {\"id\": \"BBa_K176124\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EGFP Receiver (PoPS-%3EluxR)%3A PoPS-%3EluxR+pLux/Tet-%3EGFP\", \"info\": \"TetR repressible AHL->GFP Receiver (PoPS->luxR+pL\"}, {\"id\": \"BBa_K176125\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EPoPS Receiver (High LuxR)%3A pCon 0.36-%3EluxR+pLux/Tet-%3EPoPS\", \"info\": \"pCon 0.70->luxR+pLux/Tet->PoPS AHL ->\"}, {\"id\": \"BBa_K176126\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EGFP Receiver (High LuxR)%3A pCon 0.36-%3EluxR+pLux/Tet-%3EGFP\", \"info\": \"tetR repressible AHL->GFP level K176125 with GFP . \"}, {\"id\": \"BBa_K176127\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EPoPS Receiver (Medium LuxR)%3A pCon 0.15-%3EluxR+pLux/Tet-%3EPoPS\", \"info\": \"pCon 0.15->luxR+pLux/Tet->PoPS AHL ->\"}, {\"id\": \"BBa_K176128\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EGFP Receiver (Medium LuxR)%3A pCon 0.15-%3EluxR+pLux/Tet-%3EGFP\", \"info\": \"TetR repressible AHL->GFP receiver (medium LuxR): pCon 0.\"}, {\"id\": \"BBa_K176129\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EPoPS Receiver (Low LuxR)%3A pCon 0.04-%3EluxR+pLux/Tet-%3EPoPS\", \"info\": \"pCon 0.70->luxR+pLux/Tet->PoPS AHL ->\"}, {\"id\": \"BBa_K176130\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EGFP Receiver (Low LuxR)%3A pCon 0.04-%3EluxR+pLux/Tet-%3EGFP\", \"info\": \"TetR repressible AHL->GFP receiver (Low LuxR): pCon 0.\"}, {\"id\": \"BBa_K176131\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EDeath Receiver%3A pCon 0.36-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"- iGEM HQ AHL -> Death Receiver: pCon 0.36->luxR\"}, {\"id\": \"BBa_K176132\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EDeath Receiver%3A pCon 0.36-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"TetR repressible AHL -> Death Receiver: pCon 0.36->luxR+\"}, {\"id\": \"BBa_K176133\", \"type\": \"Device\", \"description\": \"Repressible AHL-%3EPoPS Receiver%3A PoPS-%3EtetR-LVA+pCon 0.36-%3EluxR+pLux/Tet-%3EPoPS\", \"info\": \"Repressible AHL->PoPS Receiver: PoPS->tetR-LVA+p\"}, {\"id\": \"BBa_K176134\", \"type\": \"Device\", \"description\": \"Repressible AHL-%3EGFP Receiver%3A PoPS-%3EtetR-LVA+pCon 0.36-%3EluxR+pLux/Tet-%3EGFP\", \"info\": \"PoPS->tetR-LVA+pCon 0.36->luxR+pLux/t\"}, {\"id\": \"BBa_K176146\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.36-%3EluxI-LVA+pCon 0.36-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"all ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176147\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.36-%3EluxI-LVA+pCon 0.36-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"Cell death = (Cell Density * pCon 0.36) + Input AHL Sequence and\"}, {\"id\": \"BBa_K176149\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.15-%3EluxI-LVA+pCon 0.36-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"all ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176150\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.15-%3EluxI-LVA+pCon 0.36-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"cell death = (Cell Density * pCon 0.15) + Input AHL Sequence and\"}, {\"id\": \"BBa_K176152\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.04-%3EluxI-LVA+pCon 0.36-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"all ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176153\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.04-%3EluxI-LVA+pCon 0.36-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"cell death = (Cell Density * pCon 0.04) + Input AHL Sequence and\"}, {\"id\": \"BBa_K176155\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.01-%3EluxI-LVA+pCon 0.36-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"all ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176156\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.01-%3EluxI-LVA+pCon 0.36-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"cell death = (Cell Density * pCon 0.01) + Input AHL Sequence and\"}, {\"id\": \"BBa_K176168\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EDeath Receiver%3A pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB-LVA\", \"info\": \"TetR repressible AHL->Death Receiver: pCon 0.70->luxR\"}, {\"id\": \"BBa_K176169\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EDeath Receiver%3A pCon 0.70-%3EluxR+pLux/Tet-%3EccdB-LVA(weak RBS)\", \"info\": \"TetR repressible AHL -> Death Receiver: pCon 0.70->luxR+\"}, {\"id\": \"BBa_K176170\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EDeath Receiver%3A pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB-LVA(weak RBS)\", \"info\": \"TetR repressible AHL->Death Receiver: pCon 0.70->luxR\"}, {\"id\": \"BBa_K176171\", \"type\": \"Device\", \"description\": \"Repressible AHL-%3EPoPS Receiver%3A PoPS-%3EtetR-LVA+pCon 0.15-%3EluxR+pLux/Tet-%3EPoPS\", \"info\": \"Repressible AHL->PoPS Receiver: PoPS->tetR-LVA+p\"}, {\"id\": \"BBa_K176172\", \"type\": \"Device\", \"description\": \"Repressible AHL-%3EGFP Receiver%3A PoPS-%3EtetR-LVA+pCon 0.15-%3EluxR+pLux/Tet-%3EGFP\", \"info\": \"PoPS->tetR-LVA+pCon 0.15->luxR+pLux/t\"}, {\"id\": \"BBa_K176173\", \"type\": \"Device\", \"description\": \"Repressible AHL-%3EPoPS Receiver%3A PoPS-%3EtetR-LVA+pCon 0.04-%3EluxR+pLux/Tet-%3EPoPS\", \"info\": \"Repressible AHL->PoPS Receiver: PoPS->tetR-LVA+p\"}, {\"id\": \"BBa_K176174\", \"type\": \"Device\", \"description\": \"Repressible AHL-%3EGFP Receiver%3A PoPS-%3EtetR-LVA+pCon 0.04-%3EluxR+pLux/Tet-%3EGFP\", \"info\": \"PoPS->tetR-LVA+pCon 0.04->luxR+pLux/t\"}, {\"id\": \"BBa_K176185\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EDeath Receiver%3A pCon 0.15-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"- iGEM HQ AHL -> Death Receiver: pCon 0.15->luxR\"}, {\"id\": \"BBa_K176186\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EDeath Receiver%3A pCon 0.15-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"TetR repressible AHL -> Death Receiver: pCon 0.15->luxR+\"}, {\"id\": \"BBa_K176187\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EDeath Receiver%3A pCon 0.04-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"- iGEM HQ AHL -> Death Receiver: pCon 0.04->luxR\"}, {\"id\": \"BBa_K176188\", \"type\": \"Signalling\", \"description\": \"TetR repressible AHL-%3EDeath Receiver%3A pCon 0.04-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"TetR repressible AHL -> Death Receiver: pCon 0.04->luxR+\"}, {\"id\": \"BBa_K176195\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.70-%3EluxI-LVA+pCon 0.36-%3EluxR+pLux/Tet-%3EccdB(weak RBS)\", \"info\": \"all ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176196\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.70-%3EluxI-LVA+pCon 0.36-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB(weak RBS)\", \"info\": \"cell death = (Cell Density * pCon 0.70) + Input AHL sequence and features\"}, {\"id\": \"BBa_K176197\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.70-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB-LVA\", \"info\": \"cell density controller: pCon 0.70->luxI-LVA+luxR+pLux/T\"}, {\"id\": \"BBa_K176198\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.70-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB-LVA\", \"info\": \"cell density controller: (cell density * pCon 0.70) + input ahl sequence and\"}, {\"id\": \"BBa_K176199\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.70-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB-LVA(weak RBS)\", \"info\": \"cell death = (Cell Density * pCon 0.70) + Input AHL Sequence and\"}, {\"id\": \"BBa_K176200\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.70-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB-LVA(weak RBS)\", \"info\": \"Cell death = (Cell Density * pCon 0.70) + Input AHL Sequence and\"}, {\"id\": \"BBa_K176201\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.36-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB-LVA\", \"info\": \"cell density controller: (ccdB-LVA * pCon 0.36) + input ah\"}, {\"id\": \"BBa_K176202\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.36-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB-LVA\", \"info\": \"cell density controller: (cell density * pCon 0.36) + input ahl sequence and features\"}, {\"id\": \"BBa_K176203\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.36-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB-LVA(weak RBS)\", \"info\": \"Cell density controller: pCon 0.36) + luxI-LVA+pCon 0.70->lux\"}, {\"id\": \"BBa_K176204\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.36-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB-LVA(weak RBS)\", \"info\": \"cell death = (Cell Density * pCon 0.36->luxI-LVA+pCon\"}, {\"id\": \"BBa_K176205\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.15-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB-LVA\", \"info\": \"cell density controller: (ccdB-LVA * pCon 0.15) + input ah\"}, {\"id\": \"BBa_K176206\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.15-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB-LVA\", \"info\": \"cell density controller: (cell density * pCon 0.15) + input ahl sequence and features\"}, {\"id\": \"BBa_K176207\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.15-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB-LVA(weak RBS)\", \"info\": \"cell death = (Cell Density * pCon 0.15) + Input AHL Sequence and\"}, {\"id\": \"BBa_K176208\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.15-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB-LVA(weak RBS)\", \"info\": \"cell death = (Cell Density * pCon 0.15->luxI-LVA+pCon\"}, {\"id\": \"BBa_K176209\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.04-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB-LVA\", \"info\": \"all ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176210\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.04-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB-LVA\", \"info\": \"cell density controller: (cell density * pCon 0.04) + input ahl sequence and\"}, {\"id\": \"BBa_K176211\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.04-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB-LVA(weak RBS)\", \"info\": \"all ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176212\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.04-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB-LVA(weak RBS)\", \"info\": \"cell death = (Cell Density * pCon 0.04) + Input AHL Sequence and\"}, {\"id\": \"BBa_K176213\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.01-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB-LVA\", \"info\": \"all ccdb parts have been withdrawn from the registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176214\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.01-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB-LVA\", \"info\": \"cell density controller: (Cell Density * pCon 0.01) + Input AHL Sequence\"}, {\"id\": \"BBa_K176215\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.01-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3EccdB-LVA(weak RBS)\", \"info\": \"all ccdb parts have been withdrawn from the Registry . samples of parts containing the c\"}, {\"id\": \"BBa_K176216\", \"type\": \"Device\", \"description\": \"Cell density controller%3A pCon 0.01-%3EluxI-LVA+pCon 0.70-%3EluxR+pLux/Tet-%3ElacZalpha-ccdB-LVA(weak RBS)\", \"info\": \"cell death = (Cell Density * pCon 0.01) + Input AHL Sequence and\"}, {\"id\": \"BBa_K176240\", \"type\": \"Device\", \"description\": \"High input score automatic selector without lethal device%3A PoPS-%3EluxI-LVA-%3EK176237-%3EPoPS\", \"info\": \"high input score automatic selector without lethal device: PoPS->luxI-LVA->k176237\"}, {\"id\": \"BBa_K176247\", \"type\": \"Device\", \"description\": \"High input score automatic selector without lethal device (with reporter)%3A PoPS-%3EmRFP-%3EK176240-%3EPoPS\", \"info\": \"high input score automatic selector without lethal device (with reporter): mRFP->poPS->\"}, {\"id\": \"BBa_K176248\", \"type\": \"Device\", \"description\": \"Low input score automatic selector (with reporter)%3A PoPS-%3EmRFP-%3ECI Inverter (cI-LVA+pCI)-%3EK176229\", \"info\": \"low input score automatic selector (with reporter): PoPS->mRFP->cI-LVA+\"}, {\"id\": \"BBa_K176249\", \"type\": \"Device\", \"description\": \"Low input score automatic selector w/o lethal device(with reporter)%3A PoPS-%3EmRFP-%3ECI-LVA+pCI-%3EK176240\", \"info\": \"low input score automatic selector w/o lethal device(with reporter): PoPS->mRFP\"}, {\"id\": \"BBa_K177044\", \"type\": \"Generator\", \"description\": \"CI repressor from E. coli phage lambda + Tetracycline repressor (both under RBS.3)\", \"info\": \"CI repressor from e. coli phage lambda + Tetracycline \"}, {\"id\": \"BBa_K180005\", \"type\": \"Composite\", \"description\": \"GoL - Primary plasmid (part 1)/RPS - Paper primary plasmid (part 1) %5BLuxR generator%5D\", \"info\": \"LuxR is constitutively produced under promotion by promoter J23119 . sequence and features Assembly Compatibility\"}, {\"id\": \"BBa_K182002\", \"type\": \"Intermediate\", \"description\": \"Intermediate Part consisting of a cI regulated promoter and TetR (RBS+, Term-).  \", \"info\": \"this is an intermediate part using the biobrick BBa_R0051 as the upstream part and \"}, {\"id\": \"BBa_K182003\", \"type\": \"Intermediate\", \"description\": \"Intermediate part consisting of CI promoter followed by tetR, LacI and Tet Operator\", \"info\": \"intermediate part consisting of CI promoter followed by tetR, lacI and ter promoter\"}, {\"id\": \"BBa_K182100\", \"type\": \"Intermediate\", \"description\": \"Intermediate Part consisting of Lambda cI with Reporter Gene and double Terminators\", \"info\": \"intermediate part consisting of BBa_C0051 upstream and bba_E0840 downstream\"}, {\"id\": \"BBa_K185033\", \"type\": \"Inverter\", \"description\": \"An inverter of a special lactose operon system based on J23110-rbs34-lacI-dter-plac-rbs31\", \"info\": \"an inverter of a special lactose operon system based on J23110-rb\"}, {\"id\": \"BBa_K185053\", \"type\": \"Device\", \"description\": \"Promoter116+RBS34+LacI+Double terminator+Plac+RBS31+RelE+RBS30+Lon protease+Double terminator\", \"info\": \"this device composes of promoter, RBS, LacI, Plac, RelE, Lon and\"}, {\"id\": \"BBa_K188006\", \"type\": \"Reporter\", \"description\": \"Expression of ccdB for self-destruction of bacteria. Since promoter lux/cIIp22, this sequence can be\", \"info\": \"expression of ccdB for self-destruction of bacteria . since promoter lux/cI\"}, {\"id\": \"BBa_K193207\", \"type\": \"Generator\", \"description\": \"TmTHP with promotor for constituitive expression and with EGFP for fusion of Anti-Freeze Protein\", \"info\": \"TmTHP with promotor for constituitive expression and with EGFP for fusion of Anti-free\"}, {\"id\": \"BBa_K193208\", \"type\": \"Generator\", \"description\": \"TmTHP with promotor for constituitive expression and with EGFP for fusion of Anti-Freeze Protein\", \"info\": \"TmTHP with promotor for constituitive expression and with EGFP for fusion of Anti-free\"}, {\"id\": \"BBa_K196005\", \"type\": \"Intermediate\", \"description\": \"HfsG + HfsH proteins from %3Ci%3ECaulobacter crescentus%3C/i%3E + ter (BBa_B0015)\", \"info\": \"HfsG + hfsH proteins from caulobacter crescentus + ter (BB\"}, {\"id\": \"BBa_K197032\", \"type\": \"Composite\", \"description\": \"%7BPbad.rbs.prepro.StrepTag%7D%7Btype IIIs Needle Complex scFV%7D%7BupaG_short%7D(dblterm)\", \"info\": \"displayer is defined as an outmembrane protein that carries another protein to the extracellular space of the\"}, {\"id\": \"BBa_K197034\", \"type\": \"Composite\", \"description\": \"%7BPbad.rbs.prepro.StrepTag%7D%7Bmgfp-5%7D%7BGFP-LVA%7D%7Bcl02365 AtD%7D(dblterm)\", \"info\": \"a displayer is defined as an outmembrane protein that carries another protein to the extracellular space\"}, {\"id\": \"BBa_K202004\", \"type\": \"Regulatory\", \"description\": \"Hybrid promoter having multiple operator sites. Promoter has tetO2 with mutation at position 3 \", \"info\": \"promoter has tetO2 sites which are having mutation at position 3 . two out of three operator\"}, {\"id\": \"BBa_K223034\", \"type\": \"Generator\", \"description\": \"trp-operon + RBS + TolC+ HlyR + HlyC + HlyB + HlyD + TT (Trp-sensitive HlyA exporter)\", \"info\": \"trp-operon + RBS + TolC+ HlyR + HlyC +\"}, {\"id\": \"BBa_K233001\", \"type\": \"Composite\", \"description\": \" Snowdrift 1 , using TorA. A module to secrete B-galactosidase using the TAT-export Pathway\", \"info\": \"module to secrete B-galactosidase using the TAT-export Pathway .\"}, {\"id\": \"BBa_K233002\", \"type\": \"Composite\", \"description\": \"Snowdrift 2 , using YcdB. A module to secrete B-galactosidase using the TAT-export Pathway\", \"info\": \"module to secrete B-galactosidase using the TAT-export Pathway .\"}, {\"id\": \"BBa_K233306\", \"type\": \"Signalling\", \"description\": \"YcdB - This part is a export tag that utilizes the Twin Arginine Transport pathway(TAT)\", \"info\": \"YcdB is an export tag that utilizes the twin arginine transport pathway(TAT)\"}, {\"id\": \"BBa_K233307\", \"type\": \"Signalling\", \"description\": \"TorA- This part is a export tag that utilizes the Twin Arginine Transport pathway(TAT)\", \"info\": \"the twin arginine translocation (Tat)pathway serves to transport folded proteins across energy-transduc\"}, {\"id\": \"BBa_K235019\", \"type\": \"Generator\", \"description\": \"%5BK235016%5D%5BK235003%5D (ribokey-mediated pAra-controlled lambda repressor generator)\", \"info\": \"this BioBrick generates mRNA for the cI repressor protein . protein is\"}, {\"id\": \"BBa_K235022\", \"type\": \"Reporter\", \"description\": \"%5BK235018%5D%5BK235019%5D (mCherry generator, pAra-controlled ribokey-mediated signal inversion)\", \"info\": \"this BioBrick generates the mCherry fluorescent protein (J06504) under the control of the\"}, {\"id\": \"BBa_K235024\", \"type\": \"Generator\", \"description\": \"%5BK235018%5D%5BK235021%5D (mCherry generator, ribokey-mediated signal inversion)\", \"info\": \"this Biobrick will produce mCherry fluorescent protein (J06504) under the control of the \"}, {\"id\": \"BBa_K235025\", \"type\": \"Project\", \"description\": \"%5BK235022%5D%5BK235000%5D (NAND gate, pAra and pLac input signal control, mCherry output signal)\", \"info\": \"this BioBrick replicates the function of a NAND logic gate . the inputs are an inducer\"}, {\"id\": \"BBa_K235033\", \"type\": \"Regulatory\", \"description\": \"%5BK235030%5D%5BK235031%5D (constituitive promoter+32%B0C RBS thermometer+LacI+stop)\", \"info\": \"this part was designed to produce the lacI repressor above 32\\u00b0c, but was not tested in time\"}, {\"id\": \"BBa_K235034\", \"type\": \"Project\", \"description\": \"%5BK235033%5D%5BJ04450%5D (constituitive promoter+32%B0C RBS thermometer+LacI+stop+pLac+RBS+RFP+stop)\", \"info\": \"this part was designed to produce RFP below 32\\u00b0c but was not debugged in time for the 2009 competition\"}, {\"id\": \"BBa_K235035\", \"type\": \"Project\", \"description\": \"%5BK235033%5D%5BK235032%5D (constituitive promoter+32%B0C RBS thermometer+LacI+stop+pLac+RBS+GFP+stop)\", \"info\": \"this part was designed to produce GFP below 32\\u00b0C but was not debugged in time for the 2009 competition\"}, {\"id\": \"BBa_K235036\", \"type\": \"Project\", \"description\": \"%5BK235030%5D%5BK235005%5D (constituitive promoter+32%B0C RBS thermometer+mCherry CDS+stop)\", \"info\": \"this part was designed to produce RFP above 32\\u00b0c but was not debugged in time for the 2009 competition\"}, {\"id\": \"BBa_K235037\", \"type\": \"Project\", \"description\": \"%5BK235030%5D%5BJ04630%5D (constituitive promoter+32%B0C RBS thermometer+GFP+stop)\", \"info\": \"this part was designed to produce GFP above 32\\u00b0c but was not debugged in time for the 2009 competition\"}, {\"id\": \"BBa_K237001\", \"type\": \"Generator\", \"description\": \"IPTG inducible RIP Generator. RIP - Quorum sensing inhibitor of Staphylococcus spp. \", \"info\": \"RIP is a heptapeptide capable of severely reducing the Qourum sensing(Q\"}, {\"id\": \"BBa_K237002\", \"type\": \"Generator\", \"description\": \"Constitutive RIP Generator. RIP - Quorum sensing inhibitor of Staphylococcus spp. \", \"info\": \"RIP or RNAIII inhibiting peptide is a heptapeptide capable of severely \"}, {\"id\": \"BBa_K237003\", \"type\": \"Coding\", \"description\": \"RIP +export signal (OmpA). Quorum sensing inhibitor of Staphylococcus spp. (Including MRSA)\", \"info\": \"RIP is a heptapeptide capable of severely reducing the Qourum sensing(Q\"}, {\"id\": \"BBa_K237004\", \"type\": \"Generator\", \"description\": \"Constitutive sRIP Generator. RIP - Quorum sensing inhibitor of Staphylococcus spp. \", \"info\": \"RIP is a heptapeptide capable of severely reducing the Qourum sensing(Q\"}, {\"id\": \"BBa_K237006\", \"type\": \"Generator\", \"description\": \"IPTG inducible sRIP Generator. RIP - Quorum sensing inhibitor of Staphylococcus spp. \", \"info\": \"RIP is a heptapeptide capable of severely reducing the Qourum sensing(Q\"}, {\"id\": \"BBa_K257000\", \"type\": \"Regulatory\", \"description\": \"fec promoter (Pfec) - inducible through the Fec transduction pathway (ferric citrate)\", \"info\": \"fec transduction pathway allows a signal to be passed from the extracellular milieu down to the cyto\"}, {\"id\": \"BBa_K258007\", \"type\": \"Plasmid\", \"description\": \"Export of recombinant proteins in Escherichia coli using ABC transporter of Erwinia chrysanthemi \", \"info\": \"E. coli harboring the PrtDEF of . chrysanthemi secreted\"}, {\"id\": \"BBa_K258008\", \"type\": \"Plasmid\", \"description\": \"Export of recombinant proteins in Escherichia coli using ABC transporter of Erwinia chrysanthemi \", \"info\": \"E. chrysanthemi exports degradative enzymes by using a type I protein secret\"}, {\"id\": \"BBa_K258012\", \"type\": \"Project\", \"description\": \"AI2-dependent KGF synthesis with RFP reporter and AHL production for Quaroum Sensin Death Mechanism\", \"info\": \"KGF is a protein composed of 194 aminoacids and has a function to renew epitel tissue\"}, {\"id\": \"BBa_K259002\", \"type\": \"DNA\", \"description\": \"BioScaffold Linker - Removes Stop Codons %26 scars %26 replaces with a Gly-Ser linker\", \"info\": \"Bioscaffold Linker - Removes Stop Codons & scars - replaces with\"}, {\"id\": \"BBa_K259004\", \"type\": \"DNA\", \"description\": \"BioScaffold Linker - Removes Stop Codons %26 scars %26 replaces with a Gly-Ser linker\", \"info\": \"Bioscaffold Linker - Removes Stop Codons & Scars - Replaces with\"}, {\"id\": \"BBa_K259008\", \"type\": \"DNA\", \"description\": \"BioScaffold Linker - Removes Stop Codons %26 scars %26 replaces with a Gly-Ser linker\", \"info\": \"Bioscaffold Linker removes stop codons and scars from proteins . adds a\"}, {\"id\": \"BBa_K259009\", \"type\": \"DNA\", \"description\": \"BioScaffold Linker - Removes Stop Codons %26 scars %26 replaces with a Gly-Ser linker\", \"info\": \"Bioscaffold Linker - Removes stop codons & scars and replaces with \"}, {\"id\": \"BBa_K272500\", \"type\": \"Composite\", \"description\": \"Constitutive expression cassette for TetR repressor-mRFP-Spectinomycin resistance marker\", \"info\": \"Constitutive expression cassette for TetR repressor-mRFP-Spectinomycin resistance marker\"}, {\"id\": \"BBa_K272501\", \"type\": \"Composite\", \"description\": \"TetR repressible promoter-Rbs-ccdB toxin - EYFP-constitutive promoter-Rbs-Streptomycin resistance ma\", \"info\": \"TetR repressible promoter-Rbs-ccdB toxin - E\"}, {\"id\": \"BBa_K272991\", \"type\": \"Composite\", \"description\": \"Rbs-ccdB toxin - EYFP-constitutive promoter-Rbs-Streptomycin resistance marker-ECFP\", \"info\": \"Rbs-ccdB toxin - EYFP-constitutive promoter\"}, {\"id\": \"BBa_K273001\", \"type\": \"Coding\", \"description\": \"Alcohol dehydrogenase (adh2 , adhII, adhB) from %3Ci%3EZ. Mobilis%3C/i%3E ATCC 29191\", \"info\": \"acetaldehyde is converted to ethanol via the adh2 (alcohol dehydrogena\"}, {\"id\": \"BBa_K273006\", \"type\": \"Coding\", \"description\": \"%26%23945%3B-ketoisovalerate decarboxylase (kivd) from %3Ci%3ELactococcus lactis%3C/i%3E %7C codon optimized\", \"info\": \"-ketoisovalerate decarboxylase (kivd) originally sequence from lacto\"}, {\"id\": \"BBa_K273007\", \"type\": \"Intermediate\", \"description\": \"RBS - Alcohol Dehydrogenase 2 (adh2 , adhII, adhB) from %3Ci%3ES. cerevisiae%3C/i%3E\", \"info\": \"RBS - Alcohol Dehydrogenase 2 (adh2 , adhII, adh\"}, {\"id\": \"BBa_K273008\", \"type\": \"Intermediate\", \"description\": \"RBS - %26%23945%3B-ketoisovalerate decarboxylase (kivd) from Lactococcus lactis %7C codon optimized\", \"info\": \"-ketoisovalerate decarboxylase (kivd) from lactococc\"}, {\"id\": \"BBa_K283002\", \"type\": \"Device\", \"description\": \"Speed control device (pLacI-rbs-TetR-terminator-ptet-rbs-chez_his-double terminators)\", \"info\": \"full length cheZ gene fused with His6-tag was put under the control of pTet\"}, {\"id\": \"BBa_K299106\", \"type\": \"DNA\", \"description\": \"xbaI G (xbaI site and additional G to behave like biobrick prefix after xba digest)\", \"info\": \"this is just to obtain accurate sequences while working with Anderson's rbs library in original vector .\"}, {\"id\": \"BBa_K299107\", \"type\": \"DNA\", \"description\": \"T.xbaI.G (T followed by xbaI site and additional G to behave like biobrick prefix after xbaI digest)\", \"info\": \"this is just to obtain accurate sequences while working with Anderson's RBS library in original vector . sequences\"}, {\"id\": \"BBa_K299201\", \"type\": \"DNA\", \"description\": \"J23100%5Bpromoter%5D.K299107%5BTxbaIG%5D.J61101%5BRBS%5D %2A%2Ano b-brick scars between%2A%2A\", \"info\": \"this part is just to enable automatic assembly of the Anderson's RBS collection in the original vector with parts clo\"}, {\"id\": \"BBa_K299300\", \"type\": \"DNA\", \"description\": \"J23100%5Bpromoter%5D.K299107%5BTxbaIG%5D.J61100%5BRBS%5D No b-brick scars between\", \"info\": \"this part is just to enable automatic assembly of the Anderson's RBS collection in the original vector with parts clo\"}, {\"id\": \"BBa_K299301\", \"type\": \"DNA\", \"description\": \"J23100%5Bpromoter%5D.K299107%5BTxbaIG%5D.J61101%5BRBS%5D %2A%2Ano b-brick scars between%2A%2A\", \"info\": \"this part is just to enable automatic assembly of the Anderson's RBS collection in the original vector with parts clo\"}, {\"id\": \"BBa_K299307\", \"type\": \"DNA\", \"description\": \"J23100%5Bpromoter%5D.K299107%5BTxbaIG%5D.J61107%5BRBS%5D No b-brick scars between\", \"info\": \"this part is just to enable automatic assembly of the Anderson's RBS collection in the original vector with parts clo\"}, {\"id\": \"BBa_K299317\", \"type\": \"DNA\", \"description\": \"J23100%5Bpromoter%5D.K299107%5BTxbaIG%5D.J61117%5BRBS%5D No b-brick scars between\", \"info\": \"this part is just to enable automatic assembly of the Anderson's RBS collection in the original vector with parts clo\"}, {\"id\": \"BBa_K299327\", \"type\": \"DNA\", \"description\": \"J23100%5Bpromoter%5D.K299107%5BTxbaIG%5D.J61127%5BRBS%5D No b-brick scars between\", \"info\": \"this part is just to enable automatic in sillico assembly of the Anderson's RBS collection in the original vector\"}, {\"id\": \"BBa_K311004\", \"type\": \"Composite\", \"description\": \"Complement of Ethanolamine Utilization Microcompartment proteins from Salmonella LT2\", \"info\": \"a total of 5 micro-compartment genes from the salmonella LT2 operon are stacked and\"}, {\"id\": \"BBa_K314970\", \"type\": \"RBS\", \"description\": \"this is a really long short description. Will it still go through%3F this is a really long short descr\", \"info\": \"a protein native to Bacillus anthracis which cleaves poly-D-?-gluta\"}, {\"id\": \"BBa_K314986\", \"type\": \"Coding\", \"description\": \" -- No description -- thisisthenicknamethisisthenicknamethisisthenicknamethisisthenicknamethisisthen\", \"info\": \"natural CapD is a difficult to express dimer, requiring an auto-cleavage to activate .\"}, {\"id\": \"BBa_K315004\", \"type\": \"DNA\", \"description\": \"variant forward lox site with 3 base changes in the spacer region (loxm2 forward)\", \"info\": \"cre-lox system is used for site-specific recombination . lox sites are 34 b\"}, {\"id\": \"BBa_K315005\", \"type\": \"DNA\", \"description\": \"variant reverse lox site with 3 base changes in the spacer region (loxm2 reverse)\", \"info\": \"cre-lox system is used for site-specific recombination . lox sites are 34 b\"}, {\"id\": \"BBa_K322007\", \"type\": \"Translational_Unit\", \"description\": \"Lumazine protein (LumP). Causes blue shift of %3Ci%3EP. phosphoreum%3C/i%3E luciferase emmision spectrum.\", \"info\": \"Lumazine protein (LumP) of photobacterium phosphoreum is a small protein which \"}, {\"id\": \"BBa_K323089\", \"type\": \"Device\", \"description\": \"In vivo testing device for protein-DNA binding%3A part 2 (lacZ_DTER_pBAD_BsaI_DTER)\", \"info\": \"device for in vivo testing of protein-DNA binding . composed of several parts: 1. DNA binding protein to\"}, {\"id\": \"BBa_K323163\", \"type\": \"Temporary\", \"description\": \"VioC, VioD and VioE enzymes fused with zinc fingers under pBAD promoter in pSB4C5\", \"info\": \"VioC, VioD and VioE enzymes fused with zinc fingers under pBAD promote\"}, {\"id\": \"BBa_K325100\", \"type\": \"Reporter\", \"description\": \"EPIC Firefly Luciferase and LRE %3CBR%3E%3Ci%3EP. Pyralis%3CBR%3E(E. coli optimised)%3C/i%3E\", \"info\": \"this part is a translational unit for a mutant of the luciferase from the north american\"}, {\"id\": \"BBa_K325101\", \"type\": \"Translational_Unit\", \"description\": \"EPIC Firefly Luciferase %3CBR%3E%3Ci%3EPhotinus Pyralis%3CBR%3E(E. coli optimised)%3C/i%3E\", \"info\": \"this part is a translational unit for a mutant of the luciferase from the north american\"}, {\"id\": \"BBa_K325102\", \"type\": \"Translational_Unit\", \"description\": \"Luciferin Regenerating Enzyme (LRE)%3CBR%3E%3Ci%3EP. Pyralis%3CBR%3E(E. coli optimised)%3C/i%3E\", \"info\": \"LRE is a protein found in the light producing lantern organs of fireflies . catalyses\"}, {\"id\": \"BBa_K325108\", \"type\": \"Generator\", \"description\": \"EPIC Firefly Luciferase (under pBAD)%3CBR%3E%3Ci%3EP. Pyralis%3CBR%3E(E. coli optimised)%3C/i%3E\", \"info\": \"this part is a translational unit for a mutant of the luciferase from the north american\"}, {\"id\": \"BBa_K325109\", \"type\": \"Generator\", \"description\": \"EPIC Firefly Luciferase and LRE (under pBAD)%3CBR%3E%3Ci%3EP. Pyralis%3CBR%3E(E. coli optimised)%3C/i%3E\", \"info\": \"Generates EPIC luciferase and LRE when induced by arabinose . sequence\"}, {\"id\": \"BBa_K325202\", \"type\": \"Translational_Unit\", \"description\": \"Luciferin Regenerating Enzyme (LRE)%3CBR%3E%3Ci%3EL. Cruciata%3CBR%3E(E. coli optimised)%3C/i%3E\", \"info\": \"LRE is a protein found in the light producing lantern organs of fireflies . it cataly\"}, {\"id\": \"BBa_K325209\", \"type\": \"Generator\", \"description\": \"Green Firefly Luciferase and LRE (under pBAD)%3CBR%3E%3Ci%3EL. Cruciata%3CBR%3E(E. coli optimised)%3C/i%3E\", \"info\": \"this is the wild type luciferase from Luciola cruciata with a luci\"}, {\"id\": \"BBa_K325210\", \"type\": \"Reporter\", \"description\": \"Red Firefly Luciferase and LRE%3CBR%3E%3Ci%3EL. Cruciata%3CBR%3E(E. coli optimised)%3C/i%3E\", \"info\": \"luciferase and LRE were expressed and purified in BL21(DE3) . \"}, {\"id\": \"BBa_K325211\", \"type\": \"Translational_Unit\", \"description\": \"Orange Firefly Luciferase%3CBR%3E%3Ci%3EL. Cruciata%3CBR%3E(E. coli optimised)%3C/i%3E\", \"info\": \"two site-directed mutagenesis events have been carried out on the luciferase . an\"}, {\"id\": \"BBa_K325218\", \"type\": \"Generator\", \"description\": \"Orange Firefly Luciferase (under pBAD)%3CBR%3E%3Ci%3EL. Cruciata%3CBR%3E(E. coli optimised)%3C/i%3E\", \"info\": \"this part is based on part BBa_K325219 which is the green wild-type luci\"}, {\"id\": \"BBa_K325219\", \"type\": \"Generator\", \"description\": \"Red Firefly Luciferase and LRE (under pBAD)%3CBR%3E%3Ci%3EL. Cruciata%3CBR%3E(E. coli optimised)%3C/i%3E\", \"info\": \"this part generates a red-mutant of the luciferase from the Japanese firefly\"}, {\"id\": \"BBa_K325229\", \"type\": \"Generator\", \"description\": \"Green Firefly Luciferase and LRE%3CBR%3E%3Ci%3EL. Cruciata%3CBR%3E(E. coli optimised)%3C/i%3E\", \"info\": \"part is based on part BBa_K325219 which is the green wild-type lucifer\"}, {\"id\": \"BBa_K325239\", \"type\": \"Generator\", \"description\": \"Red Firefly Luciferase and LRE (under pBAD)%3CBR%3E%3Ci%3EL. Cruciata%3CBR%3E(E. coli optimised)%3C/i%3E\", \"info\": \"part is based on part BBa_K325219 which is the green wild-type lucifer\"}, {\"id\": \"BBa_K325249\", \"type\": \"Generator\", \"description\": \"Scarlet Firefly Luciferase (under pBAD)%3CBR%3E%3Ci%3EL. Cruciata%3CBR%3E(E. coli optimised)%3C/i%3E\", \"info\": \"scarlet firefly luciferase is based on part BBa_K325219\"}, {\"id\": \"BBa_K325259\", \"type\": \"Generator\", \"description\": \"Yellow Firefly Luciferase (under pBAD)%3CBR%3E%3Ci%3EL. Cruciata%3CBR%3E(E. coli optimised)%3C/i%3E\", \"info\": \"part is based on part BBa_K325219, which is the green wild-type luci\"}, {\"id\": \"BBa_K325905\", \"type\": \"Generator\", \"description\": \"Bacterial Lux reporter %3CBR%3E CDEG p%26%23955%3B AB%3CBR%3E%3Ci%3E(E. coli optimised)%3C/i%3E\", \"info\": \"LuxCDEG genes from v.fischeri have been codon optimised for use in e.coli\"}, {\"id\": \"BBa_K331018\", \"type\": \"Composite\", \"description\": \"Lumazine Synthase Microcompartment Test Construct (ECFP %26 EYFP with N-Terminal Arginine Tag)\", \"info\": \"ECFP & EYFP with N-Terminal Arginine Tag for the analysis of targeting proteins\"}, {\"id\": \"BBa_K331019\", \"type\": \"Composite\", \"description\": \"Lumazine Synthase Microcompartment Test Construct (ECFP %26 EYFP with C-Terminal Arginine Tag)\", \"info\": \"ECFP & EYFP with C-Terminal Arginine Tag for the analysis of targeting proteins\"}, {\"id\": \"BBa_K332032\", \"type\": \"Generator\", \"description\": \"Constitutive promoter+37%26%238451%3B induced RBS+tetR+double terminator+Ptet+RBS+GFP+double terminator\", \"info\": \"the tetR gene can repress the pTet promoter (BBa_R\"}, {\"id\": \"BBa_K336060\", \"type\": \"Composite\", \"description\": \"promoter+RBS+ompA signal+cyaA+double termnator+promoter+RBS+mRFP1+double termnator\", \"info\": \"this device expresses CyaA (adenylate cyclase) out of cytoplasm\"}, {\"id\": \"BBa_K336061\", \"type\": \"Composite\", \"description\": \"promoter+RBS+ompA signal+lacZ+double termnator+promoter+RBS+SBFP2+double termnator\", \"info\": \"this device expresses CyaA (adenylate cyclase) out of cytoplasm\"}, {\"id\": \"BBa_K337032\", \"type\": \"Measurement\", \"description\": \"pSMB_miTuner Plasmid HD1 (BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/CMV/Kozag_hRluc_BGH )\", \"info\": \"pSMB_miTuner plasmid for microRNA binding site measurment and\"}, {\"id\": \"BBa_K337035\", \"type\": \"Measurement\", \"description\": \"pSMB_miTuner Plasmid HD2 (BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH)\", \"info\": \"BBa_K337032 leads to a relative luciferase unit (RLU)\"}, {\"id\": \"BBa_K337036\", \"type\": \"Measurement\", \"description\": \"pSMB_miTuner Plasmid HD3 (BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH )\", \"info\": \"BBa_K337032 leads to a relative luciferase unit (rlu\"}, {\"id\": \"BBa_K337038\", \"type\": \"Measurement\", \"description\": \"pSMB_miTuner Plasmid HD4 (BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/CMV/Kozag_hRluc_BGH)\", \"info\": \"BBa_K337032 leads to a relative luciferase unit (rlu\"}, {\"id\": \"BBa_K337040\", \"type\": \"Measurement\", \"description\": \"pSMB_miTuner Plasmid HD5 (BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH)\", \"info\": \"pSMB_miTuner plasmid used for binding site characterization and expression tuning (\"}, {\"id\": \"BBa_K337042\", \"type\": \"Measurement\", \"description\": \"pSMB_miTuner Plasmid HD6 (BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH)\", \"info\": \"pSMB_miTuner plasmid used for binding site characterization and expression tuning (\"}, {\"id\": \"BBa_K337044\", \"type\": \"Measurement\", \"description\": \"pSMB_miTuner Plasmid HD7 (BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/RSV/Kozag_hRluc_BGH )\", \"info\": \"pSMB_miTuner plasmid used for microRNA binding site characterization and expression\"}, {\"id\": \"BBa_K337046\", \"type\": \"Measurement\", \"description\": \"pSMB_miTuner Plasmid HD8 (BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/RSV/Kozag_hRluc_BGH )\", \"info\": \"pSMB_miTuner plasmid used for microRNA binding site characterization and expression\"}, {\"id\": \"BBa_K343001\", \"type\": \"Coding\", \"description\": \"B-carotene monooxygenase, Produces retinal from B-carotene. ninaB gene from Drosophila.\", \"info\": \"beta-carotene monooxygenase is an enzyme that produces retinal . nin\"}, {\"id\": \"BBa_K346006\", \"type\": \"Composite\", \"description\": \"Dsba-mbp(lead metal binding peptide)+mbp(lead metal binding peptide)+lpp-ompa-mbp(lead metal binding\", \"info\": \"the part is composed of three different subparts, the Dsba-mbp, the m\"}, {\"id\": \"BBa_K346022\", \"type\": \"Measurement\", \"description\": \"PmerT promoter mutant 25+RBS(B0030)+GFP(E0040)Terminator(B0010)+Terminator(B0012)\", \"info\": \"PmerT promoter mutant 25+RBS(B0030)+GFP(E0040)Term\"}, {\"id\": \"BBa_K346023\", \"type\": \"Measurement\", \"description\": \"PmerT promoter mutant 44+RBS(B0030)+GFP(E0040)Terminator(B0010)+Terminator(B0012)\", \"info\": \"PmerT promoter mutant 44+RBS(B0030)+GFP(E0040)Term\"}, {\"id\": \"BBa_K346024\", \"type\": \"Measurement\", \"description\": \"PmerT promoter mutant 85+RBS(B0030)+GFP(E0040)Terminator(B0010)+Terminator(B0012)\", \"info\": \"PmerT promoter mutant 85+RBS(B0030)+GFP(E0040)Term\"}, {\"id\": \"BBa_K346025\", \"type\": \"Measurement\", \"description\": \"PmerT promoter mutant 88+RBS(B0030)+GFP(E0040)Terminator(B0010)+Terminator(B0012)\", \"info\": \"PmerT promoter mutant 88+RBS(B0030)+GFP(E0040)\"}, {\"id\": \"BBa_K346029\", \"type\": \"Generator\", \"description\": \"T7p(BBa_I719005)+RBS(B0034)+Lpp-OmpA+MBP(surface display of lead binding peptide)\", \"info\": \"Lpp-OmpA-mbp(lead) is designed as a fusion protein consist\"}, {\"id\": \"BBa_K346033\", \"type\": \"Generator\", \"description\": \"T7p(BBa_I719005)+RBS(B0034)+DsbA+MBP(periplasm display of mercury binding peptide)\", \"info\": \"DsbA is a protein that can export its C-terminal fusion protein into periplasm more\"}, {\"id\": \"BBa_K346034\", \"type\": \"Generator\", \"description\": \"T7p(BBa_I719005)+RBS(B0034)+Lpp-OmpA+MBP(surface display of mercury binding peptide)\", \"info\": \"this part is the combination of a T7promoter(BBa_I719005),RBS\"}, {\"id\": \"BBa_K346058\", \"type\": \"Device\", \"description\": \"T7promoter(BBa_I719005)+RBS(B0034)+phiR73 delta(BBa_I746352)+Terminator(B0015)+PO promoter(BBa_I7463\", \"info\": \"device is designed for time delay and amplification . induces the expression of T7 polymerase which is\"}, {\"id\": \"BBa_K346089\", \"type\": \"Generator\", \"description\": \"T7 promoter(BBa_I719005)+MerT+MerP+MerC(the facilitation module of mercury absorption)\", \"info\": \"MerT,merP and merC can act together to transport Hg(II) into the cyto\"}, {\"id\": \"BBa_K351004\", \"type\": \"Coding\", \"description\": \"Modified Human FGF receptor for MPT51 antigen with fission yeast surface signal peptide\", \"info\": \"this protein is modified protein which receive MPT51, antigen of mycobacterium tuberculosis\"}, {\"id\": \"BBa_K357003\", \"type\": \"Coding\", \"description\": \"3-oxoadipate enol-lactonase (also known as beta-ketoadipate enol-lactone hydrolase)\", \"info\": \"3-oxoadipate enol-lactonase is an enzyme that cata\"}, {\"id\": \"BBa_K357007\", \"type\": \"Coding\", \"description\": \"Fusion of muconolactone D-isomerase (Enzyme 3) and 3-oxoadipate enol-lactonase (Enzyme 4)\", \"info\": \"fusion of muconolactone D-isomerase (enzyme 3) and 3-oxo\"}, {\"id\": \"BBa_K362007\", \"type\": \"Reporter\", \"description\": \"This composite part has the promoter ,ahpC-promoter controlled by OxyR protein, and GFP - T-T\", \"info\": \"this composite part has the promoter ,ahpC-promoter controlled by OxyR protein,\"}, {\"id\": \"BBa_K362051\", \"type\": \"Reporter\", \"description\": \"ahpC promoter - RBS - GFP - Term - Term  - sufA promoter - RBS - RFP - Term - Term\", \"info\": \"ahpC promoter is controlled by OxyR protein, an oxidative stress responsive transcription factor \"}, {\"id\": \"BBa_K362052\", \"type\": \"Reporter\", \"description\": \"ahpC promoter - RBS - RFP - Term - Term  - sufA promoter - RBS - GFP - Term - Term\", \"info\": \"ahpC promoter is controlled by OxyR protein, an oxidative stress responsive transcription factor \"}, {\"id\": \"BBa_K362065\", \"type\": \"Reporter\", \"description\": \"ahpC promoter - RBS - GFP - T-T - sufA promoter - RBS - RFP - T-T - dps promoter - RBS - CFP - T-T\", \"info\": \"ahpC promoter, sufA promoter and dps promoter are controlled by Ox\"}, {\"id\": \"BBa_K363001\", \"type\": \"Regulatory\", \"description\": \"The consensus calcium dependent response element binding site for the Crz1 activator.\", \"info\": \"this part is a binding site for the Crz1 transcriptional activator . when placed upstream of \"}, {\"id\": \"BBa_K363006\", \"type\": \"Regulatory\", \"description\": \"A characterized calcium dependent response element binding site for the Crz1 activator\", \"info\": \"this part is a binding site for the Crz1 transcriptional activator . it occurs naturally as an activ\"}, {\"id\": \"BBa_K363011\", \"type\": \"Coding\", \"description\": \"Cna1, catalytic subunit of calcium sensitive protein phosphatase calcineurin from S. cerevisiae\", \"info\": \"this part encodes isoform A of the catalytic subunit of the protein phosphatase \"}, {\"id\": \"BBa_K363012\", \"type\": \"Coding\", \"description\": \"Cnb1, the calcium sensitive regulatory subunit for calcineurin from S. cerevisiae\", \"info\": \"this part codes for the regulatory subunit of the protein phosphatase calcineurin of Sacchar\"}, {\"id\": \"BBa_K373002\", \"type\": \"Composite\", \"description\": \"%7BPbad.rbs.prepro.StrepTag%7D%5BPYY3-36%5D%7BINP repeats%7D%7BVtaA11 AtD%7D(dblterm)\", \"info\": \"Pbad.rbs.prepro.StrepTag[PYY3-36\"}, {\"id\": \"BBa_K374010\", \"type\": \"Regulatory\", \"description\": \"Gifsy1 anti-repressor which anti-represses the Gifsy1 repressor gogR from BBa_K374008\", \"info\": \"this part contains the anti-repressor from Gifsy1 called antO which inactivates the\"}, {\"id\": \"BBa_K395603\", \"type\": \"Generator\", \"description\": \"alcohol acetyltransferase%3B converts butanol or 2-methylbutanol to butyl acetate or 2-methylbutyl ace\", \"info\": \"alcohol acetyltransferase; converts butanol or 2-methylbutano\"}, {\"id\": \"BBa_K411123\", \"type\": \"Generator\", \"description\": \"Split RFP-eIF4A_A Generator (R0040 + B0034 + RFP_split_A+Linker+eIF4A_split_A + B0015)\", \"info\": \"Split RFP-eIF4A_A Generator (R0040 + B0034 + RFP_s\"}, {\"id\": \"BBa_K411124\", \"type\": \"Generator\", \"description\": \"Split RFP-eIF4A_B Generator (R0040 + B0034 + RFP_split_B+Linker+eIF4A_split_B + B0015)\", \"info\": \"Split-RFP-eIF4A_B Generator (R0040 + B0034 + RFP_\"}, {\"id\": \"BBa_K415007\", \"type\": \"Composite\", \"description\": \"pLux/cI-OR %3A RBS-mCherry %3A Term %3A pLux/cI-OR %3A RBS-luxI %3A Term %3A p(tetR) %3A RBS-luxR %3A Term\", \"info\": \"composite is composed of the parts BBa_K415000 and bba_i15030 .\"}, {\"id\": \"BBa_K415011\", \"type\": \"Composite\", \"description\": \"PtetR %3A RBS %3A LuxR %3A Term %3A PluxR/cI-OR %3A RBS %3A mCherry %3A Term %3A Plux/cI-OR %3A RBS %3A LuxI \", \"info\": \"BBa_K415010 is a circuit which produces mCherry regulated by the Lux\"}, {\"id\": \"BBa_K415020\", \"type\": \"Composite\", \"description\": \"PluxR/cI-OR %3A RBS %3A mCherry%3A Term %3A PtetR %3A RBS %3A LuxR %3A Term %3A PLuxR/cI-OR %3A RBS %3A LuxI \", \"info\": \"this BioBrick circuit consists of part BBa_K415006 followed by BBb_C\"}, {\"id\": \"BBa_K415022\", \"type\": \"Composite\", \"description\": \"PluxR/cI-OR %3A RBS %3A mCherry %3A Term %3A PtetR %3A RBS %3A LuxR %3A Term %3A Plux/cI-OR %3A RBS %3A LuxI\", \"info\": \"BBa_K415022 can produce luxR, mCherry, and luxI\"}, {\"id\": \"BBa_K415023\", \"type\": \"Composite\", \"description\": \"pLux-Lac%3AGFP%3ATerm%3ATerm%3APluxR/cI-OR %3AmCherry%3ATerm%3APtetR%3ALuxR%3ATerm%3APlux/cI-OR%3ALuxI  \", \"info\": \"pTSMa/K415023 co-transformed in JM2.300 cells were grown overnight in\"}, {\"id\": \"BBa_K415069\", \"type\": \"Composite\", \"description\": \"pLux-Lac%3AGFP%3ATerm%3ATerm%3APluxR/cI-OR %3AmCherry%3ATerm%3APtetR%3ALuxR%3ATerm%3AFixed-pLux/cI%3ALuxI\", \"info\": \"BBa_K415069 produces luxR, mCherry, and luxI \"}, {\"id\": \"BBa_K424017\", \"type\": \"Composite\", \"description\": \"Test plataform for rhamnosyltransferase BioBrick (Rh1AB_BB) expression in E. coli\", \"info\": \"test plataform for rhamnosyltransferase BioBrick (Rh1AB_\"}, {\"id\": \"BBa_K431002\", \"type\": \"DNA\", \"description\": \"Rattus norvegicus monoamine oxidase A (Maoa), nuclear gene encoding             mitochondrial protei\", \"info\": \"Rattus norvegicus monoamine oxidase A (Maoa) nuclear gene\"}, {\"id\": \"BBa_K497006\", \"type\": \"Translational_Unit\", \"description\": \"Synechocystis heme oxygenase 1 with Agrobacterium tumefaciens bacteriophytochrome %26 RBS\", \"info\": \"Synechocystis heme oxygenase 1 with bacteriophytochrome gene\"}, {\"id\": \"BBa_K497007\", \"type\": \"Translational_Unit\", \"description\": \"Synechocystis heme oxygenase 1 with Deinococcus radiodurans bacteriophytochrome %26 RBS\", \"info\": \"assembly of Deinococcus radiodurans isolated bacteriophytochrome gene with Synechoc\"}, {\"id\": \"BBa_K497016\", \"type\": \"Primer\", \"description\": \"Agrobacterium tumefaciens fwd primer for bacteriophytochrome for insertion after heme oxygenase\", \"info\": \"Agrobacterium tumefaciens fwd primer for bacteriophytoch\"}, {\"id\": \"BBa_K497017\", \"type\": \"Primer\", \"description\": \"Reverse primer for Agrobacterium tumefaciens bacteriophytochrome gene for insertion after heme oxyge\", \"info\": \"reverse primer for agrobacterium tumefaciens bacteriophytochrome gene\"}, {\"id\": \"BBa_K497018\", \"type\": \"Primer\", \"description\": \"Forward primer Deinococcus radiodurans bacteriophytochrome gene for insertion after heme oxygenase\", \"info\": \"this is the forward primer for full amplification of bacteriophytochrome gene of Deinococc\"}, {\"id\": \"BBa_K497019\", \"type\": \"Primer\", \"description\": \"Reverse primer Deinococcus radiodurans bacteriophytochrome gene for insertion after heme oxygenase\", \"info\": \"reverse primer for full amplification of bacteriophytochrome gene of Deinococcus radiodur\"}, {\"id\": \"BBa_K511803\", \"type\": \"Generator\", \"description\": \"Repressible Fluorescence/Repression Generator (Hef1a-LacO-AmCyan-miRFF4) MammoBlock Device\", \"info\": \"composite device produces the cyan fluorescent protein amcyan-miRFF4 at a low, constitu\"}, {\"id\": \"BBa_K511804\", \"type\": \"Generator\", \"description\": \"Repressible Enhanced Blue Fluorescent Protein Generator (Hef1a-LacO-EBFP2) MammoBlock Device\", \"info\": \"composite device produces the enhanced blue fluorescent protein EBFP2 at a low, constitutive level and can be inhibit\"}, {\"id\": \"BBa_K511805\", \"type\": \"Generator\", \"description\": \"Repressible Yellow Fluorescence Generator (Hef1a-LacO-EYFP-4xFF4) MammoBlock Device \", \"info\": \"composite device produces the yellow fluorescent protein EYFP-FF4x4 at a low, constitutive level \"}, {\"id\": \"BBa_K511806\", \"type\": \"Generator\", \"description\": \"Repressible Red Fluorescent Ligand Generator (Hef1a-LacO-Delta-mCherry) MammoBlock Device%09\", \"info\": \"composite device produces the red fluorescent juxtacrine signaling ligand Delta-mCherry\"}, {\"id\": \"BBa_K511807\", \"type\": \"Generator\", \"description\": \"Repressible Red Fluorescent Protein Generator (Hef1a-LacO-mKate) MammoBlock Device\", \"info\": \"composite device produces the monomeric red fluorescent protein mKate at a low, constitutive level driven by the\"}, {\"id\": \"BBa_K511808\", \"type\": \"Generator\", \"description\": \"Repressible Yellow Fluorescent Protein Generator (Hef1a-LacO-EYFP) MammoBlock Device \", \"info\": \"composite device produces the yellow fluorescent protein EYFP at a low, constitutive level driven by the Hef1\"}, {\"id\": \"BBa_K511809\", \"type\": \"Signalling\", \"description\": \"Repressible Tango Ligand Generator (Hef1a-LacO-pDisplay-Vasopressin-MYC) MammoBlock Device\", \"info\": \"pDisplay-Vasopressin-MYC is a synthetic ligand designed to\"}, {\"id\": \"BBa_K511810\", \"type\": \"Signalling\", \"description\": \"Repressible Tango Receptor Generator (Hef1a-LacO-AVPR2-TEVs-Gal4-VP16) MammoBlock Device\", \"info\": \"AVPR2-TEVs-Gal4-VP16 is a synthetic fusion receptor adapted from\"}, {\"id\": \"BBa_K511811\", \"type\": \"Signalling\", \"description\": \"Notch-Gal4-ESN Juxtacrine Receptor Generator (CMV-Notch-Gal4-ESN) MammoBlock Device\", \"info\": \"composite device produces the juxtacrine signaling Notch-Gal4-ESN receptor using\"}, {\"id\": \"BBa_K511812\", \"type\": \"Generator\", \"description\": \"CI434-VP16-Inducible Red Fluorescence Generator (minCMV-1xCI434-mKate) MammoBlock Device\", \"info\": \"composite device produces the monomeric red fluorescent protein mKate driven by the minCMV-1xCI434\"}, {\"id\": \"BBa_K511813\", \"type\": \"Generator\", \"description\": \"Mnt-VP16-Inducible Red Fluorescence Generator (minCMV-4xMnt-mKate) MammoBlock Device\", \"info\": \"composite device produces the monomeric red fluorescent protein mKate driven by the minCMV-4xMnt\"}, {\"id\": \"BBa_K511814\", \"type\": \"Signalling\", \"description\": \"Inducible Red Fluorescent Ligand Generator (TRE-Tight-Delta-mCherry) MammoBlock Device\", \"info\": \"composite device produces the red fluorescent juxtacrine signaling ligand Delta-mCherry\"}, {\"id\": \"BBa_K511815\", \"type\": \"Generator\", \"description\": \"Inducible Red Fluorescent Protein Generator (TRE-Tight-mKate) MammoBlock Device%09\", \"info\": \"TRE-tight-mKate is an inducible red fluorescent protein generator . device produces m\"}, {\"id\": \"BBa_K511816\", \"type\": \"Generator\", \"description\": \"Inducible Blue Fluorescent Protein Generator (TRE-Tight-EBFP2) MammoBlock Device \", \"info\": \"composite device produces the blue fluorescent protein EBFP2 when induced with tTA/rtTA transactiv\"}, {\"id\": \"BBa_K511817\", \"type\": \"Generator\", \"description\": \"Inducible Yellow Fluorescent Protein Generator (TRE-Tight-EYFP-FF4x4) MammoBlock Device \", \"info\": \"composite device produces the yellow fluorescent protein EYFP-FF4x4 when induced with tTA/r\"}, {\"id\": \"BBa_K511818\", \"type\": \"Signalling\", \"description\": \"Inducible Notch-Gal4-ESN Receptor Generator (TRE-Tight-Notch-Gal4-ESN) MammoBlock Device \", \"info\": \"composite device produces the Notch-Gal4-ESN juxtacrine signaling receptor when\"}, {\"id\": \"BBa_K511819\", \"type\": \"Generator\", \"description\": \"Inducible Yellow Fluorescent Protein Generator (UAS-Gal4-Citrine) MammoBlock Device \", \"info\": \"inducible yellow fluorescent protein generator (UAS-Gal4-Citrine) mammoblock composite\"}, {\"id\": \"BBa_K511821\", \"type\": \"Generator\", \"description\": \"Inducible Fluorescence/Repression Generator (UAS-Gal4-amCyan-miRFF4) MammoBlock Device \", \"info\": \"composite device produces the cyan fluorescent protein amCyan-miRFF4 when induced with Gal4\"}, {\"id\": \"BBa_K511822\", \"type\": \"Generator\", \"description\": \"Inducible Yellow Fluorescent Protein Generator (UAS-Gal4-EYFP-FF4x4) MammoBlock Device \", \"info\": \"composite device produces the yellow fluorescent protein EYFP-FF4x4 when induced with Gal4 transactivator\"}, {\"id\": \"BBa_K511824\", \"type\": \"Signalling\", \"description\": \"Inducible Red Fluorescent Ligand Generator (UAS-Gal4-Delta-mCherry) MammoBlock Device\", \"info\": \"composite device produces red fluorescent juxtacrine signaling ligand Delta-mCherry when\"}, {\"id\": \"BBa_K511825\", \"type\": \"Signalling\", \"description\": \"Inducible Notch-Gal4-ESN Receptor Generator (UAS-Gal4-Notch-Gal4-ESN) MammoBlock Device%09\", \"info\": \"composite device produces the Notch-Gal4-ESN juxtacrine signaling receptor when\"}, {\"id\": \"BBa_K511826\", \"type\": \"Generator\", \"description\": \"Inducible N-Cadherin-2A-EYFP Generator (UAS-Gal4-N-Cadherin-2A-EYFP) MammoBlock Device \", \"info\": \"composite device produces both the N-Cadherin cell-cell adhesion compound and the yellow fluorescent protein\"}, {\"id\": \"BBa_K511905\", \"type\": \"Generator\", \"description\": \"Repressible rtTA3 Transactivator Generator (Hef1a-LacO-rtTA3) MammoBlock Device%09\", \"info\": \"Repressible rtTA3 transactivator generator (hef1a-lacO-rt\"}, {\"id\": \"BBa_K511906\", \"type\": \"Generator\", \"description\": \"Inducible CI434-VP16 Transactivator Generator (TRE-Tight-CI434-VP16) MammoBlock Device%09\", \"info\": \"composite device produces the CI434-VP16 transactivator protein when induced with tTA/r\"}, {\"id\": \"BBa_K511907\", \"type\": \"Generator\", \"description\": \"Inducible Mnt-VP16 Transactivator Generator (TRE-Tight-Mnt-VP16) MammoBlock Device%09\", \"info\": \"composite device produces the Mnt-VP16 transactivator protein when induced with tTA/rt\"}, {\"id\": \"BBa_K511908\", \"type\": \"Generator\", \"description\": \"Inducible Gal4-VP16 Transactivator Generator (TRE-Tight-Gal4-VP16) MammoBlock Device%09\", \"info\": \"composite device produces the Gal4-VP16 transactivator protein when induced with tTA/rtTA\"}, {\"id\": \"BBa_K511910\", \"type\": \"Generator\", \"description\": \"Inducible LacI-KRAB Repressor Generator (TRE-Tight-LacI-KRAB) MammoBlock Device%09\", \"info\": \"MammoBlock composite device produces lacI-KRAB strong repressor protein when induced with\"}, {\"id\": \"BBa_K525121\", \"type\": \"Coding\", \"description\": \"S-layer cspB from Corynebacterium glutamicum with TAT-Sequence and lipid anchor, PT7 and RBS\", \"info\": \"S-layer proteins are crystal-like layers consisting of multiple protein monomers . their ability for self-a\"}, {\"id\": \"BBa_K525161\", \"type\": \"Coding\", \"description\": \"Fusion Protein of Luciferase and cspB from Corynebacterium glutamicum with TAT-Sequence and lipid an\", \"info\": \"fusion protein of luciferase and cspB from corynebacterium glut\"}, {\"id\": \"BBa_K525221\", \"type\": \"Coding\", \"description\": \"S-layer cspB from Corynebacterium halotolerans with TAT-Sequence and lipid anchor,  PT7 and RBS\", \"info\": \"S-layers are crystal-like layers consisting of multiple protein monomers . their ability for self-a\"}, {\"id\": \"BBa_K525234\", \"type\": \"Coding\", \"description\": \"Fusion Protein of mRFP, S-layer cspB from Corynebacterium halotolerans with TAT-sequence, PT7, RBS \", \"info\": \"fusion protein of mRFP, S-layer cspB from corynebacterium\"}, {\"id\": \"BBa_K525261\", \"type\": \"Coding\", \"description\": \"Fusion Protein of Luciferase and cspB from Corynebacterium halotolerans with TAT-Sequence and lipid \", \"info\": \"fusion protein of luciferase and cspB from corynebacterium \"}, {\"id\": \"BBa_K525264\", \"type\": \"Coding\", \"description\": \"Fusion Protein of Luciferase, S-layer cspB from Corynebacterium halotolerans with TAT-sequence, PT7 \", \"info\": \"Fusion Protein of Luciferase, S-layer cspB from corynebacterium\"}, {\"id\": \"BBa_K525562\", \"type\": \"Coding\", \"description\": \"Fusion protein of NADP+ Oxidoreductase and BisdA and BisdB with middle strong promoter,RBS\", \"info\": \"BBa_K525562 enables the bacterium to degrade the endocrine disruptor\"}, {\"id\": \"BBa_K531000\", \"type\": \"Regulatory\", \"description\": \"P%3Csub%3ErsaA%3C/sub%3E%3A A constitutive promoter and RBS from %3Ci%3ECaulobacter crescentus%3C/i%3E\", \"info\": \"most of our chimeric RsaA-fusion proteins were expressed and secreted from Caulobacter \"}, {\"id\": \"BBa_K531002\", \"type\": \"Regulatory\", \"description\": \"P%3Csub%3Exyl%3C/sub%3E%3A Inducible promoter and RBS from %3Ci%3ECaulobacter crescentus%3C/i%3E\", \"info\": \"most of our chimeric RsaA-fusion proteins were expressed and secreted from Caulobacter \"}, {\"id\": \"BBa_K531004\", \"type\": \"Coding\", \"description\": \"dspB from Actinobacillus actinomycetemcomitansis optimized for Caulobacter crescentus\", \"info\": \"dspB comes from the bacteria actinobacillus actinomycetemcomitans\"}, {\"id\": \"BBa_K531005\", \"type\": \"Composite\", \"description\": \"P%3Csub%3Exyl%3C/sub%3E promoter+optimized %3Ci%3Eesp%3C/i%3E+%3Ci%3ErsaA%3C/i%3E secretion tag \", \"info\": \"bioBrick part enables caulobacter to express and secrete Esp protein in the presence of x\"}, {\"id\": \"BBa_K531007\", \"type\": \"Composite\", \"description\": \"P%3Csub%3ErsaA%3C/sub%3E constitutive promoter, %3Ci%3Eesp%3C/i%3E optimized for %3Ci%3ECaulobacter%3C/i%3E, and %3Ci%3ErsaA%3C/i%3E\", \"info\": \"most of our chimeric RsaA-fusion proteins were expressed and secreted from Caulobacter \"}, {\"id\": \"BBa_K531008\", \"type\": \"Composite\", \"description\": \"P%3Csub%3Exyl%3C/sub%3E + %3Ci%3ECaulobacter%3C/i%3E optimized %3Ci%3EdspB%3C/i%3E + %3Ci%3ErsaA%3C/i%3E C-term\", \"info\": \"most of our chimeric RsaA-fusion proteins were expressed and secreted from Caulobacter \"}, {\"id\": \"BBa_K531009\", \"type\": \"Composite\", \"description\": \"P%3Csub%3ErsaA%3C/sub%3E + %3Ci%3ECaulobacter%3C/i%3E optimized %3Ci%3EdspB%3C/i%3E + %3Ci%3ErsaA%3C/i%3E C-term\", \"info\": \"most of our chimeric RsaA-fusion proteins were expressed and secreted from Caulobacter \"}, {\"id\": \"BBa_K531010\", \"type\": \"Composite\", \"description\": \"Constitutive promoter and RBS BBa_K081005 + %3Ci%3ECaulobacter%3C/i%3E optimized %3Ci%3EdspB%3C/i%3E + %3Ci%3ErsaA%3C/i%3E C\", \"info\": \"most of our chimeric RsaA-fusion proteins were expressed and secreted from Caulobacter \"}, {\"id\": \"BBa_K531011\", \"type\": \"Composite\", \"description\": \"Constitutive promoter and RBS BBa_K081005 + %3Ci%3ECaulobacter%3C/i%3E optimized %3Ci%3Eesp%3C/I%3E + C-terminal sec\", \"info\": \"most of our chimeric RsaA-fusion proteins were expressed and secreted from Caulobacter \"}, {\"id\": \"BBa_K539392\", \"type\": \"Intermediate\", \"description\": \"Vio operon ABDE(each preceded by their own ribosome binding site) with a terminator\", \"info\": \"vio operon ABDE(each preceded by their own ribosome binding site) with \"}, {\"id\": \"BBa_K539461\", \"type\": \"Composite\", \"description\": \"promoter (lacI regulated)+RNA thermometer+vioD with RNA thermometer+tetR+double terminator\", \"info\": \"Vio operon is a spontaneous cascade pathway which the initial compound, L-tryptophane is\"}, {\"id\": \"BBa_K539691\", \"type\": \"Composite\", \"description\": \"promoter(lacI regulated)+Alss+ilvC+ilvD(each preceded by own RBS)and RNA thermometer+terminator\", \"info\": \"traditional genetic engineering method, we use strong promoter to initiate our genes, but this way E.coli will overex\"}, {\"id\": \"BBa_K539732\", \"type\": \"Composite\", \"description\": \"kivd (alpha-ketoisovalerate decarboxylase) with native rbs(BBa_B0030) and terminator\", \"info\": \"kivd encodes alpha-ketoisovalerate decarboxylase which is responsible for\"}, {\"id\": \"BBa_K539733\", \"type\": \"Composite\", \"description\": \"kivd (alpha-ketoisovalerate decarboxylase) with native rbs(BBa_B0034) and terminator\", \"info\": \"this is the coding sequence of kivd from lactococcus lactis subsp \"}, {\"id\": \"BBa_K539741\", \"type\": \"Composite\", \"description\": \"TetR repressible promoter (BBa_R0040)+ kivd (alpha-ketoisovalerate decarboxylase)+Ter (BBa_J61048)\", \"info\": \"kivd encodes alpha-ketoisovalerate decarboxylase which is responsible for\"}, {\"id\": \"BBa_K539742\", \"type\": \"Composite\", \"description\": \"TetR repressible promoter (BBa_R0040)+ kivd (alpha-ketoisovalerate decarboxylase)+Ter (BBa_B0015)\", \"info\": \"in traditional genetic engineering method, we use strong promoter to initiate our genes, but this way E.coli will over\"}, {\"id\": \"BBa_K541029\", \"type\": \"Composite\", \"description\": \"Reflectin 1A (TAT-IPTG inducable) and LALF (TAT-IPTG inducable) protein for E.coli\", \"info\": \"reflectin is a self-assembling protein that has the ability to reflect the sun light . lps\"}, {\"id\": \"BBa_K541715\", \"type\": \"Plasmid\", \"description\": \"Multi-host vector pTG262 converted to BioBrick vector wtih LALF protein and SacB signal peptide\", \"info\": \"multi-host vector pTG262 converted to BioBrick vector wtih LALF protein and\"}, {\"id\": \"BBa_K541800\", \"type\": \"Plasmid\", \"description\": \"B.subtilis and E.coli Episomal Shuttle Vector with Consitutive RFP to express in E.coli\", \"info\": \"this episomal vector has within its BioBrick region a constitutively expressed RFP gene in E.\"}, {\"id\": \"BBa_K541915\", \"type\": \"Plasmid\", \"description\": \"Multi-host vector pTG262 converted to BioBrick vector wtih LALF protein and SacB signal peptide\", \"info\": \"multi-host vector pTG262 converted to BioBrick vector wtih LALF protein and\"}, {\"id\": \"BBa_K541925\", \"type\": \"Plasmid\", \"description\": \"Multi-host vector pTG262 converted to BioBrick vector wtih LALF protein and LipA signal peptide\", \"info\": \"multi-host vector pTG262 converted to BioBrick vector wtih LALF protein and\"}, {\"id\": \"BBa_K542008\", \"type\": \"Device\", \"description\": \"pLacI Regulated Lumazine Synthase and pBAD Inverse-Regulated Arg-tagged ECFP and EYFP\", \"info\": \"the purpose of the microcompartment device is to specifically target proteins that have been tagged with a positively charged\"}, {\"id\": \"BBa_K542012\", \"type\": \"Intermediate\", \"description\": \"Catechol 2,3-dioxygenase with a C-terminal Arg-tag and Double Terminator (no promoter/RBS)\", \"info\": \"Catechol 2,3-dioxygenase with a C-terminal Arg-tag\"}, {\"id\": \"BBa_K546001\", \"type\": \"Composite\", \"description\": \"Lux pL controlled luxR with lux pR controlled AHL degrading enzyme AiiA(lva tag). \", \"info\": \"Lux pL controlled luxR with lux pR controlled aiiA(lva tag\"}, {\"id\": \"BBa_K546005\", \"type\": \"Composite\", \"description\": \"Lux pL controlled LuxR + lux pR autoinducing LuxI (lva tag) + lux pR controlled GFP(lva tag).\", \"info\": \"this device has three protein generators: lux pl-RBS-C0062-B0015 produces Lux\"}, {\"id\": \"BBa_K557000\", \"type\": \"Coding\", \"description\": \"CheZ%3A phosphatase which dephosphorylates CheY-P and thus plays an important role in E.Coli chemotaxi\", \"info\": \"CheZ is a phosphatase which dephosphorylates CheY-P and causes the flagell\"}, {\"id\": \"BBa_K557001\", \"type\": \"Translational_Unit\", \"description\": \"Aptamer-CheZ%3A theophylline-sensitive synthetic riboswitch+phosphatase which dephosphorylates CheY-P\", \"info\": \"theophylline-sensitive synthetic riboswitch+phosphatase which dephosphorylates\"}, {\"id\": \"BBa_K563010\", \"type\": \"Coding\", \"description\": \"Tor2 gene from the genome of the S. cerevisiae, central protein in TOR(target of rapamycin) pathway\", \"info\": \"Tor2 gene from the genome of the S. cerevisiae, central protein in TOR(target of\"}, {\"id\": \"BBa_K563053\", \"type\": \"Plasmid_Backbone\", \"description\": \"vector pYE, designed for inducible expression of recombinant proteins in S.cerevisivae.\", \"info\": \"pYES2 is a 5.9 kb vector for inducible expression of recombin\"}, {\"id\": \"BBa_K568004\", \"type\": \"Composite\", \"description\": \"Optogenetical AND-Gate blue light - without first promoter - choose your first input\", \"info\": \"part of an AND-gate where one can choose the first promoter which controls supDtRNA .\"}, {\"id\": \"BBa_K575024\", \"type\": \"Composite\", \"description\": \"LasR/PAI1 Inducible Promoter + RBS (B0030) + GFP, Constitutive Promoter + RBS (B0030) + LasR\", \"info\": \"BBa_K575024 was developed as part of a Pseudomonas \"}, {\"id\": \"BBa_K575025\", \"type\": \"Composite\", \"description\": \"LasR/PAI1 Inducible Promoter + RBS (B0030) + GFP, Constitutive Promoter + RBS (B0034) + LasR\", \"info\": \"this construct contains a LasR/PaI1 (3-oxo-c12-HSL)\"}, {\"id\": \"BBa_K575026\", \"type\": \"Composite\", \"description\": \"LasR/PAI1 Inducible Promoter + RBS (B0030) + RFP, Constitutive Promoter + RBS (B0030) + LasR%09\", \"info\": \"this construct contains a LasR/PAI1 (3-oxo-C12-HSL) in\"}, {\"id\": \"BBa_K575027\", \"type\": \"Composite\", \"description\": \"LasR/PAI1 Inducible Promoter + RBS (B0030) + RFP, Constitutive Promoter + RBS (B0034) + LasR%09\", \"info\": \"this construct contains a LasR/PAI1 (3-oxo-c12-HSL) in\"}, {\"id\": \"BBa_K575028\", \"type\": \"Composite\", \"description\": \"LasR/PAI1 Inducible Promoter + RBS (B0034) + GFP, Constitutive Promoter + RBS (B0030) + LasR%09\", \"info\": \"this construct is designed to report the presence of PAI1, part of the pseudomonas\"}, {\"id\": \"BBa_K575029\", \"type\": \"Composite\", \"description\": \"LasR/PAI1 Inducible Promoter + RBS (B0034) + GFP, Constitutive Promoter + RBS (B0034) + LasR%09\", \"info\": \"BBa K575029, which is LasR (with RBS B0034), coupled with a\"}, {\"id\": \"BBa_K575030\", \"type\": \"Composite\", \"description\": \"LasR/PAI1 Inducible Promoter + RBS (B0034) + RFP, Constitutive Promoter + RBS (B0030) + LasR%09\", \"info\": \"LasR/PAI1 Inducible Promoter + RBS (B0034) + RFP, constitu\"}, {\"id\": \"BBa_K575031\", \"type\": \"Composite\", \"description\": \"LasR/PAI1 Inducible Promoter + RBS (B0034) + RFP, Constitutive Promoter + RBS (B0034) + LasR%09\", \"info\": \"LasR/PAI1 Inducible Promoter + RBS (B0034) + RFP, constitu\"}, {\"id\": \"BBa_K575032\", \"type\": \"Composite\", \"description\": \"RhlR/PAI2 Inducible Promoter + RBS (B0030) + GFP + Constitutive Promoter + RBS (B0030) + RhlR\", \"info\": \"this construct was developed by Northwestern's 2011 iGEM team . it is designed to fluoresce with\"}, {\"id\": \"BBa_K575033\", \"type\": \"Composite\", \"description\": \"RhlR/PAI2 Inducible Promoter + RBS (B0030) + GFP + Constitutive Promoter + RBS (B0034) + RhlR\", \"info\": \"this construct was developed by Northwestern's 2011 iGEM team . it is designed to fluoresce with\"}, {\"id\": \"BBa_K575034\", \"type\": \"Composite\", \"description\": \"RhlR/PAI2 Inducible Promoter + RBS (B0030) + RFP + Constitutive Promoter + RBS (B0030) + RhlR\", \"info\": \"RhlR/PAI2 inducible promoter + RBS (B0030) + RFP +\"}, {\"id\": \"BBa_K575035\", \"type\": \"Composite\", \"description\": \"RhlR/PAI2 Inducible Promoter + RBS (B0030) + RFP + Constitutive Promoter + RBS (B0034) + RhlR\", \"info\": \"RhlR/PAI2 inducible promoter + RBS (B0030) + RFP +\"}, {\"id\": \"BBa_K575036\", \"type\": \"Composite\", \"description\": \"RhlR/PAI2 Inducible Promoter + RBS (B0034) + GFP + Constitutive Promoter + RBS (B0030) + RhlR\", \"info\": \"this construct is designed to report the presence of PAI2, part of the pseudomonas\"}, {\"id\": \"BBa_K575037\", \"type\": \"Composite\", \"description\": \"RhlR/PAI2 Inducible Promoter + RBS (B0034) + GFP + Constitutive Promoter + RBS (B0034) + RhlR\", \"info\": \"this construct is designed to report the presence of PAI2, part of the pseudomonas\"}, {\"id\": \"BBa_K575038\", \"type\": \"Composite\", \"description\": \"RhlR/PAI2 Inducible Promoter + RBS (B0034) + RFP + Constitutive Promoter + RBS (B0030) + RhlR\", \"info\": \"RhlR/PAI2 inducible promoter + RBS (B0034) + RFP +\"}, {\"id\": \"BBa_K575039\", \"type\": \"Composite\", \"description\": \"RhlR/PAI2 Inducible Promoter + RBS (B0034) + RFP + Constitutive Promoter + RBS (B0034) + RhlR\", \"info\": \"RhlR/PAI2 inducible promoter + RBS (B0034) + RFP +\"}, {\"id\": \"BBa_K575044\", \"type\": \"Composite\", \"description\": \"Genomic LasR/PAI1 Inducible Promoter + RBS (B0034) + GFP, Cons. Promoter + RBS (B0030) + LasR\", \"info\": \"this construct contains a LasR/PAI1 (3-oxo-c12-HSL) in\"}, {\"id\": \"BBa_K575045\", \"type\": \"Composite\", \"description\": \"Genomic LasR/PAI1 Inducible Promoter + RBS (B0034) + GFP, Cons. Promoter + RBS (B0030) + LasR\", \"info\": \"this construct contains a LasR/PAI1 (3-oxo-c12-HSL) in\"}, {\"id\": \"BBa_K575046\", \"type\": \"Composite\", \"description\": \"Genomic RhlR/PAI2 Inducible Promoter + RBS (B0034) + GFP, Cons. Promoter + RBS (B0034) + RhlR\", \"info\": \"this construct was developed by Northwestern's 2011 iGEM team . it is designed to fluoresce with\"}, {\"id\": \"BBa_K575047\", \"type\": \"Composite\", \"description\": \"Genomic RhlR/PAI2 Inducible Promoter + RBS (B0030) + GFP, Cons. Promoter + RBS (B0034) + RhlR\", \"info\": \"this construct is designed to report the presence of PAI2, part of the Pseudomonas \"}, {\"id\": \"BBa_K582000\", \"type\": \"DNA\", \"description\": \"500bp of Spacer/Repeat Region of the CRISPR genome present in Strep. thermophilus LMD9 strain\", \"info\": \"500bp of the spacer/repeat region of the CRISPR genome present in streptoc\"}, {\"id\": \"BBa_K594011\", \"type\": \"Composite\", \"description\": \"A device that can accepts the 3--O-C6-HSL and then produces 3-O-C12-HSL and ECFP reporter. \", \"info\": \"3-O-C6-HSL and ECFP reporter can be produced from a device of function .\"}, {\"id\": \"BBa_K594014\", \"type\": \"Composite\", \"description\": \"A device that can accepts the 3--OH-C14%3A1-HSL and then produces 3-O-C6-HSL and GFP reporter.\", \"info\": \"device that can accepts the 3--OH-C14:1-HSL and then produces 3-O-C\"}, {\"id\": \"BBa_K598015\", \"type\": \"Device\", \"description\": \"T7-promoter+TPP Up-regulated Hammerhead Ribozyme 1.20 with Native RBS+GFP+T7-terminator\", \"info\": \"T7 promoter, thiamine pyrophosphate (TPP) ligand responsive hammer\"}, {\"id\": \"BBa_K598016\", \"type\": \"Device\", \"description\": \"T7-promoter+TPP Down-regulated Hammerhead Ribozyme 2.5 with Native RBS+GFP+T7-terminator\", \"info\": \"this device can respond to different TPP concentration and inhibit gene expression when induced by 1mM IPTG sensitively\"}, {\"id\": \"BBa_K598020\", \"type\": \"Device\", \"description\": \"B0015+pBAD+vioAB+B0015+pBAD+TPP Up-regulated Hammerhead Ribozyme 1.20+vioD+B0015+pBAD+vioE\", \"info\": \"violacein and its precursors have notable antibacterial, antiviral, antiparasite and medical applications \"}, {\"id\": \"BBa_K598023\", \"type\": \"Device\", \"description\": \"Bistable Switch with TPP Up-regulated Hammerhead Ribozyme 1.20 Regulating CI434 Expression\", \"info\": \"TPP ribozyme TPP-1.20 affects the green-red ratio of bistable switch by\"}, {\"id\": \"BBa_K598024\", \"type\": \"Device\", \"description\": \"Bistable Switch with TPP Down-regulated Hammerhead Ribozyme 2.5 Regulating CI434 Expression\", \"info\": \"TPP ribozyme TPP-2.5 affects the green-red ratio of bistable switch by \"}, {\"id\": \"BBa_K598025\", \"type\": \"Device\", \"description\": \"Bistable Switch with TPP Hammerhead  Ribozyme 2.5  and Theophyline Riboswitch N8-3\", \"info\": \"TPP ribozyme TPP 2.5 and Theophyline Riboswitch N8-3\"}, {\"id\": \"BBa_K608000\", \"type\": \"Intermediate\", \"description\": \"Second of two required phycocyanobilin biosynthetic genes combined with a terminator\", \"info\": \"second of two required phycocyanobilin biosynthetic genes combined with a terminator \"}, {\"id\": \"BBa_K608001\", \"type\": \"Intermediate\", \"description\": \"First of two requisite genes required for the biosynthesis of phycocyanobilin from heme combined wit\", \"info\": \"first of two requisite genes required for the biosynthesis of phycocyanobilin from heme combined\"}, {\"id\": \"BBa_K611099\", \"type\": \"Intermediate\", \"description\": \"Truncated LVA (5%27 -11bp) Tag with Double Stop Codon and Truncated Barcode (3%27 -8bp)\", \"info\": \"this is a truncated version of the LVA Degradation Tag-TAATAA Double Stop\"}, {\"id\": \"BBa_K611100\", \"type\": \"Intermediate\", \"description\": \"Truncated LVA (5%27 -22bp) Tag with Double Stop Codon and Truncated Barcode (3%27 -8bp)\", \"info\": \"this is a truncated version of the LVA Degradation Tag-TAATAA Double Stop\"}, {\"id\": \"BBa_K611101\", \"type\": \"Intermediate\", \"description\": \"Truncated LVA (5%27 -11bp) Tag with Double Stop Codon and Truncated Barcode (3%27 -16bp)\", \"info\": \"this is a truncated version of the LVA Degradation Tag-TAATAA Double Stop\"}, {\"id\": \"BBa_K611102\", \"type\": \"Intermediate\", \"description\": \"Truncated LVA (5%27 -22bp) Tag with Double Stop Codon and Truncated Barcode (3%27 -16bp)\", \"info\": \"this is a truncated version of the LVA Degradation Tag-TAATAA Double Stop\"}, {\"id\": \"BBa_K624027\", \"type\": \"Plasmid\", \"description\": \"pYMB (shuttle vector between Escherichia coli and Magnetospirillum magneticum AMB-1)\", \"info\": \"pYMB (shuttle vector between e. coli and magnetospirillum magneticum \"}, {\"id\": \"BBa_K624028\", \"type\": \"Regulatory\", \"description\": \"pYMB+rbs (Pmsp3) (expression vector essentials on Magnetospirillum magneticum AMB-1)\", \"info\": \"pYMB+rbs (pmsp3) is an expression vector used in AMB-1 \"}, {\"id\": \"BBa_K624029\", \"type\": \"Regulatory\", \"description\": \"pYMB+rbs (Pmsp3, 6 bps trunc.) (expression vector essentials on Magnetospirillum magneticum AMB-1)\", \"info\": \"pYMB+rbs (Pmsp3, 6 bps trunc.) is\"}, {\"id\": \"BBa_K627011\", \"type\": \"Device\", \"description\": \"Fusion part of pBAD arabinose-inducible induction system and the HRV 14_3C protease\", \"info\": \"this BioBrick is a 2 part fusion of arabinose-inducible induction system and the\"}, {\"id\": \"BBa_K629005\", \"type\": \"Coding\", \"description\": \"trkD, a functional Kup (formerly TrkD) system took up Cs+ with a moderate rate and affinity\", \"info\": \"trkD, a functional Kup (formerly TrkD) system took up Cs+ with\"}, {\"id\": \"BBa_K633014\", \"type\": \"Composite\", \"description\": \"AraC+Pbad promoter+RBS+signal peptide phoA+Cellulase+Linker+estA membrane protein\", \"info\": \"the construct includes a functional expression device for autotransporter membrane protein estA, with a linker united to\"}, {\"id\": \"BBa_K646008\", \"type\": \"Composite\", \"description\": \"T7 promoter with Heme oxygenase and Agrobacterium tumefaciens bacteriophytochrome\", \"info\": \"bacteriophytochrome gene produces a protein that interacts with Biliverdin, a \"}, {\"id\": \"BBa_K733001\", \"type\": \"Regulatory\", \"description\": \"%3Ci%3EPtms%3C/i%3E - a constitutive promoter in %3Ci%3EE. coli%3C/i%3E and %3Ci%3EB. subtilis%3C/i%3E.\", \"info\": \"Ptms is a constitutive promoter that can be recognized by SigA factor in B. subtil\"}, {\"id\": \"BBa_K733002\", \"type\": \"Regulatory\", \"description\": \"%3Ci%3ExylR%3C/i%3E+%3Ci%3EPxylA%3C/i%3E%3A A xylose inducible promoter with its transcriptional regulator.\", \"info\": \"the xylose inducible promoter used to construct this part is amplified from the integration plasm\"}, {\"id\": \"BBa_K733007\", \"type\": \"Composite\", \"description\": \"%3Ci%3EPveg%3C/i%3E + spoVG RBS + %3Ci%3ElytC%3C/i%3E + linker + RPMrel + consensus RBS + GFP + double terminator\", \"info\": \"project seeks to design recombinant bacteria that specifically target and suppress the growth of colorectal carcinoma\"}, {\"id\": \"BBa_K733012\", \"type\": \"Composite\", \"description\": \"%3Ci%3ExylR%3C/i%3E+%3Ci%3EPxylA%3C/i%3E+RBS+%3Ci%3EydcE%3C/i%3E+%3Ci%3EPtms%3C/i%3E+RBS+%3Ci%3EydcD%3C/i%3E%3A Cell Growth Inhibition Device\", \"info\": \"ptms+RBS+ydcD is for the stabilization of the cell growth inhibition system\"}, {\"id\": \"BBa_K737000\", \"type\": \"Coding\", \"description\": \"We got this part from the mutant of E.coli strain K12, DH5%26%23945%3B,using PCR with the primers we desig\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_K737001\", \"type\": \"Coding\", \"description\": \"We got this part from the mutant of E.coli strain K12, DH5%26%23945%3B,using PCR with the primers we desig\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_K737048\", \"type\": \"RNA\", \"description\": \"The leading sequence involved in the nanC transcript which can act as the target of the sRNA, spot42\", \"info\": \"leading sequence involved in the nanC transcript which can act as the target of the sRNA, spot42\"}, {\"id\": \"BBa_K737049\", \"type\": \"RNA\", \"description\": \"The leading sequence involved in the YtfJ transcript which can act as the target of the sRNA, spot42\", \"info\": \"leading sequence involved in the YtfJ transcript which can act as the target of the sRNA, spot\"}, {\"id\": \"BBa_K737050\", \"type\": \"RNA\", \"description\": \"The leading sequence involved in the SrlA transcript which can act as the target of the sRNA, spot42\", \"info\": \"leading sequence involved in the SrlA transcript which can act as the target of the sRNA, spot42\"}, {\"id\": \"BBa_K737057\", \"type\": \"RNA\", \"description\": \"Spot42 have a weak Hfq binding site(whereas galK weaker),an endogenous terminator(unclear efficiency\", \"info\": \"spot42 have a weak Hfq binding site(whereas galK weaker),an endogenous terminator\"}, {\"id\": \"BBa_K737058\", \"type\": \"RNA\", \"description\": \"Spot42 is a multitarget small RNA that mediates the discoordinate expression of the E.coli galactose\", \"info\": \"Spot42 is a multitarget small RNA that mediates the discoordinate expression of the E.coli\"}, {\"id\": \"BBa_K737070\", \"type\": \"Coding\", \"description\": \"phoR, a histine kinase coding gene involved in phoBR regulon, is the regulatory protein that could a\", \"info\": \"phoR, a histine kinase coding gene involved in phoBR regulon\"}, {\"id\": \"BBa_K737071\", \"type\": \"Coding\", \"description\": \"phoR, a histine kinase coding gene involved in phoBR regulon, is the regulatory protein that could a\", \"info\": \"phoR, a histine kinase coding gene involved in phoBR regulon\"}, {\"id\": \"BBa_K748000\", \"type\": \"Coding\", \"description\": \"AgrA protein coding sequence. AgrA is the main component of S.aureus agr quorum sensing system.\", \"info\": \"AgrA is the transcriptional component of a quorum sensing system in s.aureus\"}, {\"id\": \"BBa_K748001\", \"type\": \"Coding\", \"description\": \"AgrC protein coding sequence. AgrC is main component of S.aureus agr quorum sensing system.\", \"info\": \"AgrC is main component of S.aureus agr quorum sensing system .\"}, {\"id\": \"BBa_K748002\", \"type\": \"Coding\", \"description\": \"Truncated lysostaphin coding sequence. Lysostaphin has has a specific lytic action against S.aureus.\", \"info\": \"lysostaphin is a zinc metalloenzyme that has a specific lytic action\"}, {\"id\": \"BBa_K748006\", \"type\": \"Composite\", \"description\": \"S.aureus killing device. Truncated lysostaphin coding sequence with IPTG inducible promoter.\", \"info\": \"lysostaphin is a zinc metalloenzyme that has a specific lytic action\"}, {\"id\": \"BBa_K749023\", \"type\": \"Reporter\", \"description\": \" consecutively produces PFDH, formaldehyde dehydrogenase from Pseudomonas putida \", \"info\": \"consecutively produces PFDH, formaldehyde dehydrogenase from pseu\"}, {\"id\": \"BBa_K749024\", \"type\": \"Generator\", \"description\": \" consecutively produces PFDH, formaldehyde dehydrogenase from Pseudomonas putida \", \"info\": \"consecutively produces PFDH, formaldehyde dehydrogenase from pseu\"}, {\"id\": \"BBa_K750008\", \"type\": \"Signalling\", \"description\": \"Quorum sensing system based on LuxI and LuxR to control the expression of parts behind\", \"info\": \"based on LuxI and LuxR to control the expression of parts behind . Activated by arabinose\"}, {\"id\": \"BBa_K750104\", \"type\": \"Signalling\", \"description\": \"pBADcIT-1.0%3AcI protein expression system activated by arabinose(RBS strength%3A1.0)\", \"info\": \"pBADcIT-1.0:cI protein expression system activated by arabinose(RBS strength\"}, {\"id\": \"BBa_K750105\", \"type\": \"Signalling\", \"description\": \"pBADcIT-0.6%3AcI protein expression system activated by arabinose(RBS strength%3A0.6)\", \"info\": \"this part contains promoter pBAD, RBS of 0.6 strength, cI(lva)\"}, {\"id\": \"BBa_K750106\", \"type\": \"Signalling\", \"description\": \"pBADcIT-0.3%3AcI protein expression system activated by arabinose(RBS strength%3A0.3)\", \"info\": \"this part contains promoter pBAD, RBS of 0.3 strength, cI(lva)\"}, {\"id\": \"BBa_K750107\", \"type\": \"Signalling\", \"description\": \"pBADcIT-0.07%3AcI protein expression system activated by arabinose(RBS strength%3A0.07)\", \"info\": \"pBADcIT-0.07:cI protein expression system activated by arabinose (RBS\"}, {\"id\": \"BBa_K750108\", \"type\": \"Signalling\", \"description\": \"PcIGLT-pBADGLT%3AGFP(lva) expression system controlled by cI protein or arabinose\", \"info\": \"PcIGLT-pBADGLT:GFP(lva) expression system controlled by cI protein\"}, {\"id\": \"BBa_K750115\", \"type\": \"Signalling\", \"description\": \"pBADcIT-PtetcIT-PcIGLT%3A arabinose or atc-%3EcI protein-%3Ereduction of gfp(lva)\", \"info\": \"Adding arabinose or atc can repress the expression of GFP from PcIGLT .\"}, {\"id\": \"BBa_K758000\", \"type\": \"Regulatory\", \"description\": \"UAS , this is the enhancer . And  this enhancer is used  to identify the protein localization . \", \"info\": \"enhancer is used to identify the protein localization . we think this enhancer can be used to study the human\"}, {\"id\": \"BBa_K769003\", \"type\": \"Device\", \"description\": \"Pconst.(High)-RBS-NpSRII-9a.a.linker_NpHtrII-EnvZ-Double terminator-PompR-RBS-GFP-Double terminator\", \"info\": \"when SRII receives blue light, EnvZ maybe phosphorylate OmpR . Phos\"}, {\"id\": \"BBa_K774004\", \"type\": \"Reporter\", \"description\": \"Bacterial-Mammalian promoter with eCFP reporter%3A BBaK216005 + CArG promoter sequence + BBa_E0420 \", \"info\": \"hybrid promoter combines the bacterial promoter PyeaR and the mammalian CArG element\"}, {\"id\": \"BBa_K774005\", \"type\": \"Reporter\", \"description\": \"Bacterial-Mammalian promoter with RFP reporter%3A BBaK216005 + BHN + CArG promoter sequence E9-ns2 + B\", \"info\": \"hybrid promoter combines bacterial promoter PyeaR and mammalian CArG element .\"}, {\"id\": \"BBa_K774006\", \"type\": \"Reporter\", \"description\": \"Mammalian-Bacterial promoter with eCFP reporter%3A CArG promoter sequence + BBaK216005 + BBa_E0420\", \"info\": \"the hybrid promoter combines the bacterial promoter PyeaR and the mammalian CArG\"}, {\"id\": \"BBa_K774007\", \"type\": \"Reporter\", \"description\": \"Mammalian-Bacterial promoter with RFP reporter%3A CArG promoter sequence + BBaK216005 + BBa_K08101\", \"info\": \"hybrid promoter combines the bacterial promoter PyeaR and the mammalian CArG element\"}, {\"id\": \"BBa_K774102\", \"type\": \"Project\", \"description\": \"Multi sensor - for calculation of specific concentrations of nitrates nitrites and nitric oxide usin\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_K774103\", \"type\": \"Project\", \"description\": \"Multi sensor - for calculation of specific concentrations of nitrates nitrites and nitric oxide \", \"info\": \"multi-sensor system is based on the idea that there are broad spectrum (non-specific) promoters\"}, {\"id\": \"BBa_K779120\", \"type\": \"RNA\", \"description\": \"RNA Reporter top strand with quencher (RQ) and tag fluorophore (Alexa 488) MammoBlock\", \"info\": \"BBa_K779120 has an unquenched Alexa 488 fluorophore \"}, {\"id\": \"BBa_K782043\", \"type\": \"Composite\", \"description\": \"EcoRI/BamHI equivalent multicloning site for insertion of non standardized parts to BioBrick vectors\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K782044\", \"type\": \"Composite\", \"description\": \"EcoRI/XbaI equivalent multicloning site for insertion of non standardized parts to BioBrick vectors\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K782045\", \"type\": \"Composite\", \"description\": \"EcoRI/SacI equivalent multicloning site for insertion of non standardized parts to BioBrick vectors\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K782046\", \"type\": \"Composite\", \"description\": \"HindIII/BamHI equivalent multicloning site for insertion of non standardized parts to BioBrick vecto\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K782047\", \"type\": \"Composite\", \"description\": \"HindIII/XbaI equivalent multicloning site for insertion of non standardized parts to BioBrick vector\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K782048\", \"type\": \"Composite\", \"description\": \"HindIII/XhoI equivalent multicloning site for insertion of non standardized parts to BioBrick vector\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K782049\", \"type\": \"Composite\", \"description\": \"HindIII/SacI equivalent multicloning site for insertion of non standardized parts to BioBrick vector\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K782050\", \"type\": \"Composite\", \"description\": \"BamHI/XbaI equivalent multicloning site for insertion of non standardized parts to BioBrick vectors\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K782051\", \"type\": \"Composite\", \"description\": \"BamHI/XhoI equivalent multicloning site for insertion of non standardized parts to BioBrick vectors\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K782052\", \"type\": \"Composite\", \"description\": \"BamHI/SacI equivalent multicloning site for insertion of non standardized parts to BioBrick vectors\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K782053\", \"type\": \"Composite\", \"description\": \"XbaI/BamHI equivalent multicloning site for insertion of non standardized parts to BioBrick vectors\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K782054\", \"type\": \"Composite\", \"description\": \"XbaI/XhoI equivalent multicloning site for insertion of non standardized parts to BioBrick vectors\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K782055\", \"type\": \"Composite\", \"description\": \"XbaI/SacI equivalent multicloning site for insertion of non standardized parts to BioBrick vectors\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K782056\", \"type\": \"Composite\", \"description\": \"SacI/BamHI equivalent multicloning site for insertion of non standardized parts to BioBrick vectors\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K782057\", \"type\": \"Composite\", \"description\": \"SacI/SpeI equivalent multicloning site for insertion of non standardized parts to BioBrick vectors\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K782058\", \"type\": \"Composite\", \"description\": \"SacI/XhoI equivalent multicloning site for insertion of non standardized parts to BioBrick vectors\", \"info\": \"iGEM HQ has designed a new system for cloning of genes with non-standard restriction\"}, {\"id\": \"BBa_K801030\", \"type\": \"Tag\", \"description\": \"Polypeptide containing SV40 nuclear localization sequence (SV40 NLS) for nuclear translocation\", \"info\": \"this part was designed by hybridization of oligonucleotides based on the plasmid\"}, {\"id\": \"BBa_K801039\", \"type\": \"Coding\", \"description\": \"SV40NLS-GAL4AD-linker-PIF3 (part for GAL4/LexA based light-switchable promoter system)\", \"info\": \"this part is the second component of a GAL4/LexA based yeast light-switch\"}, {\"id\": \"BBa_K801040\", \"type\": \"Coding\", \"description\": \"SV40NLS-PhyB-linker-Gal4DBD (part for GAL4 based light switchable promoter system)\", \"info\": \"one part of this fusion protein codes for the first of two components of a GAL4 based light-\"}, {\"id\": \"BBa_K801041\", \"type\": \"Composite\", \"description\": \"SV40NLS-PhyB-linker-LexA (part for a LexA based light-switchable promoter system)\", \"info\": \"one part of this fusion protein codes for the first of two components of a LexA based light-s\"}, {\"id\": \"BBa_K802002\", \"type\": \"Reporter\", \"description\": \"P%3Csub%3Elac%3C/sub%3E(%3Ci%3EB. subtilis%3C/i%3E)-RBS(%3Ci%3EE. coli%3C/i%3E)-GFP\", \"info\": \"Plac(B. subtilis)-RBS(E. coli)-GFP This part has been\"}, {\"id\": \"BBa_K806003\", \"type\": \"Coding\", \"description\": \"SeqA regulation of chromosome replication by preventing re-initiation at newly replicated origins\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_K807002\", \"type\": \"Coding\", \"description\": \"LEV%3A LexA DNA Binding Domain - Human Estrogen Receptor - VP16 Activating Domain\", \"info\": \"this part is a synthetic transcriptional activator with specificity for the LexA operator site . it is in\"}, {\"id\": \"BBa_K808001\", \"type\": \"Coding\", \"description\": \"tphC%3A terephtalate periplasmatic binding proteine of the tripartite transporter family\", \"info\": \"tphC_322 belongs to the tripartite tricarboxylate transporter family\"}, {\"id\": \"BBa_K808002\", \"type\": \"Coding\", \"description\": \"tctA_503%3A large subunit A1 of the tripartite tricarboxylate transporter family \", \"info\": \"tctA_503 is a large subunit of the tripartite tricarbox\"}, {\"id\": \"BBa_K808033\", \"type\": \"Composite\", \"description\": \"araC-Pbad regulated XylE - catechol 2,3-dioxygenase from P.putida with terminator\", \"info\": \"araC-Pbad regulated XylE - catechol 2,3-dioxygen\"}, {\"id\": \"BBa_K808034\", \"type\": \"Composite\", \"description\": \"araC-Pbad regulated terephtalate periplasmatic binding proteine of the tripartite transporter family\", \"info\": \"araC-Pbad regulated terephtalate periplasmatic binding proteine of the\"}, {\"id\": \"BBa_K812012\", \"type\": \"Device\", \"description\": \"OsTirI Ubiquitinase E3 for AID tagged protein degradation in the presence of auxin\", \"info\": \"OsTirI is an ubuquitinase E3 that recognizes AID-\"}, {\"id\": \"BBa_K812020\", \"type\": \"Coding\", \"description\": \"Eukaryotic PoPs -%3E IaaH. Indoleacetamide hydrolyase for Auxin generator, with kozak\", \"info\": \"this part contains the coding sequence for Indoleacetamide hydrolyase (iaah)\"}, {\"id\": \"BBa_K812021\", \"type\": \"Coding\", \"description\": \"Eukaryotic PoPs -%3E IaaM. Indoleacetamide monooxygenase for Auxin generator, with kozak\", \"info\": \"this part contains the coding sequence for Indoleacetamide monooxygenase (iaaM\"}, {\"id\": \"BBa_K812110\", \"type\": \"Device\", \"description\": \" GFP fusion with the ubuquitinase E3 OsTirI recoginition domain for PSC2+ plasmid\", \"info\": \"this part is a super folded GFP fused to an AID tag for its recignition by the \"}, {\"id\": \"BBa_K818300\", \"type\": \"Regulatory\", \"description\": \"Promoter alsT, repressed by TnrA during conversion of NH4 to Glutamine in B. subtilis.\", \"info\": \"alsT is a promoter in B. subtilis repressed by TnrA . Tn\"}, {\"id\": \"BBa_K823001\", \"type\": \"Regulatory\", \"description\": \"P%3Csub%3E%3Ci%3EliaI%3C/i%3E%3C/sub%3E promoter of %3Ci%3EBacillus subtilis%3C/i%3E\", \"info\": \"the promoter of the liaHI operon of B. subtilis PliaI has a\"}, {\"id\": \"BBa_K823021\", \"type\": \"Plasmid_Backbone\", \"description\": \"pSB%3Csub%3EBs%3C/sub%3E1C-%3Ci%3ElacZ%3C/i%3E (lacZ reporter vector for %3Ci%3EB. subtilis%3C/i%3E)\", \"info\": \"pSBBs1C-lacZ is a reporter vector for bacillus subtilis .\"}, {\"id\": \"BBa_K823022\", \"type\": \"Plasmid_Backbone\", \"description\": \"pSB%3Csub%3EBs%3C/sub%3E4S%3A Empty backbone for integration into %3Ci/%3EBacillus subtilis thrC%3C/i%3E locus\", \"info\": \"pSBBs4S is an empty backbone vector for the usage in Bacillus subtilis .\"}, {\"id\": \"BBa_K823023\", \"type\": \"Plasmid_Backbone\", \"description\": \"pSB%3Csub%3EBs%3C/sub%3E1C%3A Empty backbone for integration into %3Ci%3EBacillus subtilis%3C/i%3E %3Ci%3EamyE%3C/i%3E locus\", \"info\": \"pSBBs1C is an empty backbone vector for the usage in Bacillus subtilis .\"}, {\"id\": \"BBa_K823024\", \"type\": \"Plasmid_Backbone\", \"description\": \"pSB%3Csub%3EBs%3C/sub%3E4S-P%3Ci%3E%3Csub%3Exyl%3C/i%3E%3C/sub%3E%3A Integrative expression vector for %3Ci%3EBacillus subtilis%3C/i\", \"info\": \"pSBBs4S-Pxyl is an expression vector for Bacillus subtilis .\"}, {\"id\": \"BBa_K823025\", \"type\": \"Plasmid_Backbone\", \"description\": \"pSB%3Csub%3EBs%3C/sub%3E3C-%3Ci%3EluxABCDE%3C/i%3E (lux reporter vector for B.subtilis)\", \"info\": \"pSBBs3C-luxABCDE is a reporter vector for B. subtilis .\"}, {\"id\": \"BBa_K823026\", \"type\": \"Plasmid_Backbone\", \"description\": \"pSB%3Csub%3EBs%3C/sub%3E0K-P%3Csub%3Espac%3C/sub%3E (replicative Bacillus subtilis expression vector%3B IPTG inducible\", \"info\": \"pSBBs0K-Pspac is a replicative expression vector for Bacillus subtilis\"}, {\"id\": \"BBa_K823027\", \"type\": \"Plasmid_Backbone\", \"description\": \"pSB%3Csub%3EBs%3C/sub%3E2E%3A Empty backbone for integration into Bacillus subtilis lacA locus\", \"info\": \"pSBBs2E is an empty backbone vector for the usage in Bacillus subtilis .\"}, {\"id\": \"BBa_K823030\", \"type\": \"Regulatory\", \"description\": \"P%3Csub%3E%3Ci%3EcotYZ%3C/i%3E%3C/sub%3E%3A %3Ci%3EB. subtilis%3C/i%3E promoter regulating expression of spore crust proteins\", \"info\": \"PcotYZ lies within cotVWXYZ gene cluster, which regulates expression of CotY\"}, {\"id\": \"BBa_K823033\", \"type\": \"Regulatory\", \"description\": \"P%3Csub%3E%3Ci%3EcotV%3C/i%3E%3C/sub%3E%3A  %3Ci%3EB. subtilis%3C/i%3E promoter regulates spore crust protein cotV\", \"info\": \"PcotV lies within cotVWXYZ gene cluster, which regulates expression of spore crust\"}, {\"id\": \"BBa_K823049\", \"type\": \"Composite\", \"description\": \"P%3Csub%3E%3Ci%3EcotYZ%3C/i%3E%3C/sub%3E - %3Ci%3EcotZ%3C/i%3E (-2aa) - %3Ci%3Egfp%3C/i%3E - Terminator\", \"info\": \"the LMU-munich 2012 team aimed to display proteins on spores for usage as Sporobe\"}, {\"id\": \"BBa_K831004\", \"type\": \"RNA\", \"description\": \"istR (inhibitor of SOS-induced toxicity by RNA) is small ncRNA of Escherichia coli K12\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_K831011\", \"type\": \"RNA\", \"description\": \"istR (inhibitor of SOS-induced toxicity by RNA) is small ncRNA of Escherichia coli K12\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_K831012\", \"type\": \"RNA\", \"description\": \"istR (inhibitor of SOS-induced toxicity by RNA) is small ncRNA of Escherichia coli K12\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_K831014\", \"type\": \"Composite\", \"description\": \"Inducible istR (inhibitor of SOS-induced toxicity by RNA) under the control of lac promoter\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the\"}, {\"id\": \"BBa_K833014\", \"type\": \"Regulatory\", \"description\": \"constitutive promoter followed by a lox site with a bidirectional  terminator and then a lox site.  \", \"info\": \"this part is a constitutive promoter followed by a lox site with a bidirectional terminator and\"}, {\"id\": \"BBa_K836001\", \"type\": \"Coding\", \"description\": \"O-acyltransferase WSD from Acinetobacter sp. (codon usage optimized for R. opacus)\", \"info\": \"this biobrick codifies for the protein DGAT (Diacylglycerol O-acy\"}, {\"id\": \"BBa_K836002\", \"type\": \"Coding\", \"description\": \"O-acyltransferase WSD from Acinetobacter sp. (codon usage optimized for R. opacus) as used\", \"info\": \"this biobrick codifies for the protein DGAT (Diacylglycerol O-acy\"}, {\"id\": \"BBa_K836004\", \"type\": \"Translational_Unit\", \"description\": \"Lysis inhibitor from Enterobacteria phage lambda (codon usage optimized for R. opacus)\", \"info\": \"this protein is the one in charge to avoid the formation of pores in the inner membrane of the bacterial cell .\"}, {\"id\": \"BBa_K836006\", \"type\": \"Translational_Unit\", \"description\": \"Lysis protein S from %09Enterobacteria phage lambda (codon usage optimized for R. opacus)\", \"info\": \"this gene codifies for a protein that makes holes in the inner membrane of the bacterial cell . a\"}, {\"id\": \"BBa_K844007\", \"type\": \"Coding\", \"description\": \"Spider Silk 1x Subunit %22F%22 (Fewest tRNA codon optimized) with Met (ATG) added\", \"info\": \"spider silk 1x subunit \\\"f\\\" optimized to use a minimal set of tRNA codons \"}, {\"id\": \"BBa_K844008\", \"type\": \"Coding\", \"description\": \"Spider Silk 1x Subunit %22B%22 (Balanced tRNA codon optimized) with Met (ATG) added\", \"info\": \"spider silk 1x subunit \\\"b\\\" optimized to use a reduced set of tRNA codons \"}, {\"id\": \"BBa_K845000\", \"type\": \"Composite\", \"description\": \"iGEM 2012 Grenoble Team proposes a new design and application to the pBAD promoter(paraBAD).\", \"info\": \"iGEM 2012 grenoble team proposes a new design and application to the pBAD\"}, {\"id\": \"BBa_K855003\", \"type\": \"Coding\", \"description\": \"coding sequence for pvdQ with histag added to the C-terminal followed by stop codon\", \"info\": \"coding sequence for pvdQ with histag added to the C-terminal followed by stop codon\"}, {\"id\": \"BBa_K855007\", \"type\": \"Intermediate\", \"description\": \"LuxR generator regulated by Lac Promoter followed plux promoter (R0062) and RBS (B0034)\", \"info\": \"LuxR generator regulated by lac promoter followed plux promoter (R0062) and RBS (B\"}, {\"id\": \"BBa_K861032\", \"type\": \"Coding\", \"description\": \" S-FadB gene for fatty acid degradation from %3Ci%3ESalmonella enterica%3C/i%3E LT2\", \"info\": \"S-FadB gene for fatty acid degradation from salmonella enterica LT2 has better degradation efficiency\"}, {\"id\": \"BBa_K861042\", \"type\": \"Coding\", \"description\": \"FadA, gene for fatty acid degradation from %3Ci%3ESalmonella enterica%3C/i%3E LT2\", \"info\": \"FadA gene in S. enterica and in E.coli have similar function . but it is shown that\"}, {\"id\": \"BBa_K863012\", \"type\": \"Coding\", \"description\": \"tthl laccase from  T. thermophilus with constitutive promoter J23100, RBS and His-tag\", \"info\": \"tthl laccase from T. thermophilus with constitutive promoter was produced . a new\"}, {\"id\": \"BBa_K863022\", \"type\": \"Coding\", \"description\": \"bhal laccase from Bacillus halodurans with constitutive promoter J23100, RBS and   HIS tag\", \"info\": \"bhal laccase from Bacillus halodurans can be characterized for allergenicity .\"}, {\"id\": \"BBa_K863102\", \"type\": \"Composite\", \"description\": \"Cellulose binding Domain of C. Fimi Exoglucanase with T7, RBS, GS-Linker (Freiburg-Standard)\", \"info\": \"CBDcex is a C-terminal domain at the end of the protein-sequence .\"}, {\"id\": \"BBa_K863110\", \"type\": \"Protein_Domain\", \"description\": \"Cellulose binding Domain from Clostridium cellulovorans cellulose binding protein\", \"info\": \"CBDclos is an N-terminal domain quite close to the start of the protein-sequence \"}, {\"id\": \"BBa_K863111\", \"type\": \"Protein_Domain\", \"description\": \"Cellulose binding domain of C. cellulovorans cellulose binding protein gene (Freiburg-Standard)\", \"info\": \"CBDclos is an N-terminal domain quite close to the start of the protein-sequence \"}, {\"id\": \"BBa_K863112\", \"type\": \"Composite\", \"description\": \"Cellulose binding domain of C. cellulovorans with T7, RBS, GS-Linker (Freiburg-Standard)\", \"info\": \"CBDclos is an N-terminal domain quite close to the start of the protein-sequence \"}, {\"id\": \"BBa_K863113\", \"type\": \"Reporter\", \"description\": \"Cellulose binding Domain of C. cellulovorans cellulose binding protein with Reporter GFP\", \"info\": \"this construct was designed as a reporter-fusion-protein to measure the binding capacity of the cellulose binding domain \"}, {\"id\": \"BBa_K863114\", \"type\": \"Reporter\", \"description\": \"CBD of C. cellulovorans cellulose binding protein gene with const. Promoter (J23100+J61101) and GFP\", \"info\": \"this construct was designed as a reporter-fusion-protein to measure the binding capacity of the cellulose binding domain \"}, {\"id\": \"BBa_K863120\", \"type\": \"Coding\", \"description\": \"green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (Freiburg-Standard)\", \"info\": \"green fluorescent protein derived from jellyfish aequeora victoria wild-type GFP (\"}, {\"id\": \"BBa_K863121\", \"type\": \"Coding\", \"description\": \"green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (His-tag)\", \"info\": \"Tagged version of gfp from Repressilator reporter in Standard 25 (freiburg) see\"}, {\"id\": \"BBa_K863205\", \"type\": \"Device\", \"description\": \"GFP integrated in shuttle vector pECPP11JS (BBa_K863204) for integration in yeast\", \"info\": \"GFP was amplified by PCR and cloned via the AarI restriction site in the\"}, {\"id\": \"BBa_K863207\", \"type\": \"Composite\", \"description\": \"tvel5 integrated in shuttle vector pECPP11JS (BBa_K863204) for integration in yeast\", \"info\": \"tvel5 laccase was cloned into the shuttle vector pECPP11JS .\"}, {\"id\": \"BBa_K863208\", \"type\": \"Composite\", \"description\": \" tvel35 integrated in shuttle vector pECPP11JS (BBa_K863204) for integration in yeast \", \"info\": \"tvel35 integrated in shuttle vector pECPP11JS (BBa_K863204) for integration\"}, {\"id\": \"BBa_K863209\", \"type\": \"Composite\", \"description\": \"BBa_500002 integrated in shuttle vector pECPP11JS (BBa_K863204) for integration in yeast \", \"info\": \"BBa_500002 integrated in shuttle vector pECPP11JS for integration in yeast . BB\"}, {\"id\": \"BBa_K874102\", \"type\": \"Generator\", \"description\": \"IPTG inducible expression of PZF3838, M.ScaI Fusion protein (IPTG -%3E PZF3838, M.ScaI FP)\", \"info\": \"IPTG inducible expression of PZF3838, M.ScaI Fusion protein Cloned into\"}, {\"id\": \"BBa_K874103\", \"type\": \"Generator\", \"description\": \"Arabinose inducible expression of PZF3838, M.ScaI Fusion protein (ARA -%3E PZF3838, M.ScaI FP)\", \"info\": \"arabinose inducible expression of PZF3838, M.ScaI Fusion protein Cloned\"}, {\"id\": \"BBa_K874200\", \"type\": \"Project\", \"description\": \"IPTG inducible PZF targeted methylation and measurement system (dual PZF3838 targeted)\", \"info\": \"IPTG inducible PZF targeted methylation and measurement system . cloned into \"}, {\"id\": \"BBa_K874300\", \"type\": \"Generator\", \"description\": \"IPTG inducible expression of M.ScaI methyltansferase (IPTG -%3E M.ScaI) (ScaI silently mutated out)\", \"info\": \"IPTG inducible expression of M.ScaI methyltansferase (IPTG \"}, {\"id\": \"BBa_K876066\", \"type\": \"Composite\", \"description\": \"plac-luxR-Term-Term-pluxR-araC-lasR-Term-Term-pBad-tetR-Term-Term-plasR.TetO-RBS-CFP-Term-Term\", \"info\": \"plac-luxR-TT-pluxR\\u2013araC\\u2013lasR\\u2013TT\\u2013pBad\"}, {\"id\": \"BBa_K880001\", \"type\": \"Measurement\", \"description\": \"Asymmetrically digestible reporter to assay the activity of DNA recombinases FimE K137007 and HbiF K\", \"info\": \"K880001 is a utility for characterizing the functionality of fim based recombinases\"}, {\"id\": \"BBa_K880002\", \"type\": \"Measurement\", \"description\": \"GFP fluorescence reporter to assay the activity of FimE K137007 and HbiF K880000 recombinases. \", \"info\": \"this is a GFP fluorescent reporter capable of assaying the functionality of fim regulatory recombina\"}, {\"id\": \"BBa_K880003\", \"type\": \"Measurement\", \"description\": \"Asymmetrically digestible reporter, same orientation of inverted repeats as K137058 (external sites \", \"info\": \"this is an asymmetrically digestible reporter, same orientation of inverted repeats as K137058 \"}, {\"id\": \"BBa_K883151\", \"type\": \"Device\", \"description\": \"CCMV coat protein gene 25AA N-terminal replaced with HIStag under IPTG inducable promotor\", \"info\": \"this part produces a coat protein of the Cowpea Clorotic Mottle Virus . the first 25\"}, {\"id\": \"BBa_K887000\", \"type\": \"Composite\", \"description\": \"Plac+B0034+zif268+alsS+B0034+PBSII+ilvC+B0034+HIVC+ilvD+37%26%238451%3B induced RBS+tetR+double terminator\", \"info\": \"our modified E.coli will convert glucose into isobutanol . but, according to many researche\"}, {\"id\": \"BBa_K887002\", \"type\": \"Composite\", \"description\": \"Plac+B0034+alsS+B0034+ilvC+B0034+ilvD+37%26%238451%3BRBS+tetR+double terminator+Ptet+B0032+kivD+B0015\", \"info\": \"BBa_B0015 is a complete biobrick for isobutanol production .\"}, {\"id\": \"BBa_K887004\", \"type\": \"Composite\", \"description\": \"Plac+alsS+ilvC+ilvD(each preceded by own zinc-finger and RBS)+Ptet+B0032+kivD+B0015\", \"info\": \"the main goal of our project this year is to improve the production of isobutanol in E.coli\"}, {\"id\": \"BBa_K896599\", \"type\": \"RBS\", \"description\": \"Strophurus rankini voucher AMS R140490 NADH dehydrogenase subunit 4 (ND4) gene, partial cds%3B tRNA-Hi\", \"info\": \"AMS R140490 NADH dehydrogenase subunit 4 (ND4) gene, partial \"}, {\"id\": \"BBa_K896988\", \"type\": \"Coding\", \"description\": \"Homo sapiens solute carrier family 12 (potassium/chloride transporters), member 4 (SLC12A4)\", \"info\": \"potassium chloride cotransport is elevated in sickle erythrocytes . the KCC1 gene has\"}, {\"id\": \"BBa_K907003\", \"type\": \"Device\", \"description\": \"Binary signal generator, promoter reversed, RBS(reverse) - attB - Promoter(reverse) - attP - RBS\", \"info\": \"BBa_K907000(mycobacterium phage bxb1 integra\"}, {\"id\": \"BBa_K929202\", \"type\": \"Coding\", \"description\": \"EGF-Receptor_3rd domain with PelB leadersequence,  His-tag and C-terminal Sortase motif\", \"info\": \"EGF-Receptor_3rd domain with PelB leadersequence, His-tag and C\"}, {\"id\": \"BBa_K935001\", \"type\": \"Generator\", \"description\": \"E. coli chromosomal ars promoter with arsR repressor gene and double terminator (B0010-B0012)\", \"info\": \"composite part BBa_J33201 designed by the 2006 Edinburgh Team . contains the promoter of the \"}, {\"id\": \"BBa_K944012\", \"type\": \"Intermediate\", \"description\": \"T7 constitutive promoter with RBS, transcriptional regulator from de cyanide inducible promoter and \", \"info\": \"cioAB is a cyanide-insensitive terminal oxidase related to the \"}, {\"id\": \"BBa_K944015\", \"type\": \"Composite\", \"description\": \"Cyanide insensitive terminal oxidase cioAB and cyanide biosensor expression platform\", \"info\": \"composite part is combination of cyanide insensitive terminal oxidase cioAB and cyan\"}, {\"id\": \"BBa_K953003\", \"type\": \"Composite\", \"description\": \"Agrobacterium tumefaciens Bacteriophytochrome with T7 %26 RBS (E. coli Codon Optimised)\", \"info\": \"Agrobacterium tumefaciens bacteriophytochrome with a RBS\"}, {\"id\": \"BBa_K953005\", \"type\": \"Composite\", \"description\": \"Heme Oxygenase with T7 + Agrobacterium tumefaciens Bacteriophytochrome (E. coli Codon Optimised)\", \"info\": \"composite couples synechocystis heme oxygenase with bacteriophytochrome\"}, {\"id\": \"BBa_K953006\", \"type\": \"Composite\", \"description\": \"Heme Oxygenase with T7 + Deinococcus radiodurans Bacteriophytochrome (E. coli Codon Optimised)\", \"info\": \"composite couples synechocystis heme oxygenase with Deinococcus radiodur\"}, {\"id\": \"BBa_K953007\", \"type\": \"Composite\", \"description\": \"Agrobacterium tumefaciens Bacteriophytochrome with T7 + Heme Oxygenase (E. coli Codon Optimised)\", \"info\": \"composite couples agrobacterium tumefaciens bacteriophytochrome with T\"}, {\"id\": \"BBa_K957005\", \"type\": \"Generator\", \"description\": \" Constitutive expression of nah Operon for degradation of naphthalene to salicylate \", \"info\": \"constitutive expression of nah Operon for degradation of naphthalene to salicylate One of\"}, {\"id\": \"BBa_K976008\", \"type\": \"Composite\", \"description\": \"Yeast ADH1 Promoter + Firefly Luciferase + Yeast ADH1 Promoter + Renilla Luciferase\", \"info\": \"Yeast ADH1 promoter + firefly luciferase + yeast promoter\"}, {\"id\": \"BBa_K987000\", \"type\": \"Coding\", \"description\": \"This part is a coding part that produces Vip3Ca3, a protein that can deals with different forms of p\", \"info\": \"this part is a coding part that produces Vip3Ca3, a protein that can deal with different\"}, {\"id\": \"BBa_K987001\", \"type\": \"Composite\", \"description\": \"This is a composite part which has the function to invert the temperature activation by the part%3A BB\", \"info\": \"this is a composite part which has the function to invert the temperature activation by the part: BB This\"}, {\"id\": \"BBa_M1002\", \"type\": \"Coding\", \"description\": \"Phasin-Complete coding sequence from Ralstonia eutropha, PHA granule-associated protein\", \"info\": \"Phasin has been implicated as a protein involved in binding to polyhydroxyalkanoic acid \"}, {\"id\": \"BBa_M10034\", \"type\": \"Coding\", \"description\": \"%7B%26%23706%3BAg43_short%21%7D, for Ag 43 autotransporter display system, only transporter \", \"info\": \"this part is an actual transporter portion of an antigen 43 autotransporter display system based on this reference:\"}, {\"id\": \"BBa_M10035\", \"type\": \"Coding\", \"description\": \"%7B%26%23706%3BAg43_long%21%7D for Ag 43 autotransporter display system, including passenger domain\", \"info\": \"this part consists of an actual transporter portion and also passenger domain of an antigen 43 autotransporter display system\"}, {\"id\": \"BBa_M10211\", \"type\": \"Composite\", \"description\": \"%7BPbad.rbs.prepro.StrepTag%7D%7B%26%23706%3BAG4%26%23707%3B%7D%7B%26%23706%3BeCPX%21%7D%7BdblTerm%7D\", \"info\": \"Pbad.rbs.prepro.StrepTagGS5-IILK\"}, {\"id\": \"BBa_M10212\", \"type\": \"Composite\", \"description\": \"%7BPbad.rbs.prepro.StrepTag%7D%7B%26%23706%3BAG4%26%23707%3B%7D%7B%26%23706%3BupaG_short%21%7D%7BdblTerm%7D\", \"info\": \"recombinant leucine zipper constructs were tested for their ability to bind streptavidin \"}, {\"id\": \"BBa_M10213\", \"type\": \"Device\", \"description\": \"%7BPbad.rbs.prepro.StrepTag%7D%7B%26%23706%3BAG4%26%23707%3B%7D%7B%26%23706%3BAg43_short%21%7D%7BdblTerm%7D\", \"info\": \"Pbad.rbs.prepro.StrepTagAG4Ag43_\"}, {\"id\": \"BBa_M10214\", \"type\": \"Device\", \"description\": \"%7BPbad.rbs.prepro.StrepTag%7D%7B%26%23706%3BAG4%26%23707%3B%7D%7B%26%23706%3BespP(beta)%21%7D%7BdblTerm%7D\", \"info\": \"a number of the constructs used in this study were not able to bind streptavidin .\"}, {\"id\": \"BBa_M10217\", \"type\": \"Device\", \"description\": \"%7BPbad.rbs.prepro.StrepTag%7D%7B%26%23706%3BAG4%26%23707%3B%7D%7B%26%23706%3BTshA%21%7D%7BdblTerm%7D\", \"info\": \"a number of the constructs used in this study were not able to bind streptavidin .\"}, {\"id\": \"BBa_M10219\", \"type\": \"Composite\", \"description\": \"%7BPbad.rbs.prepro.StrepTag%7D%7B%26%23706%3BGS5-IILKt%26%23707%3B%7D %7B%26%23706%3BeCPX%21%7D%7BdblTerm%7D\", \"info\": \"recombinant E. coli constructs were tested for their ability to bind streptavidin \"}, {\"id\": \"BBa_M10220\", \"type\": \"Composite\", \"description\": \"%7BPbad.rbs.prepro.StrepTag%7D%7B%26%23706%3BGS5-IILK%26%23707%3B%7D%7B%26%23706%3BupaG_short%21%7D%7BdblTerm%7D\", \"info\": \"recombinant leucine zipper constructs were tested for their ability to bind streptavidin \"}, {\"id\": \"BBa_M10221\", \"type\": \"Device\", \"description\": \"%7BPbad.rbs.prepro.StrepTag%7D%7D%7B%26%23706%3BGS5-IILK%26%23707%3B%7D%7B%26%23706%3BAg43_short%21%7D%7BdblTerm%7D\", \"info\": \"toxicity can be inferred from the differences in growth rate (as determined by changes in OD 600 over\"}, {\"id\": \"BBa_M10222\", \"type\": \"Device\", \"description\": \" %7BPbad.rbs.prepro.StrepTag%7D%7B%26%23706%3BGS5-IILK%26%23707%3B%7D%7B%26%23706%3BespP(beta)%21%7D%7BdblTerm%7D \", \"info\": \"recombinant leucine zipper constructs were tested for their ability to bind streptavidin \"}, {\"id\": \"BBa_M10225\", \"type\": \"Device\", \"description\": \"%7BPbad.rbs.prepro.StrepTag%7D%7B%26%23706%3BGS5-IILK%26%23707%3B%7D%7B%26%23706%3BTshA%21%7D%7BdblTerm%7D\", \"info\": \"recombinant leucine zipper constructs were tested for their ability to bind streptavidin \"}, {\"id\": \"BBa_M11051\", \"type\": \"Coding\", \"description\": \"Captures light energy and uses it to move protons across the membrane out of the cell.\", \"info\": \"bacteriorhodopsin is a protein used by archaea, notably hal\"}, {\"id\": \"BBa_M11085\", \"type\": \"Coding\", \"description\": \"E coli outer membrane protein C (ompC) with BamHI RE site for insertion of gene to be expressed on o\", \"info\": \"BamHI RE site added to the 9th hydrophylic loop which protrudes out of the cell .\"}, {\"id\": \"BBa_M11207\", \"type\": \"Device\", \"description\": \"Device containing HXT7/mNarK promoters and GFP/RFP to monitor glucose/oxygen levels in S. cerevisiae\", \"info\": \"device containing HXT7/mNarK promoters and GFP/RFP to monitor glucose\"}, {\"id\": \"BBa_M11208\", \"type\": \"Device\", \"description\": \"Device containing HXT1/mNarK promoters and GFP/RFP to monitor glucose/oxygen levels in S. cerevisiae\", \"info\": \"device containing HXT1/mNarK promoters and GFP/RFP to monitor glucose and\"}, {\"id\": \"BBa_M11410\", \"type\": \"Regulatory\", \"description\": \"Type 2 promoter of sigE gene. Sigma factor regulates light and nitrogen responses, and has been obse\", \"info\": \"promoter potentially regulated by circadian rhythm . sigE contributes to the expression of genes related to sugar\"}, {\"id\": \"BBa_M11411\", \"type\": \"Regulatory\", \"description\": \"Type 2 promoter of lrtA gene. Gene is expressed during darkness. Potentially darkness-induced promot\", \"info\": \"Type 2 promoter of lrtA gene. Gene is expressed during darkness. potentially darkness-induced promote\"}, {\"id\": \"BBa_M1515\", \"type\": \"Composite\", \"description\": \"Thermal Hysteresis (Antifreeze) Protein (variant YL3) with 8-His tag with secretion tag and GFP\", \"info\": \"thermal hysteresis (antifreeze) protein with an 8-His tag for protein pur\"}, {\"id\": \"BBa_M1529\", \"type\": \"Composite\", \"description\": \"Thermal Hysteresis (Antifreeze) Protein (variant YL1) with 8-His tag with secretion tag and GFP\", \"info\": \"thermal hysteresis (antifreeze) protein with an 8-His tag for protein pur\"}, {\"id\": \"BBa_M1530\", \"type\": \"Composite\", \"description\": \"Thermal Hysteresis (Antifreeze) Protein (variant YL4) with 8-His tag with secretion tag and GFP\", \"info\": \"thermal hysteresis (antifreeze) protein with an 8-His tag for protein pur\"}, {\"id\": \"BBa_M1531\", \"type\": \"Composite\", \"description\": \"Thermal Hysteresis (Antifreeze) Protein (variant YL1) with 8-His tag with secretion tag and GFP\", \"info\": \"thermal hysteresis (antifreeze) protein with an 8-His tag for protein pur\"}, {\"id\": \"BBa_M1532\", \"type\": \"Composite\", \"description\": \"Thermal Hysteresis (Antifreeze) Protein (variant YL1) with 8-His tag with secretion tag and GFP\", \"info\": \"thermal hysteresis (antifreeze) protein with secretion tag and GFP .\"}, {\"id\": \"BBa_M1533\", \"type\": \"Composite\", \"description\": \"Thermal Hysteresis (Antifreeze) Protein (variant YL4) with 8-His tag with secretion tag and GFP\", \"info\": \"thermal hysteresis (antifreeze) protein with an 8-His tag and secreti\"}, {\"id\": \"BBa_M1535\", \"type\": \"Composite\", \"description\": \"Thermal Hysteresis (Antifreeze) Protein (variant YL1) with 8-His tag with secretion tag and GFP\", \"info\": \"thermal hysteresis (antifreeze) protein with secretion tag and GFP .\"}, {\"id\": \"BBa_M1536\", \"type\": \"Composite\", \"description\": \"Thermal Hysteresis (Antifreeze) Protein (variant YL4) with 8-His tag with secretion tag and GFP\", \"info\": \"thermal hysteresis (antifreeze) protein with an 8-His tag and secreti\"}, {\"id\": \"BBa_M1541\", \"type\": \"Composite\", \"description\": \"Thermal Hysteresis (Antifreeze) Protein (variant YL3) with 8-His tag with secretion tag and GFP\", \"info\": \"thermal hysteresis (antifreeze) protein with an 8-His tag and secreti\"}, {\"id\": \"BBa_M1542\", \"type\": \"Composite\", \"description\": \"Thermal Hysteresis (Antifreeze) Protein (variant YL3) with 8-His tag with secretion tag and GFP\", \"info\": \"thermal hysteresis (antifreeze) protein with an 8-His tag for protein pur\"}, {\"id\": \"BBa_M1641\", \"type\": \"Device\", \"description\": \"Complete proteorhodopsin and hydrogenase device, producing hydrogen gas. Constitutive promoter.\", \"info\": \"complete proteorhodopsin and hydrogenase device, producing hydrogen gas.\"}, {\"id\": \"BBa_M31513\", \"type\": \"Project\", \"description\": \"Refactored portion of M13 genome from unique Hpal site on gene II to the BamHI site on gene III \", \"info\": \"this part represents the refactored portion of the genome from the hpaI restriction site on gene\"}, {\"id\": \"BBa_M31516\", \"type\": \"Project\", \"description\": \"Refactored portion of M13 genome from unique Hpal site on gene II to the BamHI site on gene III\", \"info\": \"Contains refactored sequences of the M13 genome from HpaI [8669/86\"}, {\"id\": \"BBa_M31517\", \"type\": \"Other\", \"description\": \"Refactored M13KO7 genome from HpaI site in gene II through BamHI site in gene III\", \"info\": \"refactored plasmid cut at gene II's HpaI site until gene III'\"}, {\"id\": \"BBa_M31539\", \"type\": \"Composite\", \"description\": \"These are the genes in M13K07 responsible for forming the %27tip%27 of the phage. \", \"info\": \"these are the genes in M13K07 responsible for forming the 'tip' of the phage \"}, {\"id\": \"BBa_M33334\", \"type\": \"Coding\", \"description\": \"CDS+RBS for Inorganic mercury-sensitive regulatory protein merR coding sequence with RBS \", \"info\": \"merR is part of the mer operon from thermus thermophilus HB27 . it\"}, {\"id\": \"BBa_M33335\", \"type\": \"Coding\", \"description\": \"CDS for Inorganic mercury-sensitive regulatory protein merR coding sequence with RBS\", \"info\": \"merR is part of the mer operon from thermus thermophilus HB27 . \"}, {\"id\": \"BBa_M34014\", \"type\": \"DNA\", \"description\": \"Nucleotide sequence of a cDNA clone of saxiphilin from the liver of Rana Catesbeiana\", \"info\": \"nucleotide sequence of a cDNA clone of saxiphilin from the\"}, {\"id\": \"BBa_M36195\", \"type\": \"Composite\", \"description\": \"Bicistronic sequence containing ligninase and required enzyme manganese peroxidase\", \"info\": \"bicistronic sequence containing ligninase and required enzyme manganese peroxida\"}, {\"id\": \"BBa_M36222\", \"type\": \"Composite\", \"description\": \"ArsAction%3A Arsenite Removal Device (input%3A PoPs Signal, output%3A removal device)\", \"info\": \"arsenic removal device is designed to prolong cell survival and decrease the rate of cell death due to arse\"}, {\"id\": \"BBa_M36731\", \"type\": \"Composite\", \"description\": \"EfeU elemental iron (II) transporter + 5%27 UTR (medium) + terminator + Fur promoter\", \"info\": \"Efeu elemental iron (II) transporter + 5' UTR (medium) + terminat\"}, {\"id\": \"BBa_M36732\", \"type\": \"Composite\", \"description\": \"EfeU iron (II) transporter + 5%27 UTR (medium) + terminator + Fur promoter + Gemini\", \"info\": \"Efeu iron (II) transporter + 5' UTR (medium) + terminator +\"}, {\"id\": \"BBa_M36916\", \"type\": \"Composite\", \"description\": \"This series of parts codes for the expression of the benzylalcohol acetyltransferase enzyme\", \"info\": \"this sequence codes for the expression of the benzylalcohol acetyltransferas\"}, {\"id\": \"BBa_S03639\", \"type\": \"Composite\", \"description\": \"(-1,-2) HixC-pBad%3Csub%3Erev%3C/sub%3E-HixC %3A TetB-RBS%3Csub%3Erev%3C/sub%3E-HixC\", \"info\": \"hixC-pBadrev-hixc is one of the eight permutations of two\"}, {\"id\": \"BBa_S03642\", \"type\": \"Composite\", \"description\": \"(-2,-1) HixC-TetB-RBS%3Csub%3Erev%3C/sub%3E-HixC %3A pBad%3Csub%3Erev%3C/sub%3E-HixC\", \"info\": \"hixC-TetB-RBSrev-HixC : pBad\"}, {\"id\": \"BBa_S03649\", \"type\": \"Intermediate\", \"description\": \"(1)2 RFP%3Csub%3Erev%3C/sub%3E-RBS%3Csub%3Erev%3C/sub%3E-HixC %3A pLac-HixC-RBS-TetF\", \"info\": \"intermediate was assembled from parts RFPrev-RBSrev-HixC (BBa_S03\"}, {\"id\": \"BBa_S03673\", \"type\": \"Intermediate\", \"description\": \"(1)-2 RFP%3Csub%3Erev%3C/sub%3E-RBS%3Csub%3Erev%3C/sub%3E-HixC %3A pLac-HixC-TetB-RBS%3Csub%3Erev%3C/sub%3E\", \"info\": \"pLac-HixC-TetB-RBSrev Construction intermediate Sequence and features\"}, {\"id\": \"BBa_S03676\", \"type\": \"Intermediate\", \"description\": \"RFP%3Csub%3Erev%3C/sub%3E-RBS%3Csub%3Erev%3C/sub%3E-HixC %3A TetB-RBS%3Csub%3Erev%3C/sub%3E-HixC\", \"info\": \"RFPrev-RBSrev-HixC Construction intermediate Sequence and features Assembly Compatibility:\"}, {\"id\": \"BBa_S03677\", \"type\": \"Intermediate\", \"description\": \"(2,1) RFP%3Csub%3Erev%3C/sub%3E-RBS%3Csub%3Erev%3C/sub%3E-HixC-RBS-TetF-HixC %3A pLac-HixC\", \"info\": \"pLac-hixc is a construction intermediate Sequence and features assembly . it is compatible with\"}, {\"id\": \"BBa_S03679\", \"type\": \"Intermediate\", \"description\": \"(2,-1) RFP%3Csub%3Erev%3C/sub%3E-RBS%3Csub%3Erev%3C/sub%3E-HixC-RBS-TetF-HixC %3A pLac%3Csub%3Erev%3C/sub%3E-HixC\", \"info\": \"RFPrev-RBSrev-HixC : pLacrev-hixc\"}, {\"id\": \"BBa_S03680\", \"type\": \"Intermediate\", \"description\": \"(-2,1) RFP%3Csub%3Erev%3C/sub%3E-RBS%3Csub%3Erev%3C/sub%3E-HixC-TB-RBS%3Csub%3Erev%3C/sub%3E-HixC %3A pLac-HixC\", \"info\": \"RFPrev-RBSrev-HixC : pLac-hixc Construction\"}, {\"id\": \"BBa_S03681\", \"type\": \"Intermediate\", \"description\": \"(-2,-1) RFP%3Csub%3Erev%3C/sub%3E-RBS%3Csub%3Erev%3C/sub%3E-HixC-TB-RBS%3Csub%3Erev%3C/sub%3E-HixC %3A pLac%3Csub%3Erev%3C/sub%3E-HixC\", \"info\": \"RFPrev-RBSrev-HixC : pLacrev-hixc\"}, {\"id\": \"BBa_S03684\", \"type\": \"Intermediate\", \"description\": \"(1,2) RFP%3Csub%3Erev%3C/sub%3E-RBS%3Csub%3Erev%3C/sub%3E-HixC-pLac-HixC %3A RBS-TetF-HixC\", \"info\": \"RFPrev-RBSrev-HixC-pLac-hixc : R\"}, {\"id\": \"BBa_S03685\", \"type\": \"Intermediate\", \"description\": \"(1,-2) RFP%3Csub%3Erev%3C/sub%3E-RBS%3Csub%3Erev%3C/sub%3E-HixC-pLac-HixC %3A TetB-RBS%3Csub%3Erev%3C/sub%3E-HixC\", \"info\": \"RFPrev-RBSrev-HixC-pLac-hixc : Te\"}, {\"id\": \"BBa_S03686\", \"type\": \"Intermediate\", \"description\": \"RFP%3Csub%3Erev%3C/sub%3ERBS%3Csub%3Erev%3C/sub%3E-HixC %3A pLac%3Csub%3Erev%3C/sub%3E-HixC (dummy part)\", \"info\": \"RFPrevRBSrev-HixC : pLacrev-hixc (\"}, {\"id\": \"BBa_S03687\", \"type\": \"Intermediate\", \"description\": \"(-1,2) RFP%3Csub%3Erev%3C/sub%3ERBS%3Csub%3Erev%3C/sub%3E-HixC-pLac%3Csub%3Erev%3C/sub%3E-HixC %3A RBS-TetF-HixC\", \"info\": \"RFPrevRBSrev-HixC-pLacrev-hixc : R\"}, {\"id\": \"BBa_S03688\", \"type\": \"Intermediate\", \"description\": \"(-1,-2) RFP%3Csub%3Erev%3C/sub%3ERBS%3Csub%3Erev%3C/sub%3E-HixC-pLac%3Csub%3Erev%3C/sub%3E-HixC %3A TB-RBS%3Csub%3Erev%3C/sub%3E-HixC\", \"info\": \"RFPrevRBSrev-HixC-pLacrev-hixc : \"}, {\"id\": \"BBa_Y00100\", \"type\": \"Composite\", \"description\": \"nuclear 5-aminolevulinate synthase gene from S. cerevisiae, recoded for mitochondrial expression\", \"info\": \"HEM1 is a nuclear gene that encodes the enzyme 5-aminolevulinate synthase\"}]\n"
     ]
    }
   ],
   "source": [
    "# store the data with summaries\n",
    "import json\n",
    "\n",
    "x = json.dumps(for_improvement)\n",
    "y = json.dumps(for_training)\n",
    "\n",
    "# X = '[{\"id\": \"BBa_I726001\", \"type\": \"Intermediate\", \"description\": \"I\", \"info\": \"iGEM 2007 Team Parts I luxI Usage and Biology Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] . 12compatible with rfc[12\"}, {\"id\": \"BBa_I726002\", \"type\": \"Intermediate\", \"description\": \"R\", \"info\": \"iGEM 2007 Team Parts R luxR Usage and Biology Sequence and Features Assembly Compatibility: 10Compatible WITH RFC[10] 12COMPATIBLE WITH rfc[12] 21\"}, {\"id\": \"BBa_I741049\", \"type\": \"Regulatory\", \"description\": \" \", \"info\": \"Sequence and Features Assembly Compatibility: 10Compatible with rfc[10] 12COMPATIBLE WITH RFC[12] 21Compatible with Rf[21] 23Compatiable with RFC\"}, {\"id\": \"BBa_I741108\", \"type\": \"Temporary\", \"description\": \"a\", \"info\": \"a Sequence and Features Assembly Compatibility: 10Compatible WITH RFC[10] 12COMPATIBLE WITH rfc[12] 21Compatible with rc[21] 23Compat\"}, {\"id\": \"BBa_J17004\", \"type\": \"Temporary\", \"description\": \"a\", \"info\": \"a a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12Compatible with rfc[12] 21INCOMPATIBIBLE WITH rc[21\"}, {\"id\": \"BBa_J29043\", \"type\": \"Reporter\", \"description\": \"a\", \"info\": \"a a Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 316 12INCOMPATIBILITY WITH rfc[\"}, {\"id\": \"BBa_K245138\", \"type\": \"Coding\", \"description\": \"x\", \"info\": \"x x Sequence and Features Assembly Compatibility: 10compatible with rfc[10] 12compatible with RFC[12] 21compatibile with Rf[21] 23compat\"}, {\"id\": \"BBa_K252015\", \"type\": \"RBS\", \"description\": \"f\", \"info\": \"f ff sequence and features assembly compatibility: 10compatible with rfc[10] 12compatible with RFC[12] 21compatible with regc[21] 23compat\"}, {\"id\": \"BBa_K361010\", \"type\": \"Regulatory\", \"description\": \" \", \"info\": \"Sequence and Features Assembly Compatibility: 10Compatible WITH RFC[10] 12COMPATIBLE WITH rfc[12] 21Compatible with rc[21] 23Compatiable with \"}, {\"id\": \"BBa_K404245\", \"type\": \"Project\", \"description\": \" \", \"info\": \"Sequence and Features Assembly Compatibility: 10Compatible WITH RFC[10] 12COMPATIBLE WITH rfc[12] 21Compatible with rc[21] 23Compatiable with \"}, {\"id\": \"BBa_K404249\", \"type\": \"Project\", \"description\": \" \", \"info\": \"Sequence and Features Assembly Compatibility: 10Compatible WITH RFC[10] 12COMPATIBLE WITH rfc[12] 21Compatible with rc[21] 23Compatiable with \"}, {\"id\": \"BBa_K404307\", \"type\": \"Composite\", \"description\": \" \", \"info\": \"x Sequence and Features Assembly Compatibility: 10Compatible WITH RFC[10] 12COMPATIBLE WITH rfc[12] 21Compatible with rc[21] 23Compatiable\"}, {\"id\": \"BBa_K519004\", \"type\": \"Composite\", \"description\": \"a\", \"info\": \"a a Sequence and Features Assembly Compatibility: 10Compatible with rfc[10] 12INCOMPATIBLE WITH RFC[12]Illegal nheI site found at 7I\"}, {\"id\": \"BBa_K519005\", \"type\": \"Composite\", \"description\": \"a\", \"info\": \"a a Sequence and Features Assembly Compatibility: 10Compatible with rfc[10] 12INCOMPATIBLE WITH RFC[12]Illegal nheI site found at 7I\"}, {\"id\": \"BBa_K879927\", \"type\": \"Plasmid\", \"description\": \" \", \"info\": \"this is a plasmid backbone that was designed to have its copy number controlled by the presence or absence of the inducer molecule IPTG . this copy number corresponds to the expression level of the genes on the \"}, {\"id\": \"BBa_K879928\", \"type\": \"Plasmid\", \"description\": \" \", \"info\": \"this biobrick has been tested in an experiment looking at plasmid loss from a culture of cells that are not growing under selection . the culture containing IPTG produced approximately 25 times as many colonies as the culture without IP\"}]'\n",
    "# Y = '[{\"id\": \"BBa_J01062\", \"type\": \"Intermediate\", \"description\": \"Mobilized OriTF with Lock1ed cI --%3E pRM --%3E GFP %3D %5BOriTF%5D%5BOnLock1%5D%5BcI%5D%5BDblTerminator%5D%5BpRM GFP%5D\", \"info\": \"Mobilized OriTF with Lock1ed cI--> pRM --> GFP = [OriTF][OnLock1][cI][dblTerminator][\"}, {\"id\": \"BBa_J23040\", \"type\": \"Signalling\", \"description\": \"%5BTetR%5D%5Brbs%5D%5BLuxR%5D%5BdblTerm%5D%5BLuxPR%5D+%5Brbs%5D%5BLacI%5D%5BdblTerm%5D  %22AHL-dependent inverter%22\", \"info\": \"F2620+P0412 sequence and features assembly compatibility: 10Compatible with rfc[10] 12Compatible with RFC[12] 21INCOMPATIBLE WITH RFC [21]\"}, {\"id\": \"BBa_J72103\", \"type\": \"Composite\", \"description\": \"%7BaraC-Pbad%7D%7Brbs.coi%7D%7Bdouble terminator%7D%7Bcin, no start, frameshift%7D%7BrepL no start%7D%7BLPsit%7D%7Brbs.pacA%7D%7BT\", \"info\": \"this part is in BBb Format . it is flanked by BglII and BamHI sites instead of XbaI and SpeI . the phagemid is referred to internally as\"}, {\"id\": \"BBa_J72116\", \"type\": \"Composite\", \"description\": \"%7BaraC-Pbad%7D%7Brbs.coi%7D%7Bdouble terminator%7D%7Bcin, no start, frameshift%7D%7BLPsit%7D%7Brbs.pacA%7D%7BTrnpB%7D\", \"info\": \"this part is in BBb Format . it is flanked by BglII and BamHI sites instead of XbaI and SpeI . the part is referred to internally as jt\"}, {\"id\": \"BBa_K078004\", \"type\": \"Coding\", \"description\": \"2%26%2365292%3B2%91%26%2365292%3B3-Trihydroxybiphenyl 1,2-dioxygenase. The second step enzyme in dixon degradation\", \"info\": \"there is currently no text in this page . you can search for this page title in other pages, or search the related logs, but you do not have permission to create this page. if you want to create a new page\"}, {\"id\": \"BBa_K078005\", \"type\": \"Coding\", \"description\": \"2%26%2365292%3B2%91%26%2365292%3B3-Trihydroxybiphenyl 1,2-dioxygenase. The second step enzyme in dixon degradation\", \"info\": \"2,2\\\\u2018,3-trihydroxybiphenyl 1,2-dioxygenase is one enzyme in dioxin degradation pathway . it is one kind of estradoil dioxygenese repon\"}, {\"id\": \"BBa_K531007\", \"type\": \"Composite\", \"description\": \"P%3Csub%3ErsaA%3C/sub%3E constitutive promoter, %3Ci%3Eesp%3C/i%3E optimized for %3Ci%3ECaulobacter%3C/i%3E, and %3Ci%3ErsaA%3C/i%3E\", \"info\": \"most of our chimeric RsaA-fusion proteins were expressed and secreted from Caulobacter . both DspB and Esp constructs with pxyl inducible promoter and chi\"}, {\"id\": \"BBa_K531008\", \"type\": \"Composite\", \"description\": \"P%3Csub%3Exyl%3C/sub%3E + %3Ci%3ECaulobacter%3C/i%3E optimized %3Ci%3EdspB%3C/i%3E + %3Ci%3ErsaA%3C/i%3E C-term\", \"info\": \"most of our chimeric RsaA-fusion proteins were expressed and secreted from Caulobacter . both DspB and Esp constructs with Pxyl inducible promoter can inhibit the bio\"}, {\"id\": \"BBa_K531009\", \"type\": \"Composite\", \"description\": \"P%3Csub%3ErsaA%3C/sub%3E + %3Ci%3ECaulobacter%3C/i%3E optimized %3Ci%3EdspB%3C/i%3E + %3Ci%3ErsaA%3C/i%3E C-term\", \"info\": \"most of our chimeric RsaA-fusion proteins were expressed and secreted from Caulobacter . both DspB and Esp constructs with Pxyl inducible promoter can inhibit the bio\"}, {\"id\": \"BBa_K531010\", \"type\": \"Composite\", \"description\": \"Constitutive promoter and RBS BBa_K081005 + %3Ci%3ECaulobacter%3C/i%3E optimized %3Ci%3EdspB%3C/i%3E + %3Ci%3ErsaA%3C/i%3E C\", \"info\": \"most of our chimeric RsaA-fusion proteins were expressed and secreted from Caulobacter . both DspB and Esp constructs with Pxyl inducible promoter can inhibit the bio\"}, {\"id\": \"BBa_K531011\", \"type\": \"Composite\", \"description\": \"Constitutive promoter and RBS BBa_K081005 + %3Ci%3ECaulobacter%3C/i%3E optimized %3Ci%3Eesp%3C/I%3E + C-terminal sec\", \"info\": \"most of our chimeric RsaA-fusion proteins were expressed and secreted from Caulobacter . both DspB and Esp can inhibit the biofilm growth . biofilm assay data showed a\"}, {\"id\": \"BBa_K733007\", \"type\": \"Composite\", \"description\": \"%3Ci%3EPveg%3C/i%3E + spoVG RBS + %3Ci%3ElytC%3C/i%3E + linker + RPMrel + consensus RBS + GFP + double terminator\", \"info\": \"project seeks to design recombinant bacteria that specifically target and suppress the growth of colorectal carcinoma cells in a controllable way . our proposed solution requires the phage display peptide \\\\u2018RPM\"}, {\"id\": \"BBa_K733012\", \"type\": \"Composite\", \"description\": \"%3Ci%3ExylR%3C/i%3E+%3Ci%3EPxylA%3C/i%3E+RBS+%3Ci%3EydcE%3C/i%3E+%3Ci%3EPtms%3C/i%3E+RBS+%3Ci%3EydcD%3C/i%3E%3A Cell Growth Inhibition Device\", \"info\": \"ptms+RBS+ydcD is for the stabilization of the cell growth inhibition system . the rationale for including this growth inhibition device is that over-dose of BMP2 can cause unexpected proliferation of\"}, {\"id\": \"BBa_K823023\", \"type\": \"Plasmid_Backbone\", \"description\": \"pSB%3Csub%3EBs%3C/sub%3E1C%3A Empty backbone for integration into %3Ci%3EBacillus subtilis%3C/i%3E %3Ci%3EamyE%3C/i%3E locus\", \"info\": \"pSBBs1C is an empty backbone vector for the usage in Bacillus subtilis . it integrates in the amyE locus and can be selected with chloramphenicol (cat gene) this\"}, {\"id\": \"BBa_K823024\", \"type\": \"Plasmid_Backbone\", \"description\": \"pSB%3Csub%3EBs%3C/sub%3E4S-P%3Ci%3E%3Csub%3Exyl%3C/i%3E%3C/sub%3E%3A Integrative expression vector for %3Ci%3EBacillus subtilis%3C/i\", \"info\": \"pSBBs4S-Pxyl is an expression vector for Bacillus subtilis . it integrates at the thrC locus and has a chloramphenicol resistance for selection in B\"}, {\"id\": \"BBa_K823026\", \"type\": \"Plasmid_Backbone\", \"description\": \"pSB%3Csub%3EBs%3C/sub%3E0K-P%3Csub%3Espac%3C/sub%3E (replicative Bacillus subtilis expression vector%3B IPTG inducible\", \"info\": \"pSBBs0K-Pspac is a replicative expression vector for Bacillus subtilis . it has an ampicillin resistance for cloning in E.coli and kanamycin resistance for selection\"}, {\"id\": \"BBa_K823030\", \"type\": \"Regulatory\", \"description\": \"P%3Csub%3E%3Ci%3EcotYZ%3C/i%3E%3C/sub%3E%3A %3Ci%3EB. subtilis%3C/i%3E promoter regulating expression of spore crust proteins\", \"info\": \"PcotYZ lies within cotVWXYZ gene cluster, which regulates expression of CotYZ . to test the activity we cloned this promoter into the lux-reporter vector\"}, {\"id\": \"BBa_K823033\", \"type\": \"Regulatory\", \"description\": \"P%3Csub%3E%3Ci%3EcotV%3C/i%3E%3C/sub%3E%3A  %3Ci%3EB. subtilis%3C/i%3E promoter regulates spore crust protein cotV\", \"info\": \"PcotV lies within cotVWXYZ gene cluster, which regulates expression of spore crust protein CotV . to test the activity we cloned this promoter into the lux-re\"}, {\"id\": \"BBa_M10220\", \"type\": \"Composite\", \"description\": \"%7BPbad.rbs.prepro.StrepTag%7D%7B%26%23706%3BGS5-IILK%26%23707%3B%7D%7B%26%23706%3BupaG_short%21%7D%7BdblTerm%7D\", \"info\": \"recombinant leucine zipper constructs were tested for their ability to bind streptavidin . the constructs did not appear to be able to clump at the bottom of the LB plates .\"}, {\"id\": \"BBa_M10221\", \"type\": \"Device\", \"description\": \"%7BPbad.rbs.prepro.StrepTag%7D%7D%7B%26%23706%3BGS5-IILK%26%23707%3B%7D%7B%26%23706%3BAg43_short%21%7D%7BdblTerm%7D\", \"info\": \"toxicity can be inferred from the differences in growth rate (as determined by changes in OD 600 over time) between samples containing LB and LB+arabinose . pbca9145-b\"}, {\"id\": \"BBa_M10222\", \"type\": \"Device\", \"description\": \" %7BPbad.rbs.prepro.StrepTag%7D%7B%26%23706%3BGS5-IILK%26%23707%3B%7D%7B%26%23706%3BespP(beta)%21%7D%7BdblTerm%7D \", \"info\": \"recombinant leucine zipper constructs were tested for their ability to bind streptavidin . the constructs did not appear to clump in the presence of arabinose . a method for quantify\"}, {\"id\": \"BBa_S03679\", \"type\": \"Intermediate\", \"description\": \"(2,-1) RFP%3Csub%3Erev%3C/sub%3E-RBS%3Csub%3Erev%3C/sub%3E-HixC-RBS-TetF-HixC %3A pLac%3Csub%3Erev%3C/sub%3E-HixC\", \"info\": \"RFPrev-RBSrev-HixC : pLacrev-hixc Construction intermediate Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12INCOM\"}, {\"id\": \"BBa_S03680\", \"type\": \"Intermediate\", \"description\": \"(-2,1) RFP%3Csub%3Erev%3C/sub%3E-RBS%3Csub%3Erev%3C/sub%3E-HixC-TB-RBS%3Csub%3Erev%3C/sub%3E-HixC %3A pLac-HixC\", \"info\": \"RFPrev-RBSrev-HixC : pLac-hixc Construction intermediate Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12INCOMPA\"}, {\"id\": \"BBa_S03681\", \"type\": \"Intermediate\", \"description\": \"(-2,-1) RFP%3Csub%3Erev%3C/sub%3E-RBS%3Csub%3Erev%3C/sub%3E-HixC-TB-RBS%3Csub%3Erev%3C/sub%3E-HixC %3A pLac%3Csub%3Erev%3C/sub%3E-HixC\", \"info\": \"RFPrev-RBSrev-HixC : pLacrev-hixc Construction intermediate Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12INCOM\"}, {\"id\": \"BBa_S03685\", \"type\": \"Intermediate\", \"description\": \"(1,-2) RFP%3Csub%3Erev%3C/sub%3E-RBS%3Csub%3Erev%3C/sub%3E-HixC-pLac-HixC %3A TetB-RBS%3Csub%3Erev%3C/sub%3E-HixC\", \"info\": \"RFPrev-RBSrev-HixC-pLac-hixc : construction intermediate Sequence and features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12INCOMPA\"}, {\"id\": \"BBa_S03687\", \"type\": \"Intermediate\", \"description\": \"(-1,2) RFP%3Csub%3Erev%3C/sub%3ERBS%3Csub%3Erev%3C/sub%3E-HixC-pLac%3Csub%3Erev%3C/sub%3E-HixC %3A RBS-TetF-HixC\", \"info\": \"RFPrevRBSrev-HixC-pLacrev-hixc : RBS-TetF-hxc Construction intermediate Sequence and features Assembly Compatibility: 10COMPAT\"}, {\"id\": \"BBa_S03688\", \"type\": \"Intermediate\", \"description\": \"(-1,-2) RFP%3Csub%3Erev%3C/sub%3ERBS%3Csub%3Erev%3C/sub%3E-HixC-pLac%3Csub%3Erev%3C/sub%3E-HixC %3A TB-RBS%3Csub%3Erev%3C/sub%3E-HixC\", \"info\": \"TB-RBSrev-HixC-pLacrev-hixc Construction intermediate Sequence and features Assembly Compatibility: 10Compatible WITH RFC[10] 12INCOMPATIBLE WITH R\"}]'\n",
    "\n",
    "# for_improvement = json.loads(X)\n",
    "# for_training = json.loads(Y)\n",
    "\n",
    "print(x, y, sep=\"\\n\\n\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 9,
   "id": "6763bd9d",
   "metadata": {
    "_cell_guid": "2dbafb21-b316-48f6-a460-a5a9ad2437f5",
    "_uuid": "32d19872-e1f7-4523-9977-401f3721bde1",
    "collapsed": false,
    "execution": {
     "iopub.execute_input": "2023-08-06T13:28:10.724211Z",
     "iopub.status.busy": "2023-08-06T13:28:10.723830Z",
     "iopub.status.idle": "2023-08-06T13:28:10.732100Z",
     "shell.execute_reply": "2023-08-06T13:28:10.730860Z"
    },
    "jupyter": {
     "outputs_hidden": false
    },
    "papermill": {
     "duration": 0.100925,
     "end_time": "2023-08-06T13:28:10.733873",
     "exception": false,
     "start_time": "2023-08-06T13:28:10.632948",
     "status": "completed"
    },
    "tags": []
   },
   "outputs": [],
   "source": [
    "training_examples = []\n",
    "shots = []\n",
    "\n",
    "for p in for_training:\n",
    "    inp = f\"Type: {p['type']}, Information: {p['info']}\"\n",
    "    outp = p[\"description\"]\n",
    "    \n",
    "    training_examples.append({\"input\": inp, \"target\": outp})\n",
    "    shots.append(f\"{inp}, Description: {outp}\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 10,
   "id": "825bd650",
   "metadata": {
    "_cell_guid": "e20c67d0-c58e-4cfe-87b2-1c5b31ea990f",
    "_uuid": "125aff85-e07e-4d39-80ce-4afc81f675d2",
    "collapsed": false,
    "execution": {
     "iopub.execute_input": "2023-08-06T13:28:10.913220Z",
     "iopub.status.busy": "2023-08-06T13:28:10.912850Z",
     "iopub.status.idle": "2023-08-06T13:28:10.923956Z",
     "shell.execute_reply": "2023-08-06T13:28:10.923331Z"
    },
    "jupyter": {
     "outputs_hidden": false
    },
    "papermill": {
     "duration": 0.103413,
     "end_time": "2023-08-06T13:28:10.925765",
     "exception": false,
     "start_time": "2023-08-06T13:28:10.822352",
     "status": "completed"
    },
    "tags": []
   },
   "outputs": [],
   "source": [
    "class DescriptionDataset(Dataset):\n",
    "    def __init__(self, tokenizer, examples):\n",
    "        self.examples = examples\n",
    "        self.tokenizer = tokenizer\n",
    "\n",
    "    def __len__(self):\n",
    "        return len(self.examples)\n",
    "\n",
    "    def __getitem__(self, idx):\n",
    "        example = self.examples[idx]\n",
    "        inputs = self.tokenizer.encode(example[\"input\"] + \", Description: \", return_tensors=\"pt\", padding=True, truncation=True, max_length=512)\n",
    "        targets = self.tokenizer.encode(example[\"target\"], return_tensors=\"pt\", padding=True, truncation=True, max_length=512)\n",
    "        return {\"input_ids\": inputs, \"attention_mask\": inputs.ne(0), \"labels\": targets}\n",
    "\n",
    "    def collate_fn(self, batch):\n",
    "        inputs = pad_sequence([item[\"input_ids\"].squeeze(0) for item in batch], batch_first=True)\n",
    "        attention_masks = pad_sequence([item[\"attention_mask\"].squeeze(0) for item in batch], batch_first=True)\n",
    "        labels = pad_sequence([item[\"labels\"].squeeze(0) for item in batch], batch_first=True, padding_value=self.tokenizer.pad_token_id)\n",
    "        \n",
    "        return {\"input_ids\": inputs, \"attention_mask\": attention_masks, \"labels\": labels}"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 11,
   "id": "8a1884de",
   "metadata": {
    "_cell_guid": "cdd8fb1c-51e7-4806-ad40-180a7886c0b3",
    "_uuid": "83783e77-f75b-4b3f-9a68-21e9d0dfe132",
    "collapsed": false,
    "execution": {
     "iopub.execute_input": "2023-08-06T13:28:11.119596Z",
     "iopub.status.busy": "2023-08-06T13:28:11.119048Z",
     "iopub.status.idle": "2023-08-06T14:52:51.725189Z",
     "shell.execute_reply": "2023-08-06T14:52:51.721871Z"
    },
    "jupyter": {
     "outputs_hidden": false
    },
    "papermill": {
     "duration": 5080.850111,
     "end_time": "2023-08-06T14:52:51.864144",
     "exception": false,
     "start_time": "2023-08-06T13:28:11.014033",
     "status": "completed"
    },
    "tags": []
   },
   "outputs": [
    {
     "data": {
      "text/plain": [
       "('fine_tuned_description_model/tokenizer_config.json',\n",
       " 'fine_tuned_description_model/special_tokens_map.json',\n",
       " 'fine_tuned_description_model/spiece.model',\n",
       " 'fine_tuned_description_model/added_tokens.json',\n",
       " 'fine_tuned_description_model/tokenizer.json')"
      ]
     },
     "execution_count": 11,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "# Prepare the dataset and data loader\n",
    "dataset = DescriptionDataset(tokenizer, training_examples)\n",
    "batch_size = 4  # Adjust this based on your resources\n",
    "train_loader = DataLoader(dataset, batch_size=batch_size, collate_fn=dataset.collate_fn, shuffle=True)\n",
    "\n",
    "# Fine-tuning settings\n",
    "num_epochs = 3\n",
    "learning_rate = 5e-5\n",
    "\n",
    "# Define the optimizer and loss function\n",
    "optimizer = torch.optim.AdamW(model.parameters(), lr=learning_rate)\n",
    "criterion = torch.nn.CrossEntropyLoss()\n",
    "\n",
    "# Fine-tuning loop\n",
    "model.train()\n",
    "for epoch in range(num_epochs):\n",
    "    for batch in train_loader:\n",
    "        input_ids = batch[\"input_ids\"].squeeze(1).to(model.device)\n",
    "        attention_mask = batch[\"attention_mask\"].squeeze(1).to(model.device)\n",
    "        labels = batch[\"labels\"].squeeze(1).to(model.device)\n",
    "            \n",
    "        optimizer.zero_grad()\n",
    "        outputs = model(input_ids=input_ids, attention_mask=attention_mask, labels=labels)\n",
    "        loss = outputs.loss\n",
    "        loss.backward()\n",
    "        optimizer.step()\n",
    "\n",
    "# Save the fine-tuned model\n",
    "model.save_pretrained(\"fine_tuned_description_model\")\n",
    "tokenizer.save_pretrained(\"fine_tuned_description_model\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 12,
   "id": "bc1d0f29",
   "metadata": {
    "_cell_guid": "ad0a5a44-ab85-4b72-98a0-89e89d36eeb9",
    "_uuid": "09c49d4a-ab25-40ea-8293-04a254aa10f7",
    "collapsed": false,
    "execution": {
     "iopub.execute_input": "2023-08-06T14:52:52.104168Z",
     "iopub.status.busy": "2023-08-06T14:52:52.103062Z",
     "iopub.status.idle": "2023-08-06T17:11:14.745372Z",
     "shell.execute_reply": "2023-08-06T17:11:14.742887Z"
    },
    "jupyter": {
     "outputs_hidden": false
    },
    "papermill": {
     "duration": 8302.768108,
     "end_time": "2023-08-06T17:11:14.747816",
     "exception": false,
     "start_time": "2023-08-06T14:52:51.979708",
     "status": "completed"
    },
    "tags": []
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "ID: BBa_C0090\n",
      "Original Description: smaI\n",
      "Description: smaI Coding Region for ahl synthase from serratia sp., %3Csub%3E. cerevisiae (Serratia)\n",
      "--------------\n",
      "ID: BBa_C0400\n",
      "Original Description: BglG\n",
      "Description: BglG is known to bind to terminator loops in bgl operon causing antisepsis.\n",
      "--------------\n",
      "ID: BBa_C0420\n",
      "Original Description: BglF\n",
      "Description: BglF Sensor permease of bgl operon Sequence and Features Assembly Compatibility%3Answer%3B %3Ci%3EBgl%3D\n",
      "--------------\n",
      "ID: BBa_C0600\n",
      "Original Description: Tar\n",
      "Description: Tar Chemotaxis aspartate receptor %3Assembly Compatibility%3B%3E10COM%26%23703%3B5%3E%3Ci%3EB%3ACCOM%3D%3CE%3EC\n",
      "--------------\n",
      "ID: BBa_C0620\n",
      "Original Description: Tsr\n",
      "Description: Tsr serine receptor sequence and features assembly %3A 10Compatible With RFC[10, Description%3C RFC%3E]\n",
      "--------------\n",
      "ID: BBa_C2030\n",
      "Original Description: Fos\n",
      "Description: Fos Encodes the Leucine Zipper Domain Sequence and Features Assembly Compatibility%3A 10COMPAT%3D\n",
      "--------------\n",
      "ID: BBa_C2031\n",
      "Original Description: JunB\n",
      "Description: JunB encodes the leucine zipper sequence and features assembly compatibility: 10COMPATIBLE WITH R, YFP, GFP\n",
      "--------------\n",
      "ID: BBa_C2032\n",
      "Original Description: JunD\n",
      "Description: JunD encodes a JunD leucine zipper %3A 10COMPAT%3D%3E%3Ci%3EL.\n",
      "--------------\n",
      "ID: BBa_C52934\n",
      "Original Description: vdh\n",
      "Description: Origin is from pseudomonas aeruginosa. vdh%3A %3C/%3E. sp.\n",
      "--------------\n",
      "ID: BBa_I10010\n",
      "Original Description: ferA\n",
      "Description: ferA encodes an 89kda cytochrome involved in the reduction of Fe(III) %26%23963%3B%3Csub%3E%3Fe(II)%3B(ferA)\n",
      "--------------\n",
      "ID: BBa_I10101\n",
      "Original Description: csgD\n",
      "Description: csgD gene also encodes a transcription activator the curli subunit encoding c-terminase\n",
      "--------------\n",
      "ID: BBa_I10652\n",
      "Original Description: fdd\n",
      "Description: fdd dkfka;l Sequence and Features Assembly Compatibility: 10COMPAT%3A %3B%3Csub%3E%3D%3U%3ECI%3R%3CDba%3CC\n",
      "--------------\n",
      "ID: BBa_I10777\n",
      "Original Description: GldE\n",
      "Description: gldE confers gliding motility to the bacteria. sequence and features Assembly Compat, %2Csub%2D.\n",
      "--------------\n",
      "ID: BBa_I11000\n",
      "Original Description: test\n",
      "Description: Test Dummy Part%3A Unknown! Sequence and Features Assembly Compatibility: 10COMPA%3B%3Csub%3E-Tet-%3D\n",
      "--------------\n",
      "ID: BBa_I11010\n",
      "Original Description: RBS\n",
      "Description: RBS ribosome binding site sequence and features assembly%3Ant%3Bcompatiblity with RFC%3D%3Csub%3E-RBS\n",
      "--------------\n",
      "ID: BBa_I12205\n",
      "Original Description: AraC\n",
      "Description: coding region for the arac protein. barcodes are discontinued, but one was appended to the end of the coding sequence.\n",
      "--------------\n",
      "ID: BBa_I13700\n",
      "Original Description: CheY\n",
      "Description: CheY renamed part:BBa_C0020 Sequence and Features Assembly Compatibility: 10, %7B%7D\n",
      "--------------\n",
      "ID: BBa_I13701\n",
      "Original Description: CheB\n",
      "Description: CheB Renamed C0024 Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH R, %7B%7D\n",
      "--------------\n",
      "ID: BBa_I13702\n",
      "Original Description: CheR\n",
      "Description: CheR renamed part%3BBBa_C0028 Sequence and Features Assembly Compatibility%3A %3Ci%3EBBa%3ECoD\n",
      "--------------\n",
      "ID: BBa_I15006\n",
      "Original Description: Cph8\n",
      "Description: Cph8 chimeric cph1/envz light receptor usage and biology -- please enter. %3Csub%3EluxR+ccdB(weak RBS)\n",
      "--------------\n",
      "ID: BBa_I20533\n",
      "Original Description: foo\n",
      "Description: foo bar sequence and features assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM, %3Ci%3e%3D\n",
      "--------------\n",
      "ID: BBa_I712002\n",
      "Original Description: CCR5\n",
      "Description: CCR5 is a HIV-1 co-receptor. sequence and features assembly compatibility%21%26%23963%3B10%23966%3B10.\n",
      "--------------\n",
      "ID: BBa_I712024\n",
      "Original Description: CD4\n",
      "Description: CD4 sequence for CD4 (glycoprotein expressed on the surface of T helper cells, Regulatory T cells, etc.)\n",
      "--------------\n",
      "ID: BBa_I714005\n",
      "Original Description: abc\n",
      "Description: abc florescence secondary structure file:mfold-i714005-1.png how these parts, %3A%3Csub%3E%3AC/Sub%3EDI%3B(Ci%3e-mfold)\n",
      "--------------\n",
      "ID: BBa_I7154\n",
      "Original Description: pLac\n",
      "Description: (see. part. bba_r0010, see part BBa_R0010 ) %27 %29 %26\n",
      "--------------\n",
      "ID: BBa_I716000\n",
      "Original Description: wbbL\n",
      "Description: wbbl is \"necessary for completion of the O16 and K1 gene clusters\" %26%23963%3B%3Block %3Csub%3E%3D\n",
      "--------------\n",
      "ID: BBa_I716001\n",
      "Original Description: neuS\n",
      "Description: neuS neus, with wbbL, \"necessary for completion of the O16, %3A wBBL%3D\n",
      "--------------\n",
      "ID: BBa_I716024\n",
      "Original Description: VHb\n",
      "Description: VHb bacterial hemoglobin sequence and features assembly Compatibility: 10COMPATIBLE WITH RFC%21%3A rbs/tetR%3A RFP%2A RBS%3D\n",
      "--------------\n",
      "ID: BBa_I716151\n",
      "Original Description: hemA\n",
      "Description: hema delta-aminolevulinate synthase sequence and features assembly compatibility%3A 10.0%3Csub%3E-terminator%3Ci%3EGFP\n",
      "--------------\n",
      "ID: BBa_I716153\n",
      "Original Description: hemB\n",
      "Description: hemB is an enzyme involved in the heme biosynthetic pathway. also called delta-Synthase\n",
      "--------------\n",
      "ID: BBa_I716154\n",
      "Original Description: hemC\n",
      "Description: hemC is an enzyme involved in the heme biosynthetic pathway. also called porphorhodopsin\n",
      "--------------\n",
      "ID: BBa_I716155\n",
      "Original Description: hemD\n",
      "Description: hemD is an enzyme involved in the heme biosynthetic pathway. also called uidA.\n",
      "--------------\n",
      "ID: BBa_I716209\n",
      "Original Description: ceaB\n",
      "Description: ceaB colicin activity protein - Dnase for bacteria self-destruct mechanism without a, %26%23963%3B\n",
      "--------------\n",
      "ID: BBa_I716252\n",
      "Original Description: sodC\n",
      "Description: SodC basic part for the chaperone/toxicity device, Sequence and Features Assembly Compatibility%3A 10COM%3Bseq%3D%3Esequence and Features\n",
      "--------------\n",
      "ID: BBa_I716255\n",
      "Original Description: edit\n",
      "Description: Edit edit Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC[10] 12COMPATIBILITY\n",
      "--------------\n",
      "ID: BBa_I716257\n",
      "Original Description: edit\n",
      "Description: edit edit Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM, Description%20%26%3B 12COMPATIBILITY%21%3B%3A12COMPATIBLE%3B With RFC\n",
      "--------------\n",
      "ID: BBa_I716270\n",
      "Original Description: edit\n",
      "Description: 10COMPATIBLE WITH RFC[10] 12COM, Compatibility with RFC%3D%3E%3Csub%3B%3ED%3A 12COMPATIBILITY%26%23963%3Csequence and\n",
      "--------------\n",
      "ID: BBa_I716301\n",
      "Original Description: otsA\n",
      "Description: otsA - what it does Sequence and Features Assembly Compatibility: 10INCOMPAT%3Assemblycompatibility%3B10Incomparable(sequence and features)\n",
      "--------------\n",
      "ID: BBa_I716331\n",
      "Original Description: ThpA\n",
      "Description: ThpA is very similar to OtsA and otsB, and this will help prevent de novo recombination\n",
      "--------------\n",
      "ID: BBa_I716333\n",
      "Original Description: ThpC\n",
      "Description: ThpC is very similar to OtsA and otsB, and this will help prevent deafness.\n",
      "--------------\n",
      "ID: BBa_I716334\n",
      "Original Description: ThpD\n",
      "Description: ThpD is very similar to OtsA and otsB, and this will help prevent de novo nystagmus.\n",
      "--------------\n",
      "ID: BBa_I720000\n",
      "Original Description: rpoN\n",
      "Description: this is the rpoN gene, producing sigma54. there is no promoter and gene is not regulated.\n",
      "--------------\n",
      "ID: BBa_I722003\n",
      "Original Description: er\n",
      "Description: er er Sequence and Features Assembly Compatibility%3A RBS%3E%3Ci%3ER er sequence and features assembly\n",
      "--------------\n",
      "ID: BBa_I723020\n",
      "Original Description: Pu\n",
      "Description: this is the promoter activated by the transcriptional regulator xylr in response to detection of environmental. ci.\n",
      "--------------\n",
      "ID: BBa_I723024\n",
      "Original Description: PhzM\n",
      "Description: PhzM is the first of two enzymes required to convert phenazine-1-carboxylic acid to phenylacetate\n",
      "--------------\n",
      "ID: BBa_I723025\n",
      "Original Description: PhzS\n",
      "Description: PhzS is the second enzyme required to convert phenazine-1-carboxylic acid to phenylpropionate.\n",
      "--------------\n",
      "ID: BBa_I725001\n",
      "Original Description: test\n",
      "Description: Test Test Sequence and Features Assembly Compatibility with RFC[10] 12COMPATIBILITY%3A 10Compatible With RFC(10%)\n",
      "--------------\n",
      "ID: BBa_I725010\n",
      "Original Description: test\n",
      "Description: test test Sequence and Features Assembly Compatibility: 10Compatible With RFC[10] 12COMPATIBLE WITH RBS [10]\n",
      "--------------\n",
      "ID: BBa_I726001\n",
      "Original Description: I\n",
      "Description: iGEM 2007 Team Parts I luxI Usage and Biology Sequence and Features Assembly Compatibility %3A LuxI\n",
      "--------------\n",
      "ID: BBa_I726002\n",
      "Original Description: R\n",
      "Description: iGEM 2007 Team Parts R luxR Usage and Biology Sequence and Features Assembly Compatibility, %3A rbs-lacZalpha-ccdB(weak RBS)\n",
      "--------------\n",
      "ID: BBa_I726003\n",
      "Original Description: IC\n",
      "Description: iGEM 2007 Team Parts IC luxI.C Usage and Biology Polycistronic IgG molecule\n",
      "--------------\n",
      "ID: BBa_I726004\n",
      "Original Description: RY\n",
      "Description: iGEM 2007 team parts ry luxR.y Usage and biology polycistronic splice variants\n",
      "--------------\n",
      "ID: BBa_I729000\n",
      "Original Description: FliC\n",
      "Description: FliC is the flagella protein monomer sequence and features assembly compatibility%3A 10COMPATIBLE WITH, Description%3B %3Ci%3E. bauma%3D\n",
      "--------------\n",
      "ID: BBa_I732100\n",
      "Original Description: LacI\n",
      "Description: Lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins. it inhibits tetracycline-dependent gene expression.\n",
      "--------------\n",
      "ID: BBa_I732101\n",
      "Original Description: LRLa\n",
      "Description: Repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different rbs sequences\n",
      "--------------\n",
      "ID: BBa_I732102\n",
      "Original Description: LRLb\n",
      "Description: repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different peptides.\n",
      "--------------\n",
      "ID: BBa_I732103\n",
      "Original Description: LRLc\n",
      "Description: Repression matrix reveals the binding affinity of different repressor candidate with various specific promoters by different %3Ci%3EGFPs\n",
      "--------------\n",
      "ID: BBa_I732104\n",
      "Original Description: LRLd\n",
      "Description: Repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different promoter types and GFPs\n",
      "--------------\n",
      "ID: BBa_I732997\n",
      "Original Description: TEST\n",
      "Description: Compatibility: 10Compatible with RFC[10]. 12Compatibility: %10B%10Csub%10D%10E-RFC(12)-Tet-%10A%10%20D%20Sub%10\n",
      "--------------\n",
      "ID: BBa_I741009\n",
      "Original Description: recA\n",
      "Description: recA - Sequence and Features assembly Compatibility: 10INCOMPATIBLE WITH RFC[10, 10], Description:\n",
      "--------------\n",
      "ID: BBa_I741049\n",
      "Original Description:  \n",
      "Description: 10Compatible with rfc[10] 12CompatIBLE WITH RFC[/10] %26%3Csub%3EregS[/10%3C/Tet-%3D\n",
      "--------------\n",
      "ID: BBa_I741108\n",
      "Original Description: a\n",
      "Description: a Sequence and Features Assembly%3A%3E 12COMPATIBLE WITH RFC[10] 12COMPATIBILITY%3D %3B%3C TERMINATOR\n",
      "--------------\n",
      "ID: BBa_I742107\n",
      "Original Description: COMT\n",
      "Description: COMT encodes caffeic acid-O-methyl transferase from alfalfa.%3A %3Ci%3EL.\n",
      "--------------\n",
      "ID: BBa_I745017\n",
      "Original Description: p148\n",
      "Description: p148 lentivirus helper plasmid with polymerase/integrase %3CBR%3D%3E%31%3Ci%3EGFP\n",
      "--------------\n",
      "ID: BBa_I745018\n",
      "Original Description: pLV\n",
      "Description: 10COMPATIBLE WITH RFC[10]12%3A pLV Lentiviral vector backbone %3Ci%3EGFP(weak RBS)\n",
      "--------------\n",
      "ID: BBa_I766204\n",
      "Original Description: Ste2\n",
      "Description: Ste2 encodes for the yeast protein Ste2, the integral membrane receptor for alpha-factor, a mating signal peptide.\n",
      "--------------\n",
      "ID: BBa_I766205\n",
      "Original Description: XhoI\n",
      "Description: Xhoi Restriction site. sequence and features assembly compatibility: 10COMPATIBLE WITH, %7B%7D\n",
      "--------------\n",
      "ID: BBa_I766206\n",
      "Original Description: XmaI\n",
      "Description: xmai restriction site sequence and features assembly compatable with RFC[, %7B%7D(sub%7E)\n",
      "--------------\n",
      "ID: BBa_I766210\n",
      "Original Description: GFP\n",
      "Description: GFP encodes for yeast enhanced monomeric green fluorescence protein. sequence and features assembly compatibility%3A GFP%3B%3Csub%3E.\n",
      "--------------\n",
      "ID: BBa_I769902\n",
      "Original Description: test\n",
      "Description: Test test Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]I%3Csubject(sequence and features)\n",
      "--------------\n",
      "ID: BBa_I769903\n",
      "Original Description: test\n",
      "Description: 10INCOMPATIBLE WITH RFC[10]I, Test Test Sequence and Features Assembly Compatibility%3A 10Incompatible with RFC[/10] I, test test sequence and features assembly\n",
      "--------------\n",
      "ID: BBa_J01086\n",
      "Original Description: Key3\n",
      "Description: this piece is the riboregulator complement intended for use with the J01080 part. it contains a small amount of ribose and a hexamer.\n",
      "--------------\n",
      "ID: BBa_J01087\n",
      "Original Description: Key4\n",
      "Description: Key4 -- No description -- Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[, Description] %7B%7Ci%7D%7E%7DSequence and Features\n",
      "--------------\n",
      "ID: BBa_J01088\n",
      "Original Description: Key5\n",
      "Description: Key5 -- No description -- Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC[, Description:\n",
      "--------------\n",
      "ID: BBa_J01089\n",
      "Original Description: Key6\n",
      "Description: Key6 -- No description -- Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[, %7B%7D]\n",
      "--------------\n",
      "ID: BBa_J01090\n",
      "Original Description: Key7\n",
      "Description: Key7 -- No description -- Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC%3Csub%3E%3B%3Answ.\n",
      "--------------\n",
      "ID: BBa_J01091\n",
      "Original Description: Key8\n",
      "Description: Key8 -- No description -- Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[, Description: %5B%5C%5D%5BD%5E%7D]\n",
      "--------------\n",
      "ID: BBa_J05829\n",
      "Original Description: Test\n",
      "Description: Test Test Sequence and Features Assembly Compatibility%21%3BINCOMPATIBLE WITH RFC[10]I%3CBR%3D%3E%3A %3B%3ECi%33%3ARP%31%3C\n",
      "--------------\n",
      "ID: BBa_J07006\n",
      "Original Description: malE\n",
      "Description: malE is the solute-binding protein member of the ABC transporter complex MalEFGK. It is involved in cell cycle control and signal transduction.\n",
      "--------------\n",
      "ID: BBa_J07021\n",
      "Original Description: FecR\n",
      "Description: FecR CDS Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[, Description: %7Brbs.src%7D%7E%7BTetR%3CBR%3D\n",
      "--------------\n",
      "ID: BBa_J07065\n",
      "Original Description: ToxR\n",
      "Description: ToxR Front side of tox_cell_signaling_by_dimerization_system%3A %3B%3Emergency_cell%3D%3Ci%3EL.\n",
      "--------------\n",
      "ID: BBa_J125000\n",
      "Original Description: aaa\n",
      "Description: 10compatible with RFC[10] 12incompatible with rfc, Description%3A %3Csub%3E-rfi%3D.\n",
      "--------------\n",
      "ID: BBa_J125001\n",
      "Original Description: aaa\n",
      "Description: Compatibility: 10compatible with RFC[10] 12incompatible with rfc, %21%23%23%3E12incompatibility%3E with RFP\n",
      "--------------\n",
      "ID: BBa_J17004\n",
      "Original Description: a\n",
      "Description: a a Sequence and Features Assembly Compatibility: 10Compatiable With RFC[10, RFC]%3A %3Ci%3Easy.assembly.dbl.\n",
      "--------------\n",
      "ID: BBa_J176000\n",
      "Original Description: hPCD\n",
      "Description: Polycomb chromodomain (PCD) from the human CBX8 protein (orange) crystallographic plasmon\n",
      "--------------\n",
      "ID: BBa_J176003\n",
      "Original Description: Ubc\n",
      "Description: Ubc promoter drives expression at a level below that of the human phosphoglycerate kinase YFP\n",
      "--------------\n",
      "ID: BBa_J176004\n",
      "Original Description: CFP\n",
      "Description: CFP humanized cerulean fluorescent protein sequence and features assembly compatibility%3A 10COMPATIBLE WITH, %26%23953%3B%3C %3EtetR%3B\n",
      "--------------\n",
      "ID: BBa_J176005\n",
      "Original Description: mCh\n",
      "Description: mCherry is a derivative of monomeric RFP from the mushroom coral discosoma sp. spp.\n",
      "--------------\n",
      "ID: BBa_J176006\n",
      "Original Description: YFP\n",
      "Description: YFP mammalian venus fluorescent protein sequence and features assembly%3A %3Ci%3D%3B%3E%3F(aspartic acid)\n",
      "--------------\n",
      "ID: BBa_J176007\n",
      "Original Description: KRAB\n",
      "Description: KRAB Transc. repression domain Sequence and Features Assembly Compatibility%3A 10COMPATIBLE%3E%3Ci%3EGFP\n",
      "--------------\n",
      "ID: BBa_J176008\n",
      "Original Description: NLS\n",
      "Description: Fluorophore-NLS fusions are handy for making glowing nuclei. PKKK%3A %3B%3Ci%3EB%3D%3CPK+NLS+CFP+I%3E\n",
      "--------------\n",
      "ID: BBa_J176013\n",
      "Original Description: VP64\n",
      "Description: VP64 Activation Domain Module is often fused to DNA binding domains to make strong synthetic transcription factors, %3Blog%3D\n",
      "--------------\n",
      "ID: BBa_J176016\n",
      "Original Description: STOP\n",
      "Description: STOP Contains stop codons TAA and TGA in frame Sequence and Features Assembly Compatibility %27%29E%29\n",
      "--------------\n",
      "ID: BBa_J176018\n",
      "Original Description: PEST\n",
      "Description: Proline - glutamic acid - serine - threonine (PEST) motif%3A GFP\n",
      "--------------\n",
      "ID: BBa_J176021\n",
      "Original Description: HS4\n",
      "Description: HS4 chicken beta-globin gene insulator sequence and features assembly compatibility with 10COMPAT recombinant proteins\n",
      "--------------\n",
      "ID: BBa_J176023\n",
      "Original Description: EED\n",
      "Description: EED Embryonic Ectoderm Development; PCR2 member; Polycomb silencing peptide. %3Csubject(s):\n",
      "--------------\n",
      "ID: BBa_J176027\n",
      "Original Description: CMV\n",
      "Description: cytomegalovirus promoter (CMV) promoter drives expression at a level greater than the %7BFP%7D%7BB%21%7D\n",
      "--------------\n",
      "ID: BBa_J176028\n",
      "Original Description: HPK\n",
      "Description: Human phosphoglycerate kinase promoter (HPK) promoter drives expression at a %3Ci%3E. coli K1270\n",
      "--------------\n",
      "ID: BBa_J176032\n",
      "Original Description: EF1a\n",
      "Description: EF1a EF-1 alpha promoter from pEF5/FRT/V5/TOF%3B%3Csub%3E.\n",
      "--------------\n",
      "ID: BBa_J176033\n",
      "Original Description: DPRE\n",
      "Description: DPRE HoxD 11-12 PRE element from human ESC's. s.d mut, %26%23963%3B%3B %3CBR%3E\n",
      "--------------\n",
      "ID: BBa_J176034\n",
      "Original Description: Gluc\n",
      "Description: Gluc excreted gaussia luciferase (from phGluc, addgenes%3CBR%3E%3A Glucexcreted Gaussia\n",
      "--------------\n",
      "ID: BBa_J176035\n",
      "Original Description: p65\n",
      "Description: p65 activation domain bioBrick%3A derived from amino acids 288 (Tyr, YYFP) and YFP\n",
      "--------------\n",
      "ID: BBa_J176036\n",
      "Original Description: SP1A\n",
      "Description: SP1A activation domain A from SP1; Emamai et al. 1995 sequence and features assembly, %3A\n",
      "--------------\n",
      "ID: BBa_J176037\n",
      "Original Description: Sp1B\n",
      "Description: SP1B activation domain B from SP1; Emamai et al. 1995 sequence and features assembly%3A %3B%3Csub%3Emamai-etl.\n",
      "--------------\n",
      "ID: BBa_J18958\n",
      "Original Description: eYFP\n",
      "Description: eYFP Enhanced Yellow Fluorescence Protein Sequence and Features Assembly Compatibility: 10COMPAT %3Csub%3E%3Analysis%3D%3Bsequencer%26%23973%3B%3\n",
      "--------------\n",
      "ID: BBa_J18960\n",
      "Original Description: eCFP\n",
      "Description: eCFP Enhanced Cyan Fluorescent Protein Sequence and Features Assembly Compatibility%3A 10COMPA, %3Ci%3E10-Cyanobacteria%3D\n",
      "--------------\n",
      "ID: BBa_J212099\n",
      "Original Description: test\n",
      "Description: test this is a test. sequence and features assembly compatibility: 10COMPATIBLE WITH RFC%3B%3D%3EXTENDED TO %3EDUPLICATED\n",
      "--------------\n",
      "ID: BBa_J212100\n",
      "Original Description: test\n",
      "Description: Test Only. Sequence and features assembly compatibility: 10INCOMPATIBLE WITH RFC, %26%237%236%3B05%237%3B%3Bdbl\n",
      "--------------\n",
      "ID: BBa_J212103\n",
      "Original Description: test\n",
      "Description: Test Test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM, %10Ci%10%10D%10E%5Csub%5D%5E/ci%5DS%5B%5\n",
      "--------------\n",
      "ID: BBa_J22051\n",
      "Original Description: Pcya\n",
      "Description: adenylate cyclase promoter that has been reported to oscillate in cell cycle %26%23703%3Bci%3EluxI-LVA%3Brbs.\n",
      "--------------\n",
      "ID: BBa_J22052\n",
      "Original Description: Pcya\n",
      "Description: adenylate cyclase promoter, cell cycle dependent, oscillates in a cell cycle dependant manner.\n",
      "--------------\n",
      "ID: BBa_J29000\n",
      "Original Description: CrtE\n",
      "Description: CrtE is the first of 3 enzymes that are used to produce lycopene (tomato pigment) lyase.\n",
      "--------------\n",
      "ID: BBa_J29001\n",
      "Original Description: CrtB\n",
      "Description: CrtB is the second of 3 an enzyme that is used to produce a lycopene(tetramethylcysteine)\n",
      "--------------\n",
      "ID: BBa_J29002\n",
      "Original Description: CrtI\n",
      "Description: CrtI is the third of 3 enzyme that is used to produce lycopene (Tomato pigment) from lysozyme\n",
      "--------------\n",
      "ID: BBa_J290045\n",
      "Original Description: test\n",
      "Description: Test Sequence and Features Assembly %3A 10COMPATIBLE WITH RFC(12COM)%3Csub%3E-10COMPATIBILITY(10COMPATIBLE))\n",
      "--------------\n",
      "ID: BBa_J29026\n",
      "Original Description: KaiA\n",
      "Description: KaiA I added stop codons \"TAATAA\" to KaiA gene. assembly compatibility%26%23963%3B\n",
      "--------------\n",
      "ID: BBa_J29027\n",
      "Original Description: KaiB\n",
      "Description: KaiB Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC[10] 12COMPATIBILITY%3EXT%3Ci%3ELEMENT%3D\n",
      "--------------\n",
      "ID: BBa_J29029\n",
      "Original Description: pbpA\n",
      "Description: pbp2 is a penicillin-binding protein from the penicillin family of bacteriophage. it binds penicillins to form a tetracycline-responsive complex.\n",
      "--------------\n",
      "ID: BBa_J29030\n",
      "Original Description: CrtY\n",
      "Description: CrtY is the last of 4 enzymes that is used to produce a beta-carotene peptide. %5Ci%5B%5D%5R\n",
      "--------------\n",
      "ID: BBa_J29032\n",
      "Original Description: LacI\n",
      "Description: LacI is a lactose operon repressor. sequence and features assembly compatibility, Inducible promoter and promoter.\n",
      "--------------\n",
      "ID: BBa_J29033\n",
      "Original Description: KaiC\n",
      "Description: KaiC a Sequence and Features Assembly Compatibility%3A RFC-%3ElacZalpha-ccdB(weak RBS)\n",
      "--------------\n",
      "ID: BBa_J29037\n",
      "Original Description: SasA\n",
      "Description: SasA is activated by interaction with KaiC. rc site found at 373 %26%23703%3B.\n",
      "--------------\n",
      "ID: BBa_J29038\n",
      "Original Description: CheZ\n",
      "Description: CheZ chemotactic response, CheY protein phophatase Sequence and Features Assembly, %26%233%3B%3Csub%3E-%3Assembly.seq.\n",
      "--------------\n",
      "ID: BBa_J29039\n",
      "Original Description: MinE\n",
      "Description: minE reverses minC inhibition of ftsz ring formation. Sequence and Features Assembly Compatibility (Sequence and Features)\n",
      "--------------\n",
      "ID: BBa_J29040\n",
      "Original Description: MinC\n",
      "Description: minC is cell division inhibitor, inhibits ftsz ring formation. assembly compatibility %3Csub%3EluxR%3AminC%3Breduces tetracycline reuptake\n",
      "--------------\n",
      "ID: BBa_J29041\n",
      "Original Description: MinD\n",
      "Description: MinD is a cell division inhibitor, a membrane ATPase, activates minC., MinD%3A Membrane %3E+minC+minD\n",
      "--------------\n",
      "ID: BBa_J29042\n",
      "Original Description: FtsZ\n",
      "Description: FtsZ is a tubulin-like cell division protein. sequence and features assembly compatibility, %26%23303%3B%3B\n",
      "--------------\n",
      "ID: BBa_J29043\n",
      "Original Description: a\n",
      "Description: a Sequence and Features AssemblyCompatibility: 10INCOMPATIBLE WITH RFC[10,11,13,14,15,16,17]\n",
      "--------------\n",
      "ID: BBa_J29044\n",
      "Original Description: test\n",
      "Description: Test Test Sequence and Features Assembly Compatibility%3A 10INCOMPATIBLE WITH RFC[10]I%3B%3Csub%3E%3D\n",
      "--------------\n",
      "ID: BBa_J29045\n",
      "Original Description: test\n",
      "Description: Test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM, Description: %5B Test test sequence and features assembly\n",
      "--------------\n",
      "ID: BBa_J29048\n",
      "Original Description: RBS\n",
      "Description: RBS strong rbs Sequence and Features Assembly (Sequence and Features) Compatibility with 10COMPATIBLE WITH RFC\n",
      "--------------\n",
      "ID: BBa_J29052\n",
      "Original Description: idi\n",
      "Description: idi This part encodes isopentenyl pyrophosphate which stimulates cartenogen (B0030)\n",
      "--------------\n",
      "ID: BBa_J32004\n",
      "Original Description: CcdA\n",
      "Description: Ccda control cell death a sequence and features assembly %3A 10COMPATIBLE WITH REACH%3Csub%3E-ci%3e-r-lcdA%3B-seq-rd-ccd\n",
      "--------------\n",
      "ID: BBa_J32010\n",
      "Original Description: ccdB\n",
      "Description: iGEM HQ CcdB without truncated ccdA clone, %26%236%233%3B%3Csub%3E %3A ci%3EB%3D%3AE\n",
      "--------------\n",
      "ID: BBa_J32020\n",
      "Original Description: AmpR\n",
      "Description: AmpR a Sequence and Features Assembly Compatibility%3A RFC%3E%3Csub%3ECodB%3CREB%3D with RFP(s)\n",
      "--------------\n",
      "ID: BBa_J32021\n",
      "Original Description: CmR\n",
      "Description: Cmr a Sequence and Features Assembly Compatibility%26%2370%3BRFC[10, %2370]%3Ci%3R%3ECmr%3E%3A RFC(short)\n",
      "--------------\n",
      "ID: BBa_J32023\n",
      "Original Description: BLIP\n",
      "Description: BLIP beta lactamase inhibitory protein which makes ampR containing cells suceptible to death, Description%3Csub%3E-BLIP\n",
      "--------------\n",
      "ID: BBa_J33202\n",
      "Original Description: lacZ\n",
      "Description: LacZ encodes the N-terminal 76 amino acid residues of lacZ. lacZ-delta%26%23705%3B%3C/Tet-%3ElacZ%3D.\n",
      "--------------\n",
      "ID: BBa_J37013\n",
      "Original Description: iGEM\n",
      "Description: Temporary igem sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10]12, %21%26%23%26%23963%3B%27%26%3B\n",
      "--------------\n",
      "ID: BBa_J40002\n",
      "Original Description: hihi\n",
      "Description: Hihi jy Sequence and Features Assembly Compatibility%3A RFC%3E%3Csub%3D%3Brfc(weak RBS) Type: Temporary, Information: hihi.jy\n",
      "--------------\n",
      "ID: BBa_J45987\n",
      "Original Description: tyrB\n",
      "Description: tyrB dd Sequence and Features Assembly %3A 10Incompatibility with, pBAS%3E%3Ci%3ECsub%3D%26%23703%3Csub%23707%3C/i\n",
      "--------------\n",
      "ID: BBa_J45991\n",
      "Original Description: fd\n",
      "Description: fd dfa Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC, %3Csub%3E%3D\n",
      "--------------\n",
      "ID: BBa_J47500\n",
      "Original Description: XylR\n",
      "Description: XylR atgTTTACTA AACGTCACCG CATCACATTA CTGT%3A %3B%3Csub%3E\n",
      "--------------\n",
      "ID: BBa_J51000\n",
      "Original Description: ComP\n",
      "Description: ComP is a transmembrane protein from B. subtilis. Upon binding to ComX, it binds to ComP.\n",
      "--------------\n",
      "ID: BBa_J51001\n",
      "Original Description: ComA\n",
      "Description: ComA is the response regulator for the ComQXPA quorum-sensing system of B. cerevisiae\n",
      "--------------\n",
      "ID: BBa_J52001\n",
      "Original Description: rluc\n",
      "Description: rluc renilla luciferase sequence and features assembly Compatibility%3A 10COMPA, %3Ci%3E-rluc%3D\n",
      "--------------\n",
      "ID: BBa_J52002\n",
      "Original Description: Ota\n",
      "Description: Ota dominant negative TRIF Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH R, %3B%3D%3Ci%3ECIM%3A%3EXTERNAL TRITF\n",
      "--------------\n",
      "ID: BBa_J52025\n",
      "Original Description: rLUC\n",
      "Description: Light is emitted when Renilla luciferase (rLUC) is activated by RBS (Rosa+RBS)\n",
      "--------------\n",
      "ID: BBa_J52990\n",
      "Original Description: alja\n",
      "Description: Alja alja Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10,10,11,12]\n",
      "--------------\n",
      "ID: BBa_J52996\n",
      "Original Description: jksd\n",
      "Description: Jksd kjsdhf Sequence and Features Assembly Compatibility%3A 10COMPA%3E%3Ci%3ELJKsd%3CPas%3ECL%3D(weak RBS)\n",
      "--------------\n",
      "ID: BBa_J54001\n",
      "Original Description: cytR\n",
      "Description: cytR transcriptional dual regulator,regulator for deo operon, udp(short name)%3A uDPI-shortname%3C %3B%3EspA-Short name\n",
      "--------------\n",
      "ID: BBa_J54002\n",
      "Original Description: galS\n",
      "Description: galS is a isorepressor of galR. assembly compatibility: 10COMPAT. galS.\n",
      "--------------\n",
      "ID: BBa_J54004\n",
      "Original Description: galR\n",
      "Description: galR is a repressor of galETK operon. sequence and features assembly compatibility, sequence and sequence.\n",
      "--------------\n",
      "ID: BBa_J54011\n",
      "Original Description: glpR\n",
      "Description: glpR ATGAAACACAACGTCACAACGGTATTATCGAACTGGTT%3Ci%3EGlpI%3ATGAAACCACAAAGGTATTC%3G%3EAGGTGGTT\n",
      "--------------\n",
      "ID: BBa_J54012\n",
      "Original Description: glpR\n",
      "Description: glp repressor sequence and features assemblyCompatibility: 10COMPATIBLE WITH RFC, %7B%3E%3Ci%3EGFP%21%26%3B%26%23703%3C/i%\n",
      "--------------\n",
      "ID: BBa_J5515\n",
      "Original Description: dsf\n",
      "Description: Dsf sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12 %7B%7D%7BTetR%7BDtrc%21%7D\n",
      "--------------\n",
      "ID: BBa_J5532\n",
      "Original Description: inv\n",
      "Description: inv inv Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC[10]%3E-Inverter%21%3A %3Ci%3EL-inv%3B %5D%5B\n",
      "--------------\n",
      "ID: BBa_J5759\n",
      "Original Description: Test\n",
      "Description: Test Test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COMPATIBILITY %10\n",
      "--------------\n",
      "ID: BBa_J58000\n",
      "Original Description: Test\n",
      "Description: Test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM, RFC [10]\n",
      "--------------\n",
      "ID: BBa_J59001\n",
      "Original Description: tuba\n",
      "Description: Tuba none Sequence and Features Assembly Compatibility: 10Compatible with RFC[10]12Compatibility with RBS\n",
      "--------------\n",
      "ID: BBa_J64006\n",
      "Original Description: RocE\n",
      "Description: RocE from b. subtilis, BG10933 Sequence and Features Assembly Compatibility, %3A BG10833-%3E%3C/SV40-%2Csub%3D-RocE\n",
      "--------------\n",
      "ID: BBa_J64007\n",
      "Original Description: TEVr\n",
      "Description: this sequence encodes an amino acid sequence recognized by TEV protease (ENLYFQS) for tetracycline-releasing enzyme (TetR)\n",
      "--------------\n",
      "ID: BBa_J64805\n",
      "Original Description: RocD\n",
      "Description: RocD from the RocDEF promoter,. subtilis sequence and features assembly., Requires cdc.\n",
      "--------------\n",
      "ID: BBa_J64806\n",
      "Original Description: RocE\n",
      "Description: RocE from B. subtilis sequence and features assembly%3A %3B10INCOMPAT%3C/%3E%3D%3EC 3.0\n",
      "--------------\n",
      "ID: BBa_J64991\n",
      "Original Description: TetR\n",
      "Description: TetR Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]12 %26%26%3B%3Csub%3EtetR\n",
      "--------------\n",
      "ID: BBa_J69998\n",
      "Original Description: Temp\n",
      "Description: Temp r0062 b0034 Sequence and Features Assembly Compatibility %7D%7B%21%7D\n",
      "--------------\n",
      "ID: BBa_J69999\n",
      "Original Description: Temp\n",
      "Description: Temporary Temp Sequence and Features Assembly Compatibility: 10Compatible with RFC[10,11,12,13]\n",
      "--------------\n",
      "ID: BBa_J70578\n",
      "Original Description: pylT\n",
      "Description: pylT%3Aggaaacctgatgatgatcggtagatctaaat%3B %3EGGAG%3CtetR%3D%3EBaac%3ECaspA%3\n",
      "--------------\n",
      "ID: BBa_J70598\n",
      "Original Description: VioA\n",
      "Description: VioA designed from Cambridge part Sequence and Features Assembly Compatibility: 10Compatible With RFC, %26%23966%3B%3A%3E-mail-archive.com!\n",
      "--------------\n",
      "ID: BBa_J70599\n",
      "Original Description: VioA\n",
      "Description: VioA designed from Cambridge part K274002 Converted to biobrick part by converting TGA to, %26%236%3B(E. coli optimised)\n",
      "--------------\n",
      "ID: BBa_J70600\n",
      "Original Description: VioB\n",
      "Description: VioB designed from Cambridge part K274002 Converted to BioBrick part by converting TAA to ribosomes\n",
      "--------------\n",
      "ID: BBa_J70601\n",
      "Original Description: VioC\n",
      "Description: VioC designed from Cambridge part K274002 Converted to BioBrick part by converting TGA to ribosomal promoter\n",
      "--------------\n",
      "ID: BBa_J70602\n",
      "Original Description: VioD\n",
      "Description: VioD Designed from Cambridge part K274002 Converted to BioBrick form by converting TG to ribosomal.\n",
      "--------------\n",
      "ID: BBa_J70603\n",
      "Original Description: VioE\n",
      "Description: VioE Designed from Cambridge part BBa_K274002 Converted to BioBrick form by VioB %3CBR%3E\n",
      "--------------\n",
      "ID: BBa_J72139\n",
      "Original Description: Pcon\n",
      "Description: Pcon constitutive promoter sequence and features assembly compatibility%3A RFC[10, %3Csub%3EccdB(weak RBS)\n",
      "--------------\n",
      "ID: BBa_J92213\n",
      "Original Description: test\n",
      "Description: Test Sequence and Features Assembly Compatibility%3B%3Element%3A RFC[10] 12COMPATIBILITY%3C/TetF%3ECL%3D\n",
      "--------------\n",
      "ID: BBa_J96013\n",
      "Original Description: HSTK\n",
      "Description: HSTK herpes simplex thymidine kinase conferring toxicity to, %26%23963%3B%3Ci%3E tetrachloroquine\n",
      "--------------\n",
      "ID: BBa_J96017\n",
      "Original Description: loxP\n",
      "Description: loxP sequence Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10,11,12,13]%3C/D/E%3E/B/C/I%3D%3A%3B/D\n",
      "--------------\n",
      "ID: BBa_J96023\n",
      "Original Description: MS2\n",
      "Description: MS2 phage coat domain binding to RNA at the MS2 binding site sequence. MS2 protein_protein_domain.jpg%2CBR%3D%3A%3Ci%3EL.\n",
      "--------------\n",
      "ID: BBa_J96026\n",
      "Original Description: BoxB\n",
      "Description: boxb lambda n peptide binding site sequence sequence. boxb n-peptide is a protein that binds to boxB-lambda\n",
      "--------------\n",
      "ID: BBa_J96031\n",
      "Original Description: EGFP\n",
      "Description: EGFP green fluorescent protein derived from jellyfish aequeora victoria wild-type %7B%7D\n",
      "--------------\n",
      "ID: BBa_J96035\n",
      "Original Description: FLAG\n",
      "Description: 10COMPATIBLE WITH RFC[10]12COMPATIBILITY: %3CBR%3EA%3CSequence%3D %5D%5Brfc%26%23EluxI%5CBRDF\n",
      "--------------\n",
      "ID: BBa_J96036\n",
      "Original Description: HA\n",
      "Description: HA HA affinity tag Sequence and Features Assembly Compatibility%3A RFC%3D%3E%3B %3Ci%3ELA%26%23703%3B(R)%3ECL%3EDB(rb\n",
      "--------------\n",
      "ID: BBa_J96037\n",
      "Original Description: His\n",
      "Description: His affinity tag Sequence and Features Assembly Compatibility%26%3B10COMPATIBLE WITH RFC[10]12%3Esama%3D%3Brc%3A%3Ci%3ELA%21%3D\n",
      "--------------\n",
      "ID: BBa_J96039\n",
      "Original Description: GST\n",
      "Description: GAP%3A GST affin tag sequence and features Assembly Compatibility%3B10INCOMPATIBLE WITH RFC[10, %5D]\n",
      "--------------\n",
      "ID: BBa_J96040\n",
      "Original Description: IRES\n",
      "Description: IRES Internal Ribosomal Entry Site Sequence and Features Assembly Compatibility: 10Compatibility%3A%3E10COMPATIBLE\n",
      "--------------\n",
      "ID: BBa_J96041\n",
      "Original Description: P2A\n",
      "Description: P2A 2A self cleaving peptide sequence and features assembly %3A 10COMPA%3D (Sequence)\n",
      "--------------\n",
      "ID: BBa_J96042\n",
      "Original Description: T2A\n",
      "Description: T2A 2A self cleaving peptide sequence and features assembly compatibility%3A 10COMPA, %3Ci%3E-T2A.\n",
      "--------------\n",
      "ID: BBa_J96043\n",
      "Original Description: PS3\n",
      "Description: PS3 Short Dna sequence with ribosome recruitment properties (mini-IRES) sequence and features assembly, %26%235%235%3B.\n",
      "--------------\n",
      "ID: BBa_J96044\n",
      "Original Description: PS4\n",
      "Description: PS4 Short Dna sequence with ribosome recruitment properties (mini-IRES) sequence and features assembly %3Ana%3Csub%3EP.\n",
      "--------------\n",
      "ID: BBa_J96045\n",
      "Original Description: CMV\n",
      "Description: CMV promoter sequence sequence Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[DescRIPTION]\n",
      "--------------\n",
      "ID: BBa_K076002\n",
      "Original Description: Ngn1\n",
      "Description: Ngn1 is a transcription factor that promotes the differentiation of embryonic stem cells into particular types of neurotrophic cell types.\n",
      "--------------\n",
      "ID: BBa_K076004\n",
      "Original Description: EYFP\n",
      "Description: EYFP (Enhanced Yellow Fluorescent Protein)%3A 10Income-%3EYFP%3D%3Ci%3EB.\n",
      "--------------\n",
      "ID: BBa_K076009\n",
      "Original Description: Lbx1\n",
      "Description: Lbx1 encodes for a cell fate regulator that allows cells to express GABAergic inhibitory neurotransmitters in vitro\n",
      "--------------\n",
      "ID: BBa_K078102\n",
      "Original Description: dxnB\n",
      "Description: there is currently no text in this page. you can search for this page title in other pages, or search the database for the page title.\n",
      "--------------\n",
      "ID: BBa_K079012\n",
      "Original Description: mbv \n",
      "Description: mbvmb Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC[, Features]\n",
      "--------------\n",
      "ID: BBa_K079013\n",
      "Original Description: fs\n",
      "Description: 10COMPATIBLE WITH RFC[10] 12COM, fs sequence and features assembly compatibility%10 of %10%102%103%105%106%101%10COMpatible with RFC(10%)\n",
      "--------------\n",
      "ID: BBa_K079022\n",
      "Original Description: ..\n",
      "Description: %7Ci%7D%7Bsequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12IN\n",
      "--------------\n",
      "ID: BBa_K079025\n",
      "Original Description: ..\n",
      "Description: .. assembly Compatibility: 10COMPATIBLE WITH RFC[10].. 12, %21%26%27%26%3B%3Ci%3D%3E%3B %3A RFC%3ECi\n",
      "--------------\n",
      "ID: BBa_K079027\n",
      "Original Description: ...\n",
      "Description: 10Compatible with RFC[10] 12INC. %3ArcSequence and Features Assembly Compatibility:\n",
      "--------------\n",
      "ID: BBa_K079028\n",
      "Original Description: ...\n",
      "Description: .... Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]12IN, Description: %7B%7D\n",
      "--------------\n",
      "ID: BBa_K079033\n",
      "Original Description: ...\n",
      "Description: ... Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]12INCH%26%23963%3B%24%23966%3B12Inch%27%23965%3BASE%3A%3B\n",
      "--------------\n",
      "ID: BBa_K079034\n",
      "Original Description: ..\n",
      "Description: 10, Compatibility: 10compatible with RFC[10].. 12, Description: %7Distribution%7Benchmark%23%7D.\n",
      "--------------\n",
      "ID: BBa_K079035\n",
      "Original Description: ..\n",
      "Description: %7Brbs%7D%7BD%7Csub%7DSB%7CDB%3C/sub%3D%3E%3A RFC[10]..\n",
      "--------------\n",
      "ID: BBa_K091109\n",
      "Original Description: LuxS\n",
      "Description: LuxS is a synthase that produces DPD, which spontaneously forms the AI-2 signaling peptide. LuxS promotes apoptosis of AI-2\n",
      "--------------\n",
      "ID: BBa_K091156\n",
      "Original Description: pLux\n",
      "Description: pLux is a modified version of BBa_R0062 containing the -35 region. %3BPlux%3B%3CBR%3E%3A pLaux%21%3C/TetR\n",
      "--------------\n",
      "ID: BBa_K092902\n",
      "Original Description: test\n",
      "Description: Test Test Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC[10] 12COMPATIBILITY\n",
      "--------------\n",
      "ID: BBa_K094001\n",
      "Original Description: CheZ\n",
      "Description: 10Compatible with RFC[10] 12INCOMPATIBLE WITH rfc[12] %26%26%23706%3B%22%23707%3D%3E%3A rbs/src/b\n",
      "--------------\n",
      "ID: BBa_K094113\n",
      "Original Description: lacZ\n",
      "Description: lacZ the cheY* gene is installed in front of a lacI operon. this lacI, lacZ operon contains the lacI repressor gene.\n",
      "--------------\n",
      "ID: BBa_K103010\n",
      "Original Description: OmpA\n",
      "Description: Ompa Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC(12)%26%23703%3B121003%3A12100%3B12%3E%3Csub%3E-%3A%3D\n",
      "--------------\n",
      "ID: BBa_K104000\n",
      "Original Description: tp53\n",
      "Description: tp53 Tumour protein p53 - Guardian of the Genome Sequence and Features Assembly comp %3A gp300\n",
      "--------------\n",
      "ID: BBa_K1051501\n",
      "Original Description: Cln3\n",
      "Description: Cln3 Cln3, prolong the cell cycle. assembly compatibility: 10COMPATIBLE WITH R, Description%3A %3Ci%3EGFP(Cln3)\n",
      "--------------\n",
      "ID: BBa_K106026\n",
      "Original Description: Sir3\n",
      "Description: Sir3 is a protein that interacts with sir4 and sir2 to silence DNA. Assembly comp, %10B%10D\n",
      "--------------\n",
      "ID: BBa_K108000\n",
      "Original Description: MutS\n",
      "Description: MutS methyl-directed mismatch repair protein of e. coli sequence and features assembly compatibility%3A 10, %3CBR%3E(E.coli)%21%3Ci%3D\n",
      "--------------\n",
      "ID: BBa_K108001\n",
      "Original Description: SRRz\n",
      "Description: SRRz enterobacteria phage lambda lysis genes sequence and features assembly compatibility %26%23963%3B1.\n",
      "--------------\n",
      "ID: BBa_K108002\n",
      "Original Description: FlgA\n",
      "Description: flaga assembly protein for flagellar basal body periplasmic P ring of e. coli %3B/%3E.\n",
      "--------------\n",
      "ID: BBa_K108003\n",
      "Original Description: FlgB\n",
      "Description: Flagellar component of cell-proximal portion of basal-body rod of e.coli %3Csub%3E.coli%3B(I)%3EC5%3E\n",
      "--------------\n",
      "ID: BBa_K108004\n",
      "Original Description: FlgC\n",
      "Description: Flagellar component of cell-proximal portion of basal-body rod of e. coli.%3Ci%3ECat%3E.coli%3A %26%23706%3B%3B(i)tet\n",
      "--------------\n",
      "ID: BBa_K108005\n",
      "Original Description: FlgH\n",
      "Description: flagellar protein of basal-body outer-membrane l ring of e.coli, %3Ci%3E\n",
      "--------------\n",
      "ID: BBa_K108006\n",
      "Original Description: FlgI\n",
      "Description: FlgI Flagellar basal body protein of e.coli Sequence and Features Assembly Compatibility%22%23963%3B%3Ci%3EGFP\n",
      "--------------\n",
      "ID: BBa_K108007\n",
      "Original Description: FliD\n",
      "Description: flagellar filament capping protein of e.coli Sequence and Features Assembly Compatibility: 10COMPA%3Assembly%3B%3C/dbs.\n",
      "--------------\n",
      "ID: BBa_K108008\n",
      "Original Description: FliI\n",
      "Description: Flagellum-specific ATP synthase of e.coli sequence and features assembly%3A %3Ci%3ElacZalpha-ccdB(weak RBS)\n",
      "--------------\n",
      "ID: BBa_K108009\n",
      "Original Description: FliK\n",
      "Description: Flagellar hook-length control protein of e.coli Sequence and Features Assembly Compatibility%3A 10COMP%3D\n",
      "--------------\n",
      "ID: BBa_K108010\n",
      "Original Description: FliM\n",
      "Description: flagellar motor switching and energizing component of e. coli sequence and features assembly compatibility, %7D\n",
      "--------------\n",
      "ID: BBa_K108011\n",
      "Original Description: FliN\n",
      "Description: Flagellar motor switching and energizing component of e.coli Sequence and Features Assembly Compat(R)%3A GFP%3Csub%3E.coli\n",
      "--------------\n",
      "ID: BBa_K108012\n",
      "Original Description: MotA\n",
      "Description: motA proton conductor component of flagella motor of e.coli Sequence and Features Assembly Compat, motA%3A %3B motA\n",
      "--------------\n",
      "ID: BBa_K108013\n",
      "Original Description: YcgR\n",
      "Description: Ycgr protein involved in flagellar function of e.coli %26%3Ci%3ElacZalpha-ccdB(weak RBS)\n",
      "--------------\n",
      "ID: BBa_K108014\n",
      "Original Description: PR\n",
      "Description: PR promoter of alcaligenes eutrophus phar gene Sequencing and Features Assembly Comp, Description%3A %3E%3Ci%3EB. et al.\n",
      "--------------\n",
      "ID: BBa_K108015\n",
      "Original Description: PhaR\n",
      "Description: PhaR polyhydroxyalkanoate synthesis repressor of alcaligenes eubacterium sp.\n",
      "--------------\n",
      "ID: BBa_K108016\n",
      "Original Description: PP\n",
      "Description: PP promoter of Alcaligenes eutrophus PhaP gene sequence and features assembly comp, %26%26%23963%3B%3Csubtet%3E/TetR primer\n",
      "--------------\n",
      "ID: BBa_K108017\n",
      "Original Description: PhaP\n",
      "Description: phasin protein of alcaligenes eutrophus sequence and features assembly compatibility%3A %3CBR%3E(E. coli optimised)\n",
      "--------------\n",
      "ID: BBa_K108019\n",
      "Original Description: PhbC\n",
      "Description: PhbC poly-beta-hydroxybutyrate polymerase of wautersta eutropha %3C/Tet-%3E\n",
      "--------------\n",
      "ID: BBa_K108020\n",
      "Original Description: Dam\n",
      "Description: dam causes DNA methylation within the sequence GATC, preventing cleavage by the MboI. dam causes a GFP-like phenotype with a pBAD-like sequence.\n",
      "--------------\n",
      "ID: BBa_K108021\n",
      "Original Description: Fis\n",
      "Description: fis is an activator of ribosomal RNA transcription as well as other genes. it, Description: Fis acts as a repressor of rbs.\n",
      "--------------\n",
      "ID: BBa_K108022\n",
      "Original Description: RuvA\n",
      "Description: in the presence of ATPase. Inducible repressible activator of phosphorylation of ribosomal proteins\n",
      "--------------\n",
      "ID: BBa_K108023\n",
      "Original Description: RuvB\n",
      "Description: RuvB ATP-dependent DNA helicase, component of resolvasome, of e. coli %3B%3C/Tet-%3E.\n",
      "--------------\n",
      "ID: BBa_K108024\n",
      "Original Description: RuvC\n",
      "Description: RuvC is a nuclease that resolves Holliday junction intermediates in genetic recombinant cells.\n",
      "--------------\n",
      "ID: BBa_K108025\n",
      "Original Description: Pu\n",
      "Description: Pu promoter of pseudomonas putida XylUWCMA%3B%21%23963%3B3%3A %26%2396966%3B\n",
      "--------------\n",
      "ID: BBa_K108026\n",
      "Original Description: XylA\n",
      "Description: XylA xylose isomerase of pseudomonas putida. %26%237%3B%3C e. coli %3A\n",
      "--------------\n",
      "ID: BBa_K108027\n",
      "Original Description: XylM\n",
      "Description: XylM xylene monooxygenase of pseudomona, %26%23963%3B%3Csub%3E(sub%3)\n",
      "--------------\n",
      "ID: BBa_K108028\n",
      "Original Description: XylB\n",
      "Description: XylB xylulokinase of Pseudomonas cerevisiae\n",
      "--------------\n",
      "ID: BBa_K108029\n",
      "Original Description: XylS\n",
      "Description: XylS regulatory protein of Pseudomonas putida xyl S, %26%23963%3B %3Csub%3E. cylophilus sp.\n",
      "--------------\n",
      "ID: BBa_K112900\n",
      "Original Description: Pbad\n",
      "Description: This part is in BBb Format. it is flanked by BamHI and BglII, %3Ci%3EGFP\n",
      "--------------\n",
      "ID: BBa_K112901\n",
      "Original Description: ccdB\n",
      "Description: iGEM HQ, flanked by BamHI and rbs/TetR. %3CBR%3E%3D%3ACi%3EBamHI\n",
      "--------------\n",
      "ID: BBa_K112907\n",
      "Original Description: Pcon\n",
      "Description: Pcon a constitutive promoter sequence and features assembly compatability with RBS%3A%3CBR%3E%3D%3EC5%3D\n",
      "--------------\n",
      "ID: BBa_K113006\n",
      "Original Description: RFP\n",
      "Description: RFP RFP Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC[10,11]%3C/TetR/TFV%3E\n",
      "--------------\n",
      "ID: BBa_K113020\n",
      "Original Description: GFP\n",
      "Description: GFP%3Csub%3E%3A BBa_I719015(weak RBS)%3EC percentage3C/TetR%3D%3CC%3B %3G%3EGFP\n",
      "--------------\n",
      "ID: BBa_K121000\n",
      "Original Description: test\n",
      "Description: Temporary Test Sequence and Features Assembly Compatibility%3A 10compatible with RFC[10,10]%3E12COMPARED WITH RFC(11,10,12)\n",
      "--------------\n",
      "ID: BBa_K121005\n",
      "Original Description: test\n",
      "Description: test This is test Sequence and Features Assembly Compatibility: 10ComPATIBLE WITH RFC[10] %3A%3B%3Elite%3Csubtilization%3D\n",
      "--------------\n",
      "ID: BBa_K121006\n",
      "Original Description: test\n",
      "Description: Test teast Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10%20%20Rci%20A%20Brbs%20compatibility]\n",
      "--------------\n",
      "ID: BBa_K121097\n",
      "Original Description: test\n",
      "Description: Test test Sequence and Features Assembly Compatibility with RFC[10] 12COMPATIBILITY%3A 10COMPATIBLE WITH RFC(12)\n",
      "--------------\n",
      "ID: BBa_K121098\n",
      "Original Description: test\n",
      "Description: Test Test Sequence and Features Assembly Compatibility%3A 10Compatible With RFC[10] 12COMPLEX%3E.CEL%3ESequence%3B%3C/TetF%3D%3ECL%3\n",
      "--------------\n",
      "ID: BBa_K121099\n",
      "Original Description: test\n",
      "Description: Temporary test Sequence and Features Assembly Compatibility: 10Compatible With RFC[10] 12COMPATIBILITY %20%23706%3B12COMPATIBLE WITH RFC(12COM)\n",
      "--------------\n",
      "ID: BBa_K121998\n",
      "Original Description: test\n",
      "Description: test test Sequence and Features Assembly Compatibility: 10Compatible with RFC[10] 12COMPLICATION%3A%3E%3CBR(100)\n",
      "--------------\n",
      "ID: BBa_K123003\n",
      "Original Description: ER\n",
      "Description: when estrogen is present the receptor binds to it and forms a homodimer. this homod is a tetracycline-dependent receptor for oestrogen.\n",
      "--------------\n",
      "ID: BBa_K125505\n",
      "Original Description: sE\n",
      "Description: sE se master switch Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH R, Description: %26%23966%3B%21%3Ci%3E%3ESe-se master switch\n",
      "--------------\n",
      "ID: BBa_K130000\n",
      "Original Description: srlD\n",
      "Description: srlD ORF encoding for sorbitol dehydrogenase%3A%3CBR%3E(weak RBS)\n",
      "--------------\n",
      "ID: BBa_K130001\n",
      "Original Description: lipD\n",
      "Description: LipD from white rot fungus (Phanerochaete chrysosporia sp.)\n",
      "--------------\n",
      "ID: BBa_K132018\n",
      "Original Description: araC\n",
      "Description: arac araC+B0010+b0012 Sequence and Features Assembly Compatibility%3A 10.0.0-%3Elac %3Csub%3D%3EB0012\n",
      "--------------\n",
      "ID: BBa_K133016\n",
      "Original Description: CF\n",
      "Description: CF – chimeric fusion protein, which retains the central, most antigenic segment of H. cerevisiae\n",
      "--------------\n",
      "ID: BBa_K133025\n",
      "Original Description: LPP\n",
      "Description: LPP is a lipopolypeptide that activates TLR1, TLR2, TLR6. %26%23963%3Brbs.com.au.\n",
      "--------------\n",
      "ID: BBa_K133052\n",
      "Original Description: UB33\n",
      "Description: Urease epitope UB33 is a peptide derived from the catalytic site of urase.\n",
      "--------------\n",
      "ID: BBa_K133057\n",
      "Original Description: HpaA\n",
      "Description: neuraminyllactose-binding hemagglutininin from helicobacter pylori\n",
      "--------------\n",
      "ID: BBa_K133059\n",
      "Original Description: RGD\n",
      "Description: RGD is arginine-glycine-aspartic amino acid sequence, present on several extracellular membranes. RGD%3A Arginine - Glycine - Aspartic Acid Sequence\n",
      "--------------\n",
      "ID: BBa_K133066\n",
      "Original Description: GFP\n",
      "Description: GFP green fluorescence protein (mCerulean) WITHOUT stop codon %27 nucleotidazole\n",
      "--------------\n",
      "ID: BBa_K133071\n",
      "Original Description: UreB\n",
      "Description: UreB is a subunit of enzyme urease, composed of A and B subunits. it consists of a ribonucleotide and a nucleoside.\n",
      "--------------\n",
      "ID: BBa_K133140\n",
      "Original Description: GpA\n",
      "Description: Transmembrane region used as a membrane anchor and dimerization domain of glycophorin gene. %7D%7Brbs%7Ci%3E(N-terminal)%26%23703%7D)\n",
      "--------------\n",
      "ID: BBa_K134900\n",
      "Original Description: GFP\n",
      "Description: GFP this is the gfp protein sequence and features assembly compatibility%3A 10COMPATIBLE WITH%3EGFP%3B%3Csub%3E rbs.\n",
      "--------------\n",
      "ID: BBa_K137000\n",
      "Original Description: katE\n",
      "Description: katE catalase information is collated here to help future users of the BioBrick registry. katA, katB and katC expression profiles are collected here.\n",
      "--------------\n",
      "ID: BBa_K137001\n",
      "Original Description: LacY\n",
      "Description: LacY%3A beta-galactoside permease which regulates the transport of lactose into erythritol\n",
      "--------------\n",
      "ID: BBa_K137007\n",
      "Original Description: fimE\n",
      "Description: fimE gene sequence and features assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12 %5B%5R%5EFIME%5BRFC%5D\n",
      "--------------\n",
      "ID: BBa_K137015\n",
      "Original Description: LacY\n",
      "Description: LacY%3A Lactose Permease Sequence and Features Assembly Compatibility: 10Compatible with: 10COMPATIBLE WITH %3EXPRESS\n",
      "--------------\n",
      "ID: BBa_K137052\n",
      "Original Description: tetA\n",
      "Description: tetA sequence codes only for resistance cassette. assembly compatibility: 10COMPATIBLE with: rbs.\n",
      "--------------\n",
      "ID: BBa_K137067\n",
      "Original Description: katG\n",
      "Description: katG is a bifunctional enzyme, displaying both catalase activity and broad-spectrum peroxidase.\n",
      "--------------\n",
      "ID: BBa_K137111\n",
      "Original Description: lamB\n",
      "Description: LamB Assembly Compatibility with rfc(10-10)%26%23303%3B12-%3Elements%3Csub%3AlamB(-%)%3D%3ECease\n",
      "--------------\n",
      "ID: BBa_K137112\n",
      "Original Description: lamB\n",
      "Description: lamB is the a porin protein which is part of the maltose pathway. it is a %26%26%23701%3B rbs %3A of the tetracycline-induced reuptake\n",
      "--------------\n",
      "ID: BBa_K137113\n",
      "Original Description: rcsA\n",
      "Description: rcsA is a gene responsible for regulating capsule synthesis. it has also been shown to, Description%3A rbsA%3C/TetR%3EccneolacZalpha-cyclin\n",
      "--------------\n",
      "ID: BBa_K141000\n",
      "Original Description: Ucp1\n",
      "Description: The uncoupling protein UCP1 is a proton carrier characteristic of brown adipose tissue. It contains a coding sequence and a protein peptide.\n",
      "--------------\n",
      "ID: BBa_K141001\n",
      "Original Description: Ucp-\n",
      "Description: our mutant strains do not have the same growing rate as Ucp+ when they are expressing the protein. %7Bci%7D%7BAdbl%26%7D\n",
      "--------------\n",
      "ID: BBa_K142077\n",
      "Original Description: pMA\n",
      "Description: pMA amp resistance plasmid%3A 10INCOMPA%3C/TetR%3E%3D%3CPlasmA%3CE%3B%3BAsI%3F(weak RBS)%3\n",
      "--------------\n",
      "ID: BBa_K147000\n",
      "Original Description: cheZ\n",
      "Description: cheZ motility protein is a protein kinase which dephosphorylates cheY %3Ci%3E\n",
      "--------------\n",
      "ID: BBa_K147002\n",
      "Original Description: xylE\n",
      "Description: xylE encodes the enzyme catechol 2,3-dioxygenase. catalytically catalase %7D%7B converts catechol to ethanol\n",
      "--------------\n",
      "ID: BBa_K147003\n",
      "Original Description: ohbA\n",
      "Description: ohbA is a subunit of the ortho-halobenzoate 1,2-dioxy-1,4-dioxinase.\n",
      "--------------\n",
      "ID: BBa_K149000\n",
      "Original Description: test\n",
      "Description: Test asfasf Sequence and Features Assembly Compatibility%3A 10Compatible With RFC%3D%3EYE%3CSUB%3B %3ESequences and Features\n",
      "--------------\n",
      "ID: BBa_K150006\n",
      "Original Description: oriT\n",
      "Description: oriT - Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10, 0]%7D%7B%3D %7C RBS%3E %21%7D(%2D)\n",
      "--------------\n",
      "ID: BBa_K150108\n",
      "Original Description: test\n",
      "Description: Test Test Sequence and Features Assembly Compatibility%3A 10Compatible With RFC[10]12COMPATIBILITY%3E 10COMPATIBLE WITH RFC(10,11)\n",
      "--------------\n",
      "ID: BBa_K153006\n",
      "Original Description: BarA\n",
      "Description: 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 132, %3A rbs.\n",
      "--------------\n",
      "ID: BBa_K157043\n",
      "Original Description: CFP\n",
      "Description: CFP CFP under the control of a CMV promoter. sequence and features assembly compatibility %26%23976%3B%3CBR%3A CMV Promoter and CFP\n",
      "--------------\n",
      "ID: BBa_K174010\n",
      "Original Description: KinA\n",
      "Description: spo0A is the master regulator of sporulation in B. subtilis. activation of spo1 and spo2 genes.\n",
      "--------------\n",
      "ID: BBa_K177045\n",
      "Original Description: temp\n",
      "Description: temp temp Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM %3B%3Csub%3E%3A%3D(-%)\n",
      "--------------\n",
      "ID: BBa_K185013\n",
      "Original Description: SmpB\n",
      "Description: SmpB is an essential part of e. coli rescue system, together with tmRNA. It is a ribonucleotidyltransferase (TetR)\n",
      "--------------\n",
      "ID: BBa_K185021\n",
      "Original Description: xxx\n",
      "Description: xxx None Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10], Description: %7D%7Brit%3A RFC%3D\n",
      "--------------\n",
      "ID: BBa_K187028\n",
      "Original Description: trpA\n",
      "Description: trpA encodes the alpha subunit of tryptophan synthase. it is a ribosome degrading enzyme.\n",
      "--------------\n",
      "ID: BBa_K187030\n",
      "Original Description: trpC\n",
      "Description: trpC is a bifunction enzyme that serves as both indole-3-glycerol (ICG) and tetracycline (TGT)\n",
      "--------------\n",
      "ID: BBa_K187031\n",
      "Original Description: trpD\n",
      "Description: trpD encodes anthranilate synthase component II. it catalyzes the degradation of alanilate\n",
      "--------------\n",
      "ID: BBa_K187032\n",
      "Original Description: trpE\n",
      "Description: trpE encodes anthranilate synthase component I, in the tryptophyton %3Csub%3E.\n",
      "--------------\n",
      "ID: BBa_K188004\n",
      "Original Description: fsfa\n",
      "Description: fsfa afasf Sequence and Features Assembly Compatibility%3A 10COMPAT%3Csub%3E-AfaS-Freiburg-Standard\n",
      "--------------\n",
      "ID: BBa_K188009\n",
      "Original Description: sa\n",
      "Description: sa asdf sequence and features assembly compatible with RFC%3Csub%3E-RFC%3D-Sequence and features\n",
      "--------------\n",
      "ID: BBa_K188027\n",
      "Original Description: luxI\n",
      "Description: luxi luxI Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10-CBD-LVA]\n",
      "--------------\n",
      "ID: BBa_K188028\n",
      "Original Description: test\n",
      "Description: Test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COMPATIBILITY%10DESCRIPTION%10\n",
      "--------------\n",
      "ID: BBa_K188341\n",
      "Original Description: tetR\n",
      "Description: tetR x Sequence and Features Assembly Compatibility%3ArcI%3Ci%3E. coli %3B%3CSequence and Features\n",
      "--------------\n",
      "ID: BBa_K188661\n",
      "Original Description: ccdB\n",
      "Description: ccdb%3A withdrawn from the Registry. samples of parts containing the C. crataepsi sp.\n",
      "--------------\n",
      "ID: BBa_K188774\n",
      "Original Description: no.1\n",
      "Description: LacI protein can bind to pLacI and repress the expression, but lactose, %26%23963%3B%3Csub%3E%3AlacI\n",
      "--------------\n",
      "ID: BBa_K188777\n",
      "Original Description: aka\n",
      "Description: Conjugation%3A aka zx Sequence and Features Assembly Compatibility%3B10COMPATIBLE WITH RFC[10,11,12,13,14]\n",
      "--------------\n",
      "ID: BBa_K188778\n",
      "Original Description: as\n",
      "Description: 10Compatible With RFC[10] 12COMPATIBLE WITH RFC(12COM)%26%3B%3As as as Sequence and Features Assembly\n",
      "--------------\n",
      "ID: BBa_K188779\n",
      "Original Description: no.6\n",
      "Description: There is currently no text in this page. you can search for this page title in other pages, or search the internet for more information.\n",
      "--------------\n",
      "ID: BBa_K188900\n",
      "Original Description: 1234\n",
      "Description: 10COMPATIBLE WITH RFC[10, RFC] - 1234 1234 Sequence and Features Assembly Compatibility %3A with RFC(10, rc)\n",
      "--------------\n",
      "ID: BBa_K188901\n",
      "Original Description: test\n",
      "Description: Test Test Sequence and Features Assembly Compatibility: 10Compatible With RFC[10] 12COMPATIBLE WITH RFC(10]\n",
      "--------------\n",
      "ID: BBa_K188902\n",
      "Original Description: test\n",
      "Description: test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM, 10COMPATIBILITY\n",
      "--------------\n",
      "ID: BBa_K188903\n",
      "Original Description: test\n",
      "Description: test test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COMPATIBILITY\n",
      "--------------\n",
      "ID: BBa_K188904\n",
      "Original Description: test\n",
      "Description: Test Sequence and Features Assembly Compatibility with RFC[10] 12COMPATIBLE WITH RFC [10]12COMPATIBILITY%3A 10Compatible With RFC(10, 10+12)\n",
      "--------------\n",
      "ID: BBa_K188905\n",
      "Original Description: test\n",
      "Description: test test Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC[10] 12COM, Test Test Sequence\n",
      "--------------\n",
      "ID: BBa_K190001\n",
      "Original Description: gvpA\n",
      "Description: gvpA is a gas vesicle gene identified in bacillus megaterium (BamHI)\n",
      "--------------\n",
      "ID: BBa_K190004\n",
      "Original Description: gvpB\n",
      "Description: gvpB is thought to be one of the proteins forming the vesicle itself %26%23963%3B%23966%3B %3Ci%3E%3D %7B%21%7D%7\n",
      "--------------\n",
      "ID: BBa_K190014\n",
      "Original Description: gvpU\n",
      "Description: gas vesicle gene identified in bacillus megaterium. forms part of the gp100 chromosome.\n",
      "--------------\n",
      "ID: BBa_K190018\n",
      "Original Description: HmtA\n",
      "Description: HmtA Heavy Metal Transporter A is able to transport copper ions across the membrane (and to the nuclease)\n",
      "--------------\n",
      "ID: BBa_K190019\n",
      "Original Description: fMT \n",
      "Description: fMT is a metallothionein, binding arsenite(III) and ars(II)-binding peptide\n",
      "--------------\n",
      "ID: BBa_K190020\n",
      "Original Description: MymT\n",
      "Description: MymT is a methallothionein binding copper (II) ions. it is responsible for the formation of copper ions in cells.\n",
      "--------------\n",
      "ID: BBa_K190021\n",
      "Original Description: SmtA\n",
      "Description: SmtA is a metallothionein that binds Zn (II), which carries a conserved promoter.\n",
      "--------------\n",
      "ID: BBa_K190028\n",
      "Original Description: GlpF\n",
      "Description: GlpF is an aquaglycerol porin of E. coli which facilitates the transport of glucocorticoids\n",
      "--------------\n",
      "ID: BBa_K191000\n",
      "Original Description: test\n",
      "Description: Test Test Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC[10] 12COMPATIBILITY%3C/TetR%3D\n",
      "--------------\n",
      "ID: BBa_K194999\n",
      "Original Description: test\n",
      "Description: test test Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC[10] 12COMPATIBILITY%3D\n",
      "--------------\n",
      "ID: BBa_K197021\n",
      "Original Description: EILD\n",
      "Description: Leucine zippers are short peptides which form alpha helices that complement each other., Description%3B%3Ci%3ELucineZip%3E.\n",
      "--------------\n",
      "ID: BBa_K197022\n",
      "Original Description: KILR\n",
      "Description: Leucine zippers are short peptides which form alpha helices that compliment each other. they. form an a-helical loop around a. %3Ci%3EL.\n",
      "--------------\n",
      "ID: BBa_K197023\n",
      "Original Description: Ag4\n",
      "Description: peptides have been shown to mediate inorganic crystal growth and shape. the Ag4 protein. %3A%3E%3C/Tet-%3EC.\n",
      "--------------\n",
      "ID: BBa_K200003\n",
      "Original Description: Rfal\n",
      "Description: Rfal is an enzyme responsible for the ligation of an O-antigen to the core oligo (B0030)\n",
      "--------------\n",
      "ID: BBa_K200004\n",
      "Original Description: TaqI\n",
      "Description: TaqI is a type II restriction enzyme that recognises the sequence TCGA. its activity can be detected by rbs transcription\n",
      "--------------\n",
      "ID: BBa_K206108\n",
      "Original Description: 421\n",
      "Description: 421? Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]%3A%3Csub%3E%3D%3ECI%3AC_Sequence%3CD%3EB%3B%\n",
      "--------------\n",
      "ID: BBa_K208000\n",
      "Original Description: GFP\n",
      "Description: GFP was previously mutated for improved fluorescence photostability. The cycle 3 mutant produces a GFP with a %26%23456%3B%3Ci%3EGFP%3A%3E. coli GFP\n",
      "--------------\n",
      "ID: BBa_K211001\n",
      "Original Description: RI7\n",
      "Description: RI7 encodes the rat olfactory GPCR receptor, clone I7, which binds to a rat cell surface protein\n",
      "--------------\n",
      "ID: BBa_K223038\n",
      "Original Description: HlyA\n",
      "Description: HlyA GaattcggcgctttctagATGCCAACAATAACCACTGC%3Ci%3EGFP%3B%3ElacZalpha-ccdB(weak RBS)\n",
      "--------------\n",
      "ID: BBa_K237007\n",
      "Original Description: VR2\n",
      "Description: BBa_G00101(VR) was modified to achieve a higher GC content, so that it binds to the rbs.\n",
      "--------------\n",
      "ID: BBa_K238008\n",
      "Original Description: VirA\n",
      "Description: VirA is a histidine kinase sensor originally found in agrobacterium tumefaciens.\n",
      "--------------\n",
      "ID: BBa_K238009\n",
      "Original Description: VirG\n",
      "Description: virG is the transcriptional activator of the virA/virg two-component signaling system, %7B%7D%7E\n",
      "--------------\n",
      "ID: BBa_K238010\n",
      "Original Description: RpoA\n",
      "Description: RpoA encodes the alfa subunit of the RNA polymerase. it has illegal, illegal levels of ribonuclease\n",
      "--------------\n",
      "ID: BBa_K238024\n",
      "Original Description: lock\n",
      "Description: This device was originally designed by John Anderson of berkeley iGEM team 2006 (BBa_J) and consists of a ribosomal RNA polymerase (ribose-free)\n",
      "--------------\n",
      "ID: BBa_K243030\n",
      "Original Description: SEG\n",
      "Description: the SEG linker was created to combine our protein domains fok_a and foki_i to form a new protein.\n",
      "--------------\n",
      "ID: BBa_K243031\n",
      "Original Description: pMA \n",
      "Description: %7Ba%7D%7BO%3A%21%23963%3B plasmid%3B construction and cloning of parts according to the BioB-Standard%23%7D\n",
      "--------------\n",
      "ID: BBa_K243033\n",
      "Original Description: pEX\n",
      "Description: pEX is our main E. coli protein expression vector. it possesses the restriction sites X, Y and Z\n",
      "--------------\n",
      "ID: BBa_K243037\n",
      "Original Description: pBAD\n",
      "Description: pBAD cloning vector carries the restriction sites and an ampicilin resistance. Expression vector for BamHI %26%23963%3CBR+BamHI expression\n",
      "--------------\n",
      "ID: BBa_K245001\n",
      "Original Description: X2\n",
      "Description: X2 coiled-coil... Sequence and Features Assembly Compatibility%3A 10COMPATIBLE, Description%3B:\n",
      "--------------\n",
      "ID: BBa_K245021\n",
      "Original Description: cYFP\n",
      "Description: cYFP codes for the c-terminal of yellow flourescent protein (yfp) %3Ci%3Ecoefficient%3A tetracycline-resistant protein (TetR)\n",
      "--------------\n",
      "ID: BBa_K245022\n",
      "Original Description: nYFP\n",
      "Description: The sequence of this part codes N-terminal of yellow flourescent protein (yfp) flourescence can only be expressed in hepatitis B\n",
      "--------------\n",
      "ID: BBa_K245024\n",
      "Original Description: Z1\n",
      "Description: sequence encodes a short zinc binding peptide. assembly compatibility: 10COMPATIBLE WITH, %7B%7D\n",
      "--------------\n",
      "ID: BBa_K245025\n",
      "Original Description: AUP\n",
      "Description: Sequence encodes a short peptide for binding gold nanoparticles. assembly compatibility%3Csubject%3E.\n",
      "--------------\n",
      "ID: BBa_K245026\n",
      "Original Description: TA\n",
      "Description: this part is the coding sequence for a synthetic trimerization domain TA. together with TB and tetracycline\n",
      "--------------\n",
      "ID: BBa_K245027\n",
      "Original Description: TB\n",
      "Description: This part is the coding sequence for a synthetic trimerization domain TB. together with TA and rbd1 are used to construct a ribosome.\n",
      "--------------\n",
      "ID: BBa_K245028\n",
      "Original Description: TC\n",
      "Description: TC is the coding sequence for a synthetic trimerization domain TC. together with TA and RBS (see below).\n",
      "--------------\n",
      "ID: BBa_K245029\n",
      "Original Description: DDD\n",
      "Description: Trimerization coiled-coil sequence is composed of three segments that are combined to form a staggered agglutination sequence\n",
      "--------------\n",
      "ID: BBa_K245030\n",
      "Original Description: KKK\n",
      "Description: trimerization coiled coil sequence, composed of three segments that are combined to form a staggered heterogeneous repeat (His)\n",
      "--------------\n",
      "ID: BBa_K245031\n",
      "Original Description: EEE\n",
      "Description: Trimerization coiled coil sequence is composed of three segments that are combined to form a staggered heterogeneous polypeptide\n",
      "--------------\n",
      "ID: BBa_K245038\n",
      "Original Description: NZ\n",
      "Description: NZ forms coiled coiles with CZ that can also be found in registry%3A BBa_%3D.\n",
      "--------------\n",
      "ID: BBa_K245039\n",
      "Original Description: CZ\n",
      "Description: CZ forms coiled coiles with NZ that can also be found in registry: BBa_1500 %3Csub%3E-BBa%3Antetracycline\n",
      "--------------\n",
      "ID: BBa_K245042\n",
      "Original Description: VASP\n",
      "Description: the vasodilator-stimulated phosphoprotein (VASP) is a key regulator of eosinophilia.\n",
      "--------------\n",
      "ID: BBa_K245046\n",
      "Original Description: ccdB\n",
      "Description: Cell density controller%3A pCon 0.01-%3EluxI-LVA+pLux/TetR+ccdB(weak RBS)\n",
      "--------------\n",
      "ID: BBa_K245114\n",
      "Original Description: LL37\n",
      "Description: Sequence encodes an antimicrobial peptide cathelicidin ll-37 %26%23963%3B %3CBR%3E%21%2396961%3Ci%3EGFP\n",
      "--------------\n",
      "ID: BBa_K245116\n",
      "Original Description: GyrB\n",
      "Description: sequence encodes a 24 kda fragment of gyrase subunit B. When an amino acid is added to the end of the transcript, a tetracycline residue is formed.\n",
      "--------------\n",
      "ID: BBa_K245118\n",
      "Original Description: P1\n",
      "Description: sequence encodes coiled-coil segment that forms parallel heterodimer with P2 that can also be activated by p2\n",
      "--------------\n",
      "ID: BBa_K245119\n",
      "Original Description: P2\n",
      "Description: sequence encodes coiled-coil segment that forms parallel heterodimer with P1 that can also be used in RNA splicing\n",
      "--------------\n",
      "ID: BBa_K245120\n",
      "Original Description: P3\n",
      "Description: Sequence encodes coiled-coil segment that forms parallel heterodimer with P4 that can also be a repressible promoter\n",
      "--------------\n",
      "ID: BBa_K245121\n",
      "Original Description: P4\n",
      "Description: Sequence encodes coiled-coil segment that forms parallel heterodimer with P3 that can also be used to form heterodimers\n",
      "--------------\n",
      "ID: BBa_K245122\n",
      "Original Description: P5\n",
      "Description: Sequence encodes coiled-coil segment that forms parallel heterodimer with P6 that can also be phosphorylated\n",
      "--------------\n",
      "ID: BBa_K245123\n",
      "Original Description: P6\n",
      "Description: Sequence encodes coiled-coil segment that forms parallel heterodimer with P5 that can also be used as a ribosome\n",
      "--------------\n",
      "ID: BBa_K245124\n",
      "Original Description: P7\n",
      "Description: Sequence encodes coiled-coil segment that forms parallel heterodimer with P8 that can also be used as a ribozyme\n",
      "--------------\n",
      "ID: BBa_K245125\n",
      "Original Description: P8\n",
      "Description: Sequence encoding coiled-coil segment that forms parallel heterodimer with P7 that can also be incorporated into a ribozyme\n",
      "--------------\n",
      "ID: BBa_K245126\n",
      "Original Description: H1\n",
      "Description: sequence encodes homodimeric parallel coiled-coil segment. assembly compatibleity: 10COM, rbs.\n",
      "--------------\n",
      "ID: BBa_K245127\n",
      "Original Description: GCN\n",
      "Description: sequence encodes a homodimeric parallel coiled-coil segment GNC-p1(I)(II).\n",
      "--------------\n",
      "ID: BBa_K245128\n",
      "Original Description: p53\n",
      "Description: this part is the coding sequence for the tetramerization domain of the transcription factor p53. %7BaaS%7D.\n",
      "--------------\n",
      "ID: BBa_K245130\n",
      "Original Description: AEA\n",
      "Description: Sequence encodes trimerization coiled coil sequence. composed of three segments that are combined to form a single terminator.\n",
      "--------------\n",
      "ID: BBa_K245131\n",
      "Original Description: ELST\n",
      "Description: ELST The sequence encodes elastin-like segment. assembly compatibility: 10COMPA, rbs.\n",
      "--------------\n",
      "ID: BBa_K245132\n",
      "Original Description: APH1\n",
      "Description: sequence encoding coiled-coil segment that forms antiparallel homodimer. similar to, but different from\n",
      "--------------\n",
      "ID: BBa_K245133\n",
      "Original Description: APH\n",
      "Description: sequence encodes coiled-coil segment that forms antiparallel homodimer. similar to, rbs.\n",
      "--------------\n",
      "ID: BBa_K245134\n",
      "Original Description: BCR\n",
      "Description: sequence encodes coiled-coil segment that forms antiparallel homodimer. assembly comp, peptide sequence.\n",
      "--------------\n",
      "ID: BBa_K245135\n",
      "Original Description: APHE\n",
      "Description: Sequence encodes coiled-coil segment that forms antiparallel homodimer. assembly comp, Description %26%23706%3B%21%2370703%3B\n",
      "--------------\n",
      "ID: BBa_K245138\n",
      "Original Description: x\n",
      "Description: x x Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10, 10]%3A %3CBR%3E%3D\n",
      "--------------\n",
      "ID: BBa_K245139\n",
      "Original Description: RADA\n",
      "Description: Sequence of this part codes a peptide comprised of four repeats of R-A-D-A, A-B-C, and D-A motifs\n",
      "--------------\n",
      "ID: BBa_K245140\n",
      "Original Description: mNGF\n",
      "Description: Sequence encodes mouse nerve growts factor (mNGF) which causes diferententiation in neurons and glia.\n",
      "--------------\n",
      "ID: BBa_K249016\n",
      "Original Description: mms6\n",
      "Description: mms6 is an enzyme derived from the Magnespirllum Magneticum bacteria. it utilizes the methyltransferase enzyme to convert methylsulfate to sulphonamide.\n",
      "--------------\n",
      "ID: BBa_K252015\n",
      "Original Description: f\n",
      "Description: f ff Sequence and features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]%3A rbs sequence and features\n",
      "--------------\n",
      "ID: BBa_K256004\n",
      "Original Description: NorR\n",
      "Description: nitric oxide (NO) induces NO-detoxifying enzymes in e. coli (S. pombe)\n",
      "--------------\n",
      "ID: BBa_K266013\n",
      "Original Description: luxA\n",
      "Description: luxA Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10,11]%10D%10EluxA.sequence and features assembly%10Incompatible with RFC(10,12)\n",
      "--------------\n",
      "ID: BBa_K269000\n",
      "Original Description: OmcB\n",
      "Description: This gene is the first in the electron transport chain and works in concert with OmcE, OmcS, and OmcB. %3CBR%3E\n",
      "--------------\n",
      "ID: BBa_K269001\n",
      "Original Description: OmcE\n",
      "Description: This gene is the first in the electron transport chain and works in concert with OmcB, OmcS, and OmcII.\n",
      "--------------\n",
      "ID: BBa_K269002\n",
      "Original Description: OmcS\n",
      "Description: This gene is the first in the electron transport chain and works in concert with OmcE, OmcT, and OmcI.\n",
      "--------------\n",
      "ID: BBa_K269003\n",
      "Original Description: OmcT\n",
      "Description: This gene is the first in the electron transport chain and works in concert with OmcE, OmcS, and OmcB. %26%236%3B%3C/TetR\n",
      "--------------\n",
      "ID: BBa_K270005\n",
      "Original Description: XylR\n",
      "Description: XylR is a regulatory protien that is under constitutive expression of the pr promoter %26%23703%3B%3Csub%3E YFP\n",
      "--------------\n",
      "ID: BBa_K273020\n",
      "Original Description: E1A1\n",
      "Description: Antisense RNA against the formation of pyruvate dehydrogenase complex (PDC)%3Analytical%3B%3C/TetR\n",
      "--------------\n",
      "ID: BBa_K273021\n",
      "Original Description: E1A2\n",
      "Description: E1A2 Antisense RNA against the formation of pyruvate dehydrogenase, %26%3B%3CBR%3E(+TetR)\n",
      "--------------\n",
      "ID: BBa_K273022\n",
      "Original Description: E1A3\n",
      "Description: Antisense RNA against the formation of pyruvate dehydrogenase, E1A3 - %3Ci%3E\n",
      "--------------\n",
      "ID: BBa_K273023\n",
      "Original Description: E1A4\n",
      "Description: Antisense RNA against the formation of pyruvate dehydrogenase, %3A YFP(weak RBS)\n",
      "--------------\n",
      "ID: BBa_K273024\n",
      "Original Description: E1B1\n",
      "Description: Anti-Sense RNA against the formation of pyruvate dehydrogenase complex (PDC)%3CBR%3A%3E(PDI)\n",
      "--------------\n",
      "ID: BBa_K273025\n",
      "Original Description: E1B2\n",
      "Description: E1B2 Antisense RNA against the formation of pyruvate dehydrogenase %3Ci%3E1B0\n",
      "--------------\n",
      "ID: BBa_K273026\n",
      "Original Description: E1B3\n",
      "Description: E1B3 Antisense RNA against the formation of pyruvate dehydrogenase%26%23703%3B%23704%3D\n",
      "--------------\n",
      "ID: BBa_K273027\n",
      "Original Description: E1B4\n",
      "Description: Antisense RNA against the formation of pyruvate dehydrogenase (PDC, Description: %26%23963%3B%24%23966%3B)\n",
      "--------------\n",
      "ID: BBa_K273028\n",
      "Original Description: E21\n",
      "Description: E21 Antisense RNA against the formation of pyruvate dehydrogenase complex (%3A pYD%3E)\n",
      "--------------\n",
      "ID: BBa_K273029\n",
      "Original Description: E22\n",
      "Description: E22 Antisense RNA against the formation of pyruvate dehydrogenase complex (%3A PPDH)\n",
      "--------------\n",
      "ID: BBa_K273030\n",
      "Original Description: E23\n",
      "Description: %23E23 Antisense RNA against the formation of pyruvate dehydrogenase complex (%23)\n",
      "--------------\n",
      "ID: BBa_K273031\n",
      "Original Description: E24\n",
      "Description: E24 Antisense RNA against the formation of pyruvate dehydrogenase complex (TetF)\n",
      "--------------\n",
      "ID: BBa_K289002\n",
      "Original Description: GSH\n",
      "Description: april 1 marks the first day of a three-day holiday in switzerland., Description:,\n",
      "--------------\n",
      "ID: BBa_K289003\n",
      "Original Description: GSH\n",
      "Description: GSH has strong affinity to the lyophobic groove of PP1. MCs, with a strong affinity for GSH.\n",
      "--------------\n",
      "ID: BBa_K289005\n",
      "Original Description: PDC\n",
      "Description: Pyruvate decarboxylase (PDC) is a homotetrameric enzyme which can degrade.\n",
      "--------------\n",
      "ID: BBa_K289007\n",
      "Original Description: Rbc\n",
      "Description: Synechocystis sp. PCC6803 is a cyanobacteria with a penicillin-resistant promoter.\n",
      "--------------\n",
      "ID: BBa_K294060\n",
      "Original Description: test\n",
      "Description: Test Test Sequence and Features Assembly Compatibility: 10Compatible WITH RFC[10]12, %10%103%105%10%5D.\n",
      "--------------\n",
      "ID: BBa_K294120\n",
      "Original Description: nasa\n",
      "Description: nasa sequence and features assembly (RBS) with RFC%3Csub%3E. faecalis (B0050)\n",
      "--------------\n",
      "ID: BBa_K294206\n",
      "Original Description: sss\n",
      "Description: 10compatible with rfc[10] 12compatible with RFC[12] %3Ci%3E%3Bgenerator%3CP%3D%3ECI%3A rbs-induced tetrachloroe\n",
      "--------------\n",
      "ID: BBa_K294354\n",
      "Original Description: test\n",
      "Description: Test Test Test Sequence and Features Assembly Compatibility%3A RFC[10,11,11] %3Csubstituitive Test Sequent and Features Assemblies\n",
      "--------------\n",
      "ID: BBa_K294898\n",
      "Original Description: GFP\n",
      "Description: GFP test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12 - Compatibilities of GFP sequence and features\n",
      "--------------\n",
      "ID: BBa_K294902\n",
      "Original Description: test\n",
      "Description: Test test long Sequence and features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10,11] %21%27%26%26%23453%3B%3Assembly%3B.\n",
      "--------------\n",
      "ID: BBa_K302006\n",
      "Original Description: spaI\n",
      "Description: SpaI binds subtilin and prevents it from penetrating the cell membrane to form pores. %7B%3Csub%3EI%3A spaI\n",
      "--------------\n",
      "ID: BBa_K302007\n",
      "Original Description: spaF\n",
      "Description: spaF forms a membrane transporter that removes subtilin from the membrane, preventing it from forming pores. SpaF binds to a protein phosphatase in the absence of the spaF promoter.\n",
      "--------------\n",
      "ID: BBa_K302008\n",
      "Original Description: spaE\n",
      "Description: spaE forms a membrane transporter that removes subtilin from the membrane, preventing it from forming pores. spaE binds to a rbs-associated protein.\n",
      "--------------\n",
      "ID: BBa_K302009\n",
      "Original Description: spaG\n",
      "Description: SpaG is one of three proteins from B. subtilis which form a membrane transporter that removes subtilin from the plasma membrane.\n",
      "--------------\n",
      "ID: BBa_K302010\n",
      "Original Description: sfp\n",
      "Description: svp encodes for a 4'-Phosphopantheinyl-Transferase %26%23703%3B tetracycline-tet-%3Ci%3Eptyl%3\n",
      "--------------\n",
      "ID: BBa_K302011\n",
      "Original Description: swrA\n",
      "Description: swrA bacillus subtilis 168 is unable to biosynthesize flagellar %26%23707%3B1%3B%3Chemozygosaccharide%3B.\n",
      "--------------\n",
      "ID: BBa_K302019\n",
      "Original Description: spaB\n",
      "Description: 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 11, RFC%3E%3Ci%3EP.\n",
      "--------------\n",
      "ID: BBa_K302023\n",
      "Original Description: spaS\n",
      "Description: SpaS codes for the subtilin precursor peptide. assembly compatibility: 10COMPATIBLE WITH %3Analyzer%3B%3Csub%3E%3D\n",
      "--------------\n",
      "ID: BBa_K302024\n",
      "Original Description: spaT\n",
      "Description: 10compatible with RFC[10] 12compatibility with R, sequence and features assembly%3A %3Csub%3E. thomasidis-%3EC.\n",
      "--------------\n",
      "ID: BBa_K302025\n",
      "Original Description: spaB\n",
      "Description: 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 11, %7B%7D\n",
      "--------------\n",
      "ID: BBa_K302026\n",
      "Original Description: spaC\n",
      "Description: SpaC is a modifier of the subtilin precursor coded by spaS. sequence and features assembly compatability %26%23963%3B\n",
      "--------------\n",
      "ID: BBa_K302027\n",
      "Original Description: spaT\n",
      "Description: SpaT codes for a subtilin transporter. assembly compatibility: 10COMPATIBLE WITH R, %3Ci%3ESPAT%3D\n",
      "--------------\n",
      "ID: BBa_K302028\n",
      "Original Description: spaB\n",
      "Description: spaB is a modifier of the subtilin precursor encoded by spaS. sequence and features assembly compatability (SeqV)\n",
      "--------------\n",
      "ID: BBa_K302029\n",
      "Original Description: sacB\n",
      "Description: SacB encodes the enzyme levansucrase that catalyses the conversion of extracellular suc to ubiquitin inducible form\n",
      "--------------\n",
      "ID: BBa_K302032\n",
      "Original Description: mazE\n",
      "Description: mazE Encodes the liable antitoxin to mazF in Bacillus Subtilis sp.\n",
      "--------------\n",
      "ID: BBa_K302033\n",
      "Original Description: mazF\n",
      "Description: BBa_K302033 encodes an endoribonuclease that cleaves a ribosomal protein.\n",
      "--------------\n",
      "ID: BBa_K305000\n",
      "Original Description: test\n",
      "Description: Test Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC[10] 12COMPA, %3Csub%3E.\n",
      "--------------\n",
      "ID: BBa_K307101\n",
      "Original Description: parS\n",
      "Description: this part is parb protein binding site. it is involed in partition system. assembly compatibility: aaa-assembly%3B%3C/dbs.\n",
      "--------------\n",
      "ID: BBa_K307102\n",
      "Original Description: dif\n",
      "Description: dif replication terminus of vibrio cholerae chromosome II sequence and features assembly comp. %26%236%234%233%236%3B24%235%233%3B %3Csub%3B.\n",
      "--------------\n",
      "ID: BBa_K307105\n",
      "Original Description: rctB\n",
      "Description: rctB the Replication Initiator gene of Vibrio cholerae chromos, %26%3B%3B %3Csub%3E%3Anaevobacterium spp.\n",
      "--------------\n",
      "ID: BBa_K307106\n",
      "Original Description: parB\n",
      "Description: parB is a chromosomeII partitioning protein from vibrio cholerae. %26%233%3B%3Csub%3E%3Dneobacteria%3A%3Bselective-\n",
      "--------------\n",
      "ID: BBa_K309099\n",
      "Original Description: test\n",
      "Description: Test Test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COMPATIBILITY%3B%3Csub%3E%3Assembly\n",
      "--------------\n",
      "ID: BBa_K310018\n",
      "Original Description: Hfq\n",
      "Description: Hfq coming soonSequence and Features Assembly Compatibility: 10Compatible with RFC[10, RBS]\n",
      "--------------\n",
      "ID: BBa_K314011\n",
      "Original Description: CapD\n",
      "Description: CapD is a protein native to bacillus anthracis. it cleaves poly-peptides.\n",
      "--------------\n",
      "ID: BBa_K314444\n",
      "Original Description: test\n",
      "Description: Barcodes are discontinued, but one was appended to a composite part that includes the barcode %26%23973%3B %3C/T%3D\n",
      "--------------\n",
      "ID: BBa_K314560\n",
      "Original Description: test\n",
      "Description: test test part Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC[10] 12, Test test part sequence and features\n",
      "--------------\n",
      "ID: BBa_K317035\n",
      "Original Description: pduP\n",
      "Description: pduP this part is enzyme relating to propandiol metabolization. localize at, promoter sequence and promoter regions.\n",
      "--------------\n",
      "ID: BBa_K317998\n",
      "Original Description: RhlA\n",
      "Description: Pseudomonas aeruginosa produces rhamnose-containing glycolipid biosynthesia.\n",
      "--------------\n",
      "ID: BBa_K317999\n",
      "Original Description: RhlB\n",
      "Description: RhlB Pseudomonas aeruginosa produces rhamnose-containing plasmid.\n",
      "--------------\n",
      "ID: BBa_K318516\n",
      "Original Description: RamA\n",
      "Description: 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 116.5%26%2330.5%3A%3Ci%3EPst%3A.\n",
      "--------------\n",
      "ID: BBa_K319033\n",
      "Original Description: ESV\n",
      "Description: this plasmid can be used to eliminate an upstream PstI restriction site and a downstream B-cell ligand.\n",
      "--------------\n",
      "ID: BBa_K320015\n",
      "Original Description: P25\n",
      "Description: Pfs (Ookinete Surface Membrane Protein)%3A %3Ci%3EPFL%3EC 1.10-%3Eukaryote-Surface-Motif Protein\n",
      "--------------\n",
      "ID: BBa_K320016\n",
      "Original Description: p28\n",
      "Description: IGEM EPFL team's was interested in the ookinete surface membrane proteins Pfs, GFP.\n",
      "--------------\n",
      "ID: BBa_K320999\n",
      "Original Description: P25\n",
      "Description: P25 t Sequence and Features Assembly Compatibility with RFC%3A%3B%3E%3Ci%3D%3EB%3ECL%3CPDB%3EP25\n",
      "--------------\n",
      "ID: BBa_K323104\n",
      "Original Description: 105\n",
      "Description: Temporary 105 a Sequence and Features Assembly Compatibility%3A With RFC%3D%3B%3ECase%3Csub%3E-Sequence-and-Features-Assembly-%3\n",
      "--------------\n",
      "ID: BBa_K323129\n",
      "Original Description: 130\n",
      "Description: 130 a Sequence and Features Assembly Compatibility with RFC[10,11,12] %3Csub%3E15%3Assembly%3ArcSequence and Features (TetR)\n",
      "--------------\n",
      "ID: BBa_K323137\n",
      "Original Description: 138\n",
      "Description: %3Assembly%3D%3B%3Csub%3Etetracycline-free-radical-short-interval-tetrachlorobenzene\n",
      "--------------\n",
      "ID: BBa_K323140\n",
      "Original Description: 141\n",
      "Description: 141 a Sequence and Features Assembly%3A RFC%3E - %3Csub%3ECase%3R - RFP%3B%3CEI%3EDescription%3ACse\n",
      "--------------\n",
      "ID: BBa_K323141\n",
      "Original Description: 142\n",
      "Description: %7BaSequence and Features Assembly%5Bcompatibility%7D with RFC[10%2A%2B%2Csub%3E%3C/sub%2E%2CD\n",
      "--------------\n",
      "ID: BBa_K323142\n",
      "Original Description: 143\n",
      "Description: %3CBR%3D%3E%3ArcGIS%3B%31%3Ci%3ED%3ECR%3DP%3DSequence%33%3Csub%3ERC%3EPrc%\n",
      "--------------\n",
      "ID: BBa_K323143\n",
      "Original Description: 144\n",
      "Description: 144 a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] %3B%3CBR%3E%3D%3ECS%3A rfp, rcs, src\n",
      "--------------\n",
      "ID: BBa_K323144\n",
      "Original Description: 145\n",
      "Description: 145 a Sequence and Features Assembly Compatibility%3A10Comparable With RFC[10]%3CBR%3EYE-Sequence-Features-Assembly.\n",
      "--------------\n",
      "ID: BBa_K336054\n",
      "Original Description: kkk\n",
      "Description: kkk kk Sequence and Features AssemblyCompatibility:10COMPATIBLE WITH RFC[10, RBS%3Csub%3EDB(weak RBS)\n",
      "--------------\n",
      "ID: BBa_K341453\n",
      "Original Description: lacI\n",
      "Description: LacI is a member of the lacI-galr family of bacterial transcription regulators. lacI consists of a ribose-coupled tail protein and a nucleolus terminator\n",
      "--------------\n",
      "ID: BBa_K341717\n",
      "Original Description: ToxR\n",
      "Description: ToxR cholera toxin transcriptional activator sequence and features assembly%3A COMPATIBILITY: 10COMPA\n",
      "--------------\n",
      "ID: BBa_K341718\n",
      "Original Description: VH\n",
      "Description: VH is the heavy chain of antibody. we want to link it behind the toxR gene. hexapeptide-linked heavy-chain peptide.\n",
      "--------------\n",
      "ID: BBa_K341719\n",
      "Original Description: VL\n",
      "Description: VL is the light chain of antibody, we also connect it after the toxR gene., Description: %26%23703%3BBB%21%23707%3B%3AVL%3Ci%3E.\n",
      "--------------\n",
      "ID: BBa_K341720\n",
      "Original Description: pCTX\n",
      "Description: pCTX is a promoter recognized by toxR. sequence and features assembly compatibility%3CBR%3E\n",
      "--------------\n",
      "ID: BBa_K361010\n",
      "Original Description:  \n",
      "Description: Sequence and Features Assembly Compatibility: 10Compatible WITH RFC[10] 12COMPATIBLE, %7B\n",
      "--------------\n",
      "ID: BBa_K364202\n",
      "Original Description: hBAX\n",
      "Description: hBAX is a pro-apoptotic member of the Bcl-2 protein family. %3A rbs.\n",
      "--------------\n",
      "ID: BBa_K364300\n",
      "Original Description: hVDR\n",
      "Description: 10INCOMPATIBLE WITH RFC[10]I,... Sequence and Features Assembly Compatibility%3A RFC%3E%3B%3C/TetF%3D\n",
      "--------------\n",
      "ID: BBa_K371037\n",
      "Original Description: pduA\n",
      "Description: pduA at each end is special DNA sequence that make this parts compatible to BBF RFC 53., Description of BBF rfc 53 protein coding sequence %3Csub%3B%3Epdu\n",
      "--------------\n",
      "ID: BBa_K371037\n",
      "Original Description: pduA\n",
      "Description: pduA at each end is special DNA sequence that make this parts compatible to BBF RFC 53., %26%23703%3B53\n",
      "--------------\n",
      "ID: BBa_K371039\n",
      "Original Description: pduU\n",
      "Description: this part encodes pDU J proterin, which is a shell protein of Citrobactor fr. this part has a %7Baa%7D %2A%7Csub%3E%3A%21%7D\n",
      "--------------\n",
      "ID: BBa_K371040\n",
      "Original Description: pduB\n",
      "Description: This part encodes pduB, which is a shell protein of pDU. It is mainly a rbl-like protein with ribosomal insertion\n",
      "--------------\n",
      "ID: BBa_K371056\n",
      "Original Description: ATG\n",
      "Description: ATG ATG Sequence and Features Assembly Compatibility: 10Compatable WITH RFC[10%10Csub%10dbl]%10Dbl%10cSub%10dar.\n",
      "--------------\n",
      "ID: BBa_K371060\n",
      "Original Description: GGT\n",
      "Description: Glycine %3A RFC%3D%3Csub%3E%3EGLYCERIDES%3B%3CDi%3EC%3EB%3ED%3CGlycine%23%3C/dbls%3\n",
      "--------------\n",
      "ID: BBa_K377700\n",
      "Original Description: blah\n",
      "Description: april 1 marks the first day of a three-day holiday in switzerland.,, Description:\n",
      "--------------\n",
      "ID: BBa_K377703\n",
      "Original Description: Temp\n",
      "Description: Flu operon/ Ag43 NOTHING Sequence and Features Assembly Compatibility: 10INCOMPATIBLE, %10Incomparable\n",
      "--------------\n",
      "ID: BBa_K377704\n",
      "Original Description: FimB\n",
      "Description: fimB inverts an invertible DNA region containing the promoter for the fim operon %26%23963%3B\n",
      "--------------\n",
      "ID: BBa_K387008\n",
      "Original Description: Oct4\n",
      "Description: Oct4 human transcriptional factor that can induce iPSCs (inducible Pluripotent Stem Cells (IPSC))\n",
      "--------------\n",
      "ID: BBa_K392029\n",
      "Original Description: test\n",
      "Description: test test test sequence and features assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COMPATIBILITY\n",
      "--------------\n",
      "ID: BBa_K398100\n",
      "Original Description: bbc1\n",
      "Description: bbc1 protein from chlamydomonas sp. W-80 that enhances the expression of chromosomal expression\n",
      "--------------\n",
      "ID: BBa_K398200\n",
      "Original Description: AlnA\n",
      "Description: AlnA is an emulsifying protein present in the alasan complex which naturally occurs in a variety of bacteria and fungi\n",
      "--------------\n",
      "ID: BBa_K398201\n",
      "Original Description: OprG\n",
      "Description: outer membrane emulsifying protein from pseudomonas putida. %3Aci%3E. coli%3B(weak RBS)\n",
      "--------------\n",
      "ID: BBa_K398300\n",
      "Original Description: AlkS\n",
      "Description: Transcription factor involved in the expression of alkane-degrading genes in pseudom. sp. cerevisiae.\n",
      "--------------\n",
      "ID: BBa_K404245\n",
      "Original Description:  \n",
      "Description: Sequence and Features Assembly Compatibility%3A 10Compatible WITH RFC[10] 12COMPATIBLE, Description:\n",
      "--------------\n",
      "ID: BBa_K404249\n",
      "Original Description:  \n",
      "Description: Sequence and Features Assembly Compatibility: 10Compatible WITH RFC[10] 12COMPATIBLE, %7B%21%7D\n",
      "--------------\n",
      "ID: BBa_K404307\n",
      "Original Description:  \n",
      "Description: xSequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COM, %26%26%23706%3B12COMPARABLE\n",
      "--------------\n",
      "ID: BBa_K404316\n",
      "Original Description: EGFP\n",
      "Description: EGFP was improved by the iGEM team Freiburg_Bioware 2010 by converting it into RFC, %3ArcTet-%3EGFP\n",
      "--------------\n",
      "ID: BBa_K419007\n",
      "Original Description: alkG\n",
      "Description: 10COMPATIBLE WITH RFC[10] 12COMPLEX%3A ALKG SECTURE AND FEATURES ASSEMBLISHMENT COMPATIBILITY:\n",
      "--------------\n",
      "ID: BBa_K419009\n",
      "Original Description: alkH\n",
      "Description: AlkH sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] 12COMPATIBILITY%3A %3CBR%3E%3D\n",
      "--------------\n",
      "ID: BBa_K426003\n",
      "Original Description: tn5\n",
      "Description: tn5 encodes a DNA modifying enzyme. comes from enterobacterial tranposons., %3CBR%3E%3ECi%3EB%33%3B26%236%3B.\n",
      "--------------\n",
      "ID: BBa_K426006\n",
      "Original Description: zf+\n",
      "Description: DNA binding domains are proteins that bind to a specific DNA sequences. zinc finger nuclease binds to DNA.\n",
      "--------------\n",
      "ID: BBa_K426007\n",
      "Original Description: zf-\n",
      "Description: DNA binding domains are proteins that bind to a specific DNA sequences. Zinc Finger Nuclease (ZnF)\n",
      "--------------\n",
      "ID: BBa_K500005\n",
      "Original Description: Luc1\n",
      "Description: Luc1 N-terminal of luciferase contains 1-436aa of 550a%26%23963%3B00135\n",
      "--------------\n",
      "ID: BBa_K500006\n",
      "Original Description: Luc2\n",
      "Description: luciferase contains 440-550aa sequence. assembly compatibility%3A 10COMPA%3B%3Csub%3E%3D(ISO-LVA-ITER)\n",
      "--------------\n",
      "ID: BBa_K500007\n",
      "Original Description: MBP\n",
      "Description: MBP is a maltose-binding protein. It is involved in enzymatic digestion of malta toxin and enol phosphate\n",
      "--------------\n",
      "ID: BBa_K500008\n",
      "Original Description: Nub\n",
      "Description: Nub N-terminal of ubiquitin sequence contains 1-35aa of 76aa sequence and features. nucleotide sequence and amino acid sequence are conserved.\n",
      "--------------\n",
      "ID: BBa_K509005\n",
      "Original Description: GLuc\n",
      "Description: Gluc is a bioluminescent luciferase protein that emits green light. it has been described in silico.\n",
      "--------------\n",
      "ID: BBa_K510034\n",
      "Original Description: Swi6\n",
      "Description: Swi6 is a critical protein for heterochromatin assembly in fission yeast. it contains a c-terminal tetR repressor and a streptavidin ligase\n",
      "--------------\n",
      "ID: BBa_K510035\n",
      "Original Description: Swi6\n",
      "Description: Swi6 is a critical protein for heterochromatin assembly in fission yeast Schizosaccharomyces spp.\n",
      "--------------\n",
      "ID: BBa_K512000\n",
      "Original Description: cas3\n",
      "Description: Cas3 belongs to a series of genes responsible for CRISPR interference to work. Cas1 and Cas2 have been described.\n",
      "--------------\n",
      "ID: BBa_K518005\n",
      "Original Description: cheZ\n",
      "Description: cheZ is responsible for the dephosphorylation of flagellum-regulating protein cheY. it's a GFP-selectin repressible protein.\n",
      "--------------\n",
      "ID: BBa_K519004\n",
      "Original Description: a\n",
      "Description: a a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10,11]%10%3A %3CBR%3E\n",
      "--------------\n",
      "ID: BBa_K519005\n",
      "Original Description: a\n",
      "Description: a a Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10]%3Csub%3E%3D(weak RFC)\n",
      "--------------\n",
      "ID: BBa_K519010\n",
      "Original Description: SmtA\n",
      "Description: SmtA is a type II metallothionein with a reduced cys content, %26%23987%3B%23983%3Brbs\n",
      "--------------\n",
      "ID: BBa_K524204\n",
      "Original Description: pTE\n",
      "Description: pTE is a template plasmid for generating linear DNA substrate for lambda RED, %7D%7Brbs%3CBR%3D%2Csub%21%7D\n",
      "--------------\n",
      "ID: BBa_K530001\n",
      "Original Description: CRTE\n",
      "Description: part has been improved by the DTU-Denmark 2016 team by removing the illegal restriction site AgeI at, %7D%7B%2Csub%23%7D\n",
      "--------------\n",
      "ID: BBa_K530002\n",
      "Original Description: CRTI\n",
      "Description: part has been improved by the DTU-Denmark 2016 team by removing the illegal restriction site BgIII from the part.\n",
      "--------------\n",
      "ID: BBa_K530025\n",
      "Original Description: Vtc2\n",
      "Description: Vtc2 catalyzes the conversion of GDP-L-Galactose to L-Glutamic Acid\n",
      "--------------\n",
      "ID: BBa_K530026\n",
      "Original Description: GME\n",
      "Description: GME catalyzes the conversion of GDP-D-mannose to GDP-L-Galac %3A Glucagonyltransferase\n",
      "--------------\n",
      "ID: BBa_K530027\n",
      "Original Description: Vtc4\n",
      "Description: Vtc4 catalyzes the conversion of L-Galactose-1-P to L-Glutamine\n",
      "--------------\n",
      "ID: BBa_K539413\n",
      "Original Description: vioD\n",
      "Description: vioD gene codes for the fourth enzyme in the violacein biosynthetic pathway - an aa.\n",
      "--------------\n",
      "ID: BBa_K539513\n",
      "Original Description: vioC\n",
      "Description: vioC codes for the last enzyme in the violacein biosynthetic pathway - an F%3Csub%3E%3ArcT(weak RBS)\n",
      "--------------\n",
      "ID: BBa_K545005\n",
      "Original Description: fha \n",
      "Description: fha is a RBS containing a binding site for the rsmA protein %26%23973%3B%3Csub%3E%3A rbsma\n",
      "--------------\n",
      "ID: BBa_K545006\n",
      "Original Description: mag \n",
      "Description: mag is a RBS containing a. binding site for the rsmA protein. it binds to rbs-macromolecule binding protein and a GFP.\n",
      "--------------\n",
      "ID: BBa_K549010\n",
      "Original Description: LuxE\n",
      "Description: LuxE contains only the coding sequence of the gene luxE from photorhabdus luminescence (P. luminescens)\n",
      "--------------\n",
      "ID: BBa_K554003\n",
      "Original Description: SoxR\n",
      "Description: SoxR is a transcription factor found in bacteria and is activated during superoxide or nitric oxide depletion.\n",
      "--------------\n",
      "ID: BBa_K554004\n",
      "Original Description: IL10\n",
      "Description: IL-10 is an anti-inflammatory interleukin, produced mainly by monocytes. IL-1 is a potentiator of apoptosis.\n",
      "--------------\n",
      "ID: BBa_K554005\n",
      "Original Description: IL12\n",
      "Description: IL-12 is a pro-inflammatory type 1 cytokine which bridges the innate resistance and adapts to a changing environment\n",
      "--------------\n",
      "ID: BBa_K554009\n",
      "Original Description: TolC\n",
      "Description: TolC is part of the hemolysin secretion system, very important to export the proteins produced inside tetR.\n",
      "--------------\n",
      "ID: BBa_K564000\n",
      "Original Description: ChiX\n",
      "Description: ChiX is a 84 bp long Sequence and Features Assembly. It consists of a single ribosomal repeat encoding a short splice of chlorophyll.\n",
      "--------------\n",
      "ID: BBa_K566027\n",
      "Original Description: CcaS\n",
      "Description: ccas is a member of cyanobacteriochrome family of proteins. phycocyanobis %21%23104%3B%3Csub%3E. sp.\n",
      "--------------\n",
      "ID: BBa_K566028\n",
      "Original Description: CcaR\n",
      "Description: CcaR, the response regulator of CcaS, wich is a member of cyanobacterium halotolerans\n",
      "--------------\n",
      "ID: BBa_K567020\n",
      "Original Description: KanR\n",
      "Description: Start codon of KanR gene is mutated from ATG to CGA. PT%3A tetracycline-induced mutagenesis in rat.\n",
      "--------------\n",
      "ID: BBa_K569011\n",
      "Original Description: FGFR\n",
      "Description: FGFR is a membrane-bound receptor that dimerizes in response to the ligand FGF(short Glycoperoxidase)\n",
      "--------------\n",
      "ID: BBa_K569017\n",
      "Original Description: CheY\n",
      "Description: CheY is a chemotaxis protein that is activated by the protein CheA. after CheY hexafluorophore is released.\n",
      "--------------\n",
      "ID: BBa_K575003\n",
      "Original Description: LasR\n",
      "Description: LasR was sequenced from the genome Sequence and Features Assembly (Sequence and Features)%3A 10INCOMPATIBLE WITH, %3B%3Csub%3ELASR%3D\n",
      "--------------\n",
      "ID: BBa_K584017\n",
      "Original Description: test\n",
      "Description: Test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COMPATIBILITY%3A%3E%3CBR%3B%26%23707%3C/Test%31%3Cbrin\n",
      "--------------\n",
      "ID: BBa_K587000\n",
      "Original Description: RecA\n",
      "Description: GAATTCGCGGCCTCTTAGATGGCTAGAAAACAAACAAA, %3Ci%3ErecA%3CTcttct%3AGAAAAAacgaaac%3Btcgct\n",
      "--------------\n",
      "ID: BBa_K588000\n",
      "Original Description: trpR\n",
      "Description: trpR is a transcription repressor that binds to the rp operator as well as rbs.\n",
      "--------------\n",
      "ID: BBa_K588001\n",
      "Original Description: ptrp\n",
      "Description: ptrp is a tryptophan promoter and operator. it will be repressed by tetracycline.\n",
      "--------------\n",
      "ID: BBa_K590080\n",
      "Original Description: mamK\n",
      "Description: mamK is a filamentous, actin-like protein that creates a scaffold for magnetosomes %26%23973%3B%3Csub%3Eactin%3B(weak RBS)\n",
      "--------------\n",
      "ID: BBa_K590081\n",
      "Original Description: mamI\n",
      "Description: mamI is required for vesicle formation for later magnetosome growth in AMB-1 %21%3E.coli%3A.\n",
      "--------------\n",
      "ID: BBa_K592002\n",
      "Original Description: ccaR\n",
      "Description: ccaR function as a photoreversible switch between green (535nm) and red (672nm, %26%23963%3B(%21%23966%23)\n",
      "--------------\n",
      "ID: BBa_K607015\n",
      "Original Description: cI \n",
      "Description: cI gene codes for the bacteriophage repressor from phage lambd%3B %3Ci%3EL.\n",
      "--------------\n",
      "ID: BBa_K628004\n",
      "Original Description: tba\n",
      "Description: tba sequence and features assembly compatibility: 10COMPATIBLE WITH RFC[10] %7D%7B%21%7B(weak RBS)\n",
      "--------------\n",
      "ID: BBa_K631039\n",
      "Original Description: nahD\n",
      "Description: nahd test sequence and features assembly compatibleity%3A%3D%3B%3C %3EXCEPTION%3 C. electrophoresis\n",
      "--------------\n",
      "ID: BBa_K634000\n",
      "Original Description: exaD\n",
      "Description: ExaD is a sensor kinase which (in the presence of ethanol) phosphorylates %26%29\n",
      "--------------\n",
      "ID: BBa_K634001\n",
      "Original Description: exaE\n",
      "Description: ExaE, a transcription factor that is activated by phosphorylation from exaD. It is a %3B phosphorystallo%3A of tetracycline containing protein\n",
      "--------------\n",
      "ID: BBa_K641000\n",
      "Original Description: Pctx\n",
      "Description: Pctx is a promoter activated by ToxR dimers. toxR %3A pCon 0.70-%3EluxI-LVA%3Csub%3D-ToxR+pCon\n",
      "--------------\n",
      "ID: BBa_K648035\n",
      "Original Description: RecA\n",
      "Description: there is currently no text in this page. you can search for this page title in other pages, or search the, Description section.\n",
      "--------------\n",
      "ID: BBa_K648036\n",
      "Original Description: RecA\n",
      "Description: RecA is a protein used by Escherichia coli to repair and maintain DNA. many normal laboratory strains, %7Bsub%7D\n",
      "--------------\n",
      "ID: BBa_K648037\n",
      "Original Description: RecA\n",
      "Description: there is currently no text in this page. you can search for this page title in other pages, or search the, Title of this page in google.\n",
      "--------------\n",
      "ID: BBa_K648038\n",
      "Original Description: RecA\n",
      "Description: there is currently no text in this page. you can search for this page title in other pages, or search the, Description:.\n",
      "--------------\n",
      "ID: BBa_K648124\n",
      "Original Description: RecA\n",
      "Description: there is currently no text in this page. you can search for this page title in other pages, or search the, Description:.\n",
      "--------------\n",
      "ID: BBa_K649010\n",
      "Original Description: test\n",
      "Description: test Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC[10] 12COMPA TABLE OF CONTENUUM [10] %3Ci%3E RFC\n",
      "--------------\n",
      "ID: BBa_K649901\n",
      "Original Description: test\n",
      "Description: test x Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC[10]12%3Csub%3E/Test%21%3Csequencing%3D(+2)\n",
      "--------------\n",
      "ID: BBa_K660004\n",
      "Original Description: iLOV\n",
      "Description: iLOV is a variant of LOV2 (http://parts.igem.org/part%3A%3B%3D%3Csub%3ELOV.pLoV.ccs.split%3EB.\n",
      "--------------\n",
      "ID: BBa_K669000\n",
      "Original Description: chiS\n",
      "Description: chiS belongs to a signal transduction system specific for chitin oligosaccharides (ChiS)\n",
      "--------------\n",
      "ID: BBa_K669001\n",
      "Original Description: chiP\n",
      "Description: chiP is a chitin oligosaccharide specific porin of Vibrio tetR%3Csub%3E. coli sub-unit(s)\n",
      "--------------\n",
      "ID: BBa_K669002\n",
      "Original Description: CBP\n",
      "Description: chitooligosaccharide-binding protein (cbp) is a cytoplasmic protein that binds to chitotococcus spp.\n",
      "--------------\n",
      "ID: BBa_K678070\n",
      "Original Description: p68\n",
      "Description: p68 is a plasmid that can be used to assay promoter activity in aspergillus sp.\n",
      "--------------\n",
      "ID: BBa_K726004\n",
      "Original Description: RelB\n",
      "Description: RelB part of a toxin-antitoxin system. Compatibility: 10COM, Description: %7D\n",
      "--------------\n",
      "ID: BBa_K726006\n",
      "Original Description: YefM\n",
      "Description: Antitoxin of the yefM-yoeB toxin-antitoxin %3A YES-%3EYEFM-YOEB\n",
      "--------------\n",
      "ID: BBa_K726013\n",
      "Original Description: YoeB\n",
      "Description: Toxic component of a toxin-antitoxin (TA) module. %3A YoeB%3Csub%3E.\n",
      "--------------\n",
      "ID: BBa_K764002\n",
      "Original Description: WbnK\n",
      "Description: Fucosyltransferase wbnK adds a branched -L peptide to the hexapeptide strand.\n",
      "--------------\n",
      "ID: BBa_K764003\n",
      "Original Description: WfcA\n",
      "Description: Close relatives include: wfeE from Escherichia coli O32, WfaO, close relatives also include: WfeI from E. coli K12, rbsA from bacillus thuringiensis\n",
      "--------------\n",
      "ID: BBa_K764004\n",
      "Original Description: WclY\n",
      "Description: wclY is a glycosyltransferase from e. coli O157:H7.\n",
      "--------------\n",
      "ID: BBa_K764007\n",
      "Original Description: WbiP\n",
      "Description: wbiP adds a -D-Galactose donor sugar onto an hexokinase reporter.\n",
      "--------------\n",
      "ID: BBa_K769100\n",
      "Original Description: luxA\n",
      "Description: luxA Sequence and Features Assembly Compatibility%3A RFC(12)%3EluxA %3Csub%3D-lacZ%3ECi%3ELluxA-LVA-Rsa-LuxA.\n",
      "--------------\n",
      "ID: BBa_K769101\n",
      "Original Description: luxD\n",
      "Description: luxD Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10,12,13,14,15,16]\n",
      "--------------\n",
      "ID: BBa_K769200\n",
      "Original Description: ribA\n",
      "Description: this gene is from BL21(DE3) It is coding a protein \"GTP cyclohydrogenase\"\n",
      "--------------\n",
      "ID: BBa_K769201\n",
      "Original Description: ribB\n",
      "Description: This gene is from BL21(DE3) it is coding protein \"3,4-dihydroxy-2-phosphate dehydrogenase\"\n",
      "--------------\n",
      "ID: BBa_K769203\n",
      "Original Description: ribC\n",
      "Description: ribc is coding for a protein \"riboflavin synthase subunit alpha\" %7Balpha-ribose%7D%7ABdbl.\n",
      "--------------\n",
      "ID: BBa_K769205\n",
      "Original Description: ribF\n",
      "Description: ribf%3B%3CBR%3E%3D%3EC5%3E/TP-%3AdbcdB-ribf(E. coli optimised)\n",
      "--------------\n",
      "ID: BBa_K771301\n",
      "Original Description: TesA\n",
      "Description: TesA is involved in the biosynthesis of fatty acids in E. coli. the full-length, %3EmpA%3B%3Ci%3EL.\n",
      "--------------\n",
      "ID: BBa_K771302\n",
      "Original Description: FabG\n",
      "Description: fatty acid synthesis initiated by FabG in E.coli. %5Brbs%5D%5C/TetR%5E. coli%5A\n",
      "--------------\n",
      "ID: BBa_K771303\n",
      "Original Description: FabI\n",
      "Description: FabI %3B involved in the biosynthesis of fatty acids in E. coli. the fatty acid synthesis\n",
      "--------------\n",
      "ID: BBa_K771304\n",
      "Original Description: FabZ\n",
      "Description: FabZ involves in the biosynthesis of fatty acids in E.coli. fatty acid synthesis initiated, %7B%7D%7E. coli\n",
      "--------------\n",
      "ID: BBa_K776004\n",
      "Original Description: PrrC\n",
      "Description: PrrC is involved in transducing signal from cbb3 cytochrome c oxidase to promoter.\n",
      "--------------\n",
      "ID: BBa_K776005\n",
      "Original Description: PpsR\n",
      "Description: PpsR funcion is repression of pigment biosynthesis. psr funcion inhibits %7Brbs.\n",
      "--------------\n",
      "ID: BBa_K777109\n",
      "Original Description: fliC\n",
      "Description: fliC gene codes for flagellin, the subunit that forms the flagellar filament of bacterium flagellum\n",
      "--------------\n",
      "ID: BBa_K777113\n",
      "Original Description: motA\n",
      "Description: motA Proteins are a part of the flagellar motor complex. motA proteins represent the proton conducting proteins of the eosinophiles.\n",
      "--------------\n",
      "ID: BBa_K777117\n",
      "Original Description: motB\n",
      "Description: this gene codes for motB, a part of the flagellar motor %3B motA and motB. motA is a ribozyme tetramethyladiol-transferase enzyme with motB and motC\n",
      "--------------\n",
      "ID: BBa_K777121\n",
      "Original Description: yhjH\n",
      "Description: yhjH is a phosphodiesterase involved in regulating the levels of c-distribution.\n",
      "--------------\n",
      "ID: BBa_K787001\n",
      "Original Description: Ter \n",
      "Description: Ter NADH-dependent crotonyl-CoA Ter from treponema dent, %26%23963%3B%3Csub%3E. cerevisiae\n",
      "--------------\n",
      "ID: BBa_K798018\n",
      "Original Description: TRP1\n",
      "Description: TRP1 encodes phosphoribosylanthranilate isomerase that catalyzes apoptosis.\n",
      "--------------\n",
      "ID: BBa_K805013\n",
      "Original Description: CcdB\n",
      "Description: ccdB (control of cell death) gene cannot be requested due to patent issues. ige, Description %7D\n",
      "--------------\n",
      "ID: BBa_K805014\n",
      "Original Description: LuxI\n",
      "Description: Luxi test Sequence and Features Assembly%3A RFC[10,11]%3Ci%3ELuxi test%3D%3EluxI%3CTetR%3ECL%3B.aspx\n",
      "--------------\n",
      "ID: BBa_K805016\n",
      "Original Description: LuxI\n",
      "Description: Luxi BBa_B0034,bba_c0061,bby_b0015, Luxi_BBa%3CBR%3E%3A%3D%3B%33%3D %3ACbrigade\n",
      "--------------\n",
      "ID: BBa_K817001\n",
      "Original Description: FadR\n",
      "Description: FadR is a construct encoding natural repressor for pfad, a kinase inhibitor\n",
      "--------------\n",
      "ID: BBa_K817004\n",
      "Original Description: SP1\n",
      "Description: Modified pCI-1 (design1) helps to deliver other peptide out of the bacteria. sequence and features, Description: %7B%3Csub%3E-%3D%7D%21%23703%3C/TetR\n",
      "--------------\n",
      "ID: BBa_K817005\n",
      "Original Description: SP2\n",
      "Description: modified pCI-1 (design1) helps to deliver other peptide out of the bacteria. it is a repressible ribose-dependent kinase.\n",
      "--------------\n",
      "ID: BBa_K817006\n",
      "Original Description: SP3\n",
      "Description: SP3 is a signal peptide that helps to deliver other signals out of the bacteria. it is %26%23106%3B %3Ci%3E%3D%3B SP3\n",
      "--------------\n",
      "ID: BBa_K821000\n",
      "Original Description: Test\n",
      "Description: Test Test Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12COMPATIBILITY%21%26%23963%3B%3Csubtyping %3E. coli%23%23966%3\n",
      "--------------\n",
      "ID: BBa_K821999\n",
      "Original Description: Test\n",
      "Description: Test Test Sequence and Features Assembly %3A 10COMPATIBLE WITH RFC[10] 12COM, Description%3B test sequence and features assembly\n",
      "--------------\n",
      "ID: BBa_K826008\n",
      "Original Description: fdr\n",
      "Description: fdr acts on iron-sulfur proteins as donors, with NAD+ or NADP+ as donor %3Ci%3E.\n",
      "--------------\n",
      "ID: BBa_K826009\n",
      "Original Description: ruba\n",
      "Description: Ruba rubredoxin sequence and features assembly compatibility%3B%3E WITH RFC%3A %3C/TetR%3D\n",
      "--------------\n",
      "ID: BBa_K826010\n",
      "Original Description: aldH\n",
      "Description: aldH catalyzes the aldehydes to CO2 at the same time, another enzyme, hexagonase\n",
      "--------------\n",
      "ID: BBa_K835001\n",
      "Original Description: EnvZ\n",
      "Description: EnvZ Perceive Osmolality Shift, and Control Expression of Membrane Protein OmpF and OmpC, Description\n",
      "--------------\n",
      "ID: BBa_K838004\n",
      "Original Description: mCMV\n",
      "Description: mCMV is a minimal promoter for mammalian cells. this part is included in the %26%23703%3A%2CBR%3Csub%3E%3B(generic)%3A promoter%3\n",
      "--------------\n",
      "ID: BBa_K842000\n",
      "Original Description: flhB\n",
      "Description: flhB is one of three flagella genes responsible for the generation of proteins that export flagellin to e. coli.\n",
      "--------------\n",
      "ID: BBa_K842001\n",
      "Original Description: flhD\n",
      "Description: flhD is directly induced by several separate systems, among these is the two-component quo, among which is the tetR quo.\n",
      "--------------\n",
      "ID: BBa_K842002\n",
      "Original Description: flgJ\n",
      "Description: flgJ transcribes a flagellum specific muramidase which hydrolyzes %7Ci%7D%2C/i%3E\n",
      "--------------\n",
      "ID: BBa_K842003\n",
      "Original Description: fliA\n",
      "Description: fliA is an alternate sigma factor for the class 3 flagella operons. %3Csub%3E%3A b-sigma.\n",
      "--------------\n",
      "ID: BBa_K842004\n",
      "Original Description: fliC\n",
      "Description: used for reconstitution of flagella apparatus in E.coli B strains. %26%23703%3E. coli%3E%3Ci%3EB. sp.\n",
      "--------------\n",
      "ID: BBa_K842005\n",
      "Original Description: fliH\n",
      "Description: fliH function as part of the flagella specific export system and is necessary for flageller growth and assembly. %7B%7D%7BB%3D\n",
      "--------------\n",
      "ID: BBa_K842006\n",
      "Original Description: cheA\n",
      "Description: activated cheA self-phosphorylates itself by hydrolyzing ATP in order to gain a repressible promoter.\n",
      "--------------\n",
      "ID: BBa_K842007\n",
      "Original Description: cheB\n",
      "Description: cheB removes the methyl group that are attached to the gamma-glutamyl adduct.\n",
      "--------------\n",
      "ID: BBa_K842008\n",
      "Original Description: cheW\n",
      "Description: cheW is involved in the transmission of sensory signals from the chemoreceptors to the flagellar membranes. It is a member of the ribosomal chemotactic protein family.\n",
      "--------------\n",
      "ID: BBa_K842009\n",
      "Original Description: cheY\n",
      "Description: cheY is a regulatory protein that reverses the direction of flagella rotatation from counter-clockwise to clockwise.\n",
      "--------------\n",
      "ID: BBa_K842010\n",
      "Original Description: cheZ\n",
      "Description: cheZ is a regulatory protein that constantly dephosphorylates cheY that is attached to a flag, which is phosphorylated.\n",
      "--------------\n",
      "ID: BBa_K842011\n",
      "Original Description: motA\n",
      "Description: motA is a structural protein for the stationary element of the flagella motor. used for reconstitution of flag, used for e. coli.\n",
      "--------------\n",
      "ID: BBa_K842012\n",
      "Original Description: motB\n",
      "Description: motB is a structural protein for the stationary element of the flagella motor. the protein works in conjunction with a ribosome.\n",
      "--------------\n",
      "ID: BBa_K851003\n",
      "Original Description: XylR\n",
      "Description: XylR is the regulatory protein of the xylose operon in b. subtilis. a protein that represses the expression of a specific operon by binding to a conserved promoter.\n",
      "--------------\n",
      "ID: BBa_K858000\n",
      "Original Description: SdiA\n",
      "Description: LuxR ortholog is found in the LT2 strain of salmonella. dimerizes and activates LuxR repressor protein.\n",
      "--------------\n",
      "ID: BBa_K858004\n",
      "Original Description: NucB\n",
      "Description: NucB, a nuclease that was taken from the Bacillus subtilis strain 168, %26%2370%3B%3C %23703%3C/TetR strain %3A%3E%3\n",
      "--------------\n",
      "ID: BBa_K864204\n",
      "Original Description: OmpF\n",
      "Description: OmpF forms cell pores facilitating passive diffusion of small molecules across the outer cell membrane. forms a mixed, %29%26%23706%3B%3Csub%3E-TetR\n",
      "--------------\n",
      "ID: BBa_K864680\n",
      "Original Description: tetM\n",
      "Description: this gene confers tetracycline resistance (at least 12 g/ml to E. coli n.s.\n",
      "--------------\n",
      "ID: BBa_K875003\n",
      "Original Description: CymR\n",
      "Description: composite produces constitutively the CymR regulator protein, that binds the cumate operator repressing, phosphatase\n",
      "--------------\n",
      "ID: BBa_K879011\n",
      "Original Description: RFP\n",
      "Description: RFP The part contains sequence from E1010 with removal of Kpn I site. this was done to, RFP%3Csub%3E1010\n",
      "--------------\n",
      "ID: BBa_K879017\n",
      "Original Description: LacI\n",
      "Description: LacI Sequence and Features Assembly Compatibility With RFC[10,11,12,13,14,15,16,17,18,19,20]\n",
      "--------------\n",
      "ID: BBa_K879018\n",
      "Original Description: TetR\n",
      "Description: TetR Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10] 12, %7DeletR%3B%7B%2Ci%7BRet%23%7D%7BB%26%2370\n",
      "--------------\n",
      "ID: BBa_K879927\n",
      "Original Description:  \n",
      "Description: this plasmid was designed to have its copy number controlled by the presence or absence of the inducer molecule, %2Ci%2ECdB%26%3EccdB(i)\n",
      "--------------\n",
      "ID: BBa_K879928\n",
      "Original Description:  \n",
      "Description: Plasmid %3CBR%3E%3A Inducible Promoter plasmid%3D%3ACi%3EBaa1-%3EGFP reporter%3B%3ECas9\n",
      "--------------\n",
      "ID: BBa_K892008\n",
      "Original Description: osmY\n",
      "Description: osmY code for the Osmotically induced protein y which has been shown to have export peptides.\n",
      "--------------\n",
      "ID: BBa_K892009\n",
      "Original Description: fucO\n",
      "Description: fucO is required for e. coli to utilize ethylene glycol as a food source. FucO %3Csub%3E/Tet-%3EB%3EFUG%3A%3CE%3D\n",
      "--------------\n",
      "ID: BBa_K892010\n",
      "Original Description: aldA\n",
      "Description: AldA is one of the genes required for e. coli to utilize ethylene glycol as a %3CIP%3Ethanol(weak RBS)\n",
      "--------------\n",
      "ID: BBa_K892016\n",
      "Original Description: Cph8\n",
      "Description: Cph8 red light sensor (cph1/envz chimera) sequence and features assembly comp, hexadecibel\n",
      "--------------\n",
      "ID: BBa_K892101\n",
      "Original Description: fdsa\n",
      "Description: fdsa sequence and features assembly compatibility%3A RFC%3E%3Csub%3D%3ECi%3EL.asp(tetrachlorosidae)\n",
      "--------------\n",
      "ID: BBa_K902010\n",
      "Original Description: PhoP\n",
      "Description: PhoP is a transcription factor which is phosphorylated by PhoQ BBa_K90 kinase.\n",
      "--------------\n",
      "ID: BBa_K902011\n",
      "Original Description: PhoQ\n",
      "Description: PhoQ is part of the PhoPQ two component regulatory system. it acts as a transmembrane.\n",
      "--------------\n",
      "ID: BBa_K902068\n",
      "Original Description: RhaS\n",
      "Description: RhaS is a transcription factor which is part of the rhaSR operon. it activates apoptosis in response to nitric oxide\n",
      "--------------\n",
      "ID: BBa_K902069\n",
      "Original Description: RhaR\n",
      "Description: In the presence of rhamnose, it complexes with the sugar to upregulate the rhodamine receptor.\n",
      "--------------\n",
      "ID: BBa_K918012\n",
      "Original Description: ADH2\n",
      "Description: ADH2 s Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10, %26%21%26%23706%3B%3C/TetR%21%3Ci%3E-ADH2\n",
      "--------------\n",
      "ID: BBa_K934027\n",
      "Original Description: test\n",
      "Description: Test z Sequence and Features Assembly Compatibility%3A 10Incompatible With RFC[10,100%3E]\n",
      "--------------\n",
      "ID: BBa_K950005\n",
      "Original Description: lacZ\n",
      "Description: LacZ reporter gene sequence and features assembly compatible with 10COMPATIBLE WITH%7Brbs%7D%7E%5Csub%21%7D.\n",
      "--------------\n",
      "ID: BBa_M1011\n",
      "Original Description: phaP\n",
      "Description: Noggin is a protein involved at multiple stages of vertebrate embryonic development including neural induction and bone marrow reprogramming.\n",
      "--------------\n",
      "ID: BBa_M11301\n",
      "Original Description: OxyA\n",
      "Description: OxyA streptomyces rimosus oxytetracycline gene cluster, complete %26%23703%3B %3Ci%3E%3A tet(I)-OxyA cluster\n",
      "--------------\n",
      "ID: BBa_M11302\n",
      "Original Description: OxyB\n",
      "Description: OxyB streptomyces rimosus oxytetracycline gene cluster, complete (OxyB)\n",
      "--------------\n",
      "ID: BBa_M11304\n",
      "Original Description: OxyK\n",
      "Description: OxyK streptomyces rimosus oxytetracycline gene cluster, complete, GFP%3Csubmit-%3EcoDistrict%3A YFP\n",
      "--------------\n",
      "ID: BBa_M11305\n",
      "Original Description: OxyF\n",
      "Description: OxyF streptomyces rimosus oxytetracycline gene cluster, complete, %26%23703%3B%3B\n",
      "--------------\n",
      "ID: BBa_M11306\n",
      "Original Description: oxyL\n",
      "Description: oxyL Streptomyces rimosus sp. %3Csubtil.%3E-sequence-and-features-Assembly-Compatibility\n",
      "--------------\n",
      "ID: BBa_M11307\n",
      "Original Description: OxyR\n",
      "Description: OxyR streptomyces coelicolor a3(2) AhpD (ahpB) with RBS\n",
      "--------------\n",
      "ID: BBa_M11308\n",
      "Original Description: OxyQ\n",
      "Description: Oxyq OxyQ Streptomyces rimosus sequence and features assassment%3CBR%3D%3E\n",
      "--------------\n",
      "ID: BBa_M11309\n",
      "Original Description: OxyT\n",
      "Description: OxyT Streptomyces rimosus sequence and features assembly. %7B%7D%3A%3C/D%7E%2C/dbl%3E\n",
      "--------------\n",
      "ID: BBa_M11310\n",
      "Original Description: OleY\n",
      "Description: OleY oleY streptomyces antibioticus sequence and features assembly%21%23963%3B%23966%3Bcomplex\n",
      "--------------\n",
      "ID: BBa_M11311\n",
      "Original Description: OleV\n",
      "Description: OleV streptomyces antibioticus 2,3-dehydratase (OleV) sequence, %26%23953%3B%3Ci%3E.\n",
      "--------------\n",
      "ID: BBa_M11312\n",
      "Original Description: OleW\n",
      "Description: OleW putative 3-ketoreductase streptomyces antibioticus sequence and features assembly%3A %3Breproducible%3C/dbl%3E. sp.\n",
      "--------------\n",
      "ID: BBa_M11313\n",
      "Original Description: urdR\n",
      "Description: urdR NDP-hexose 4-ketoreductase %3Ci%3ERD%3E UrdR sequence%3A ketoadiene dehydroacetate\n",
      "--------------\n",
      "ID: BBa_M11314\n",
      "Original Description: oleL\n",
      "Description: oleL dTDP-4-keto-6-deoxyglucose 3,5-epsilon ribosome binding protein\n",
      "--------------\n",
      "ID: BBa_M11315\n",
      "Original Description: oleS\n",
      "Description: oleS dTDP-D-glucose synthase [Streptomyosin II]%3B %3EtetR%3Ci%3EP-dtdp-d-glycos\n",
      "--------------\n",
      "ID: BBa_M11316\n",
      "Original Description: oleE\n",
      "Description: oleE dehydratase [Streptomyces aeruginosus] sequence and features assembly compat.\n",
      "--------------\n",
      "ID: BBa_M11317\n",
      "Original Description: oxyN\n",
      "Description: oxyN streptomyces rimosus oxytetracycline gene cluster, complete, gln.\n",
      "--------------\n",
      "ID: BBa_M11318\n",
      "Original Description: OxyD\n",
      "Description: OxyD [Streptomyces rimosus]%3Bsequence and Features Assembly Compatibility: %3A plasmid sequence and features\n",
      "--------------\n",
      "ID: BBa_M1145\n",
      "Original Description: part\n",
      "Description: Part ad Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10,11,12,13,14]\n",
      "--------------\n",
      "ID: BBa_M1147\n",
      "Original Description: PhaP\n",
      "Description: PhaP asgasgf Sequence and Features Assembly%3A %3Ci%3EGFP%3E10COMPATIBLE WITH RFC%21%3A GFP\n",
      "--------------\n",
      "ID: BBa_M11560\n",
      "Original Description: CUP2\n",
      "Description: CUP2 - Copper-binding transcription factor; activates transcription of the metallothionein genes, chromosomal inactivated\n",
      "--------------\n",
      "ID: BBa_M11561\n",
      "Original Description: CAD1\n",
      "Description: CAD1 calmium induced transcriptional activator sequence and features assembly Compatibility: 10COMPA%26%23953%3B%3Csub%33%3E%3A10COMPA\n",
      "--------------\n",
      "ID: BBa_M11563\n",
      "Original Description: cole\n",
      "Description: Cole cole sequence and features assembly compatibility%3A 10Compatible with RFC%3E[10]12, RBS%3CIP%3D\n",
      "--------------\n",
      "ID: BBa_M11564\n",
      "Original Description: test\n",
      "Description: Test test Sequence and Features Assembly Compatibility%3A RFC[10%3Csub%3E%3D%3B RFC(Sequence and Features)\n",
      "--------------\n",
      "ID: BBa_M11565\n",
      "Original Description: test\n",
      "Description: Test test Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC[10]I, Description: %7B%7D\n",
      "--------------\n",
      "ID: BBa_M11566\n",
      "Original Description: test\n",
      "Description: Test test Sequence and Features Assembly Compatibility%3A 10INCOMPATIBLE WITH RFC[10]I%3B %3Csub%3E%3D\n",
      "--------------\n",
      "ID: BBa_M11567\n",
      "Original Description: phaC\n",
      "Description: phaC gkjfglkdjsglpdsf Sequence and Features - %3A%3EPf%3Ci%3ESP.\n",
      "--------------\n",
      "ID: BBa_M1160\n",
      "Original Description: Test\n",
      "Description: Test Sample Sequence and Features Assembly Compatibility (RFC)%3A 10INCOMPATIBLE WITH RFC[10]I\n",
      "--------------\n",
      "ID: BBa_M1161\n",
      "Original Description: Test\n",
      "Description: Test Check 1 2 Sequence and Features Assembly compatible with RFC[10]%10Assembly%10Compatibility%10%10C/Tet-%10D%10B%1040\n",
      "--------------\n",
      "ID: BBa_M1166\n",
      "Original Description: PhaP\n",
      "Description: There is currently no text in this page. you can search for this page title in other pages, or search for the description in the, Description:\n",
      "--------------\n",
      "ID: BBa_M1167\n",
      "Original Description: ssn\n",
      "Description: ssn protein sequence Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC, RFP%3A %3Csubtyping%3D\n",
      "--------------\n",
      "ID: BBa_M1173\n",
      "Original Description: asdf\n",
      "Description: Temporary asdf ads;flj as Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH,\n",
      "--------------\n",
      "ID: BBa_M1176\n",
      "Original Description: part\n",
      "Description: Part ad Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10,11]%3Ci%3E%3D%3Brbs(weak RBS)\n",
      "--------------\n",
      "ID: BBa_M1177\n",
      "Original Description: HK\n",
      "Description: Temporary HK HK Sequence and Features Assembly Compatibility: 10Compatible with RFC[10]. %7Brfc%3A%7D%7BA%7BDEV%3Csub%7d%7e%\n",
      "--------------\n",
      "ID: BBa_M1182\n",
      "Original Description: PhaP\n",
      "Description: PhaP HK Sequence and Features Assembly (RPB) Compatibility%3Csub%3EdbF with RFC(sub%3)%3EC%3B%3D)\n",
      "--------------\n",
      "ID: BBa_M1185\n",
      "Original Description: phB\n",
      "Description: phB a;sldfsd;jSequence and Features Assembly Compatibility: %7B%7D%7E%7BD%21%7D\n",
      "--------------\n",
      "ID: BBa_M1188\n",
      "Original Description: PhaP\n",
      "Description: PhaP HK Sequence and Features Assembly Compatibility: 10INCOMPATIBLE WITH RFC%3A %3B%3C/TetF%3E%3D\n",
      "--------------\n",
      "ID: BBa_M1189\n",
      "Original Description: ssn\n",
      "Description: ssn Protein sequence Sequence and Features AssemblyCompatible With RFC%3CBR%3E%3D%3A RFC(B0040)\n",
      "--------------\n",
      "ID: BBa_M1190\n",
      "Original Description: PhaP\n",
      "Description: PhaP fhh Sequence and Features Assembly Compatibility with RFC%3A 10COMPATIBLE WITH RFC, %3B%3Csub%3E%3D%3EPhoP\n",
      "--------------\n",
      "ID: BBa_M1191\n",
      "Original Description: Ryan\n",
      "Description: Ryan eug Sequence and Features Assembly Compatibility: 10COMPATIBLE WITH RFC[10,11,12,13,14]\n",
      "--------------\n",
      "ID: BBa_M1199\n",
      "Original Description: PhaP\n",
      "Description: PhaP Polyhydroxyalkanoates (PHAs) are polyoxoesters that are produced from phloydiocysteine\n",
      "--------------\n",
      "ID: BBa_M12067\n",
      "Original Description: E1\n",
      "Description: the receptors on the liver recognize this protein, which leads to endocytosis of the particle displaying the protein. %7D\n",
      "--------------\n",
      "ID: BBa_M1298\n",
      "Original Description: phaP\n",
      "Description: phaP This part is used in polyhydroxyalkanoic acid granule binding. it is a chromosomal repressible RNAse.\n",
      "--------------\n",
      "ID: BBa_M1299\n",
      "Original Description: PhaP\n",
      "Description: -See Blackboard Attachment Sequence and Features. assembly compatibility: 10INCOMPATIBLE, %26%23703%3B%3B.\n",
      "--------------\n",
      "ID: BBa_M1300\n",
      "Original Description: Phap\n",
      "Description: 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 112 %21%3Apr%3Arc%3E.aspx%3B.\n",
      "--------------\n",
      "ID: BBa_M1311\n",
      "Original Description: bcd\n",
      "Description: bcd enzyme open reading frame coding sequence. 10COMPATIBLE WITH RFC[10,11,12], Description\n",
      "--------------\n",
      "ID: BBa_M1355\n",
      "Original Description: RS1\n",
      "Description: RS1 homology region for recombination into synechococcus PCC 7002 sequence, pRS1 %26%23943%3B70023%2394\n",
      "--------------\n",
      "ID: BBa_M1356\n",
      "Original Description: RS2\n",
      "Description: RS2 right side homology region for recombination into synechococcus PCC 700, %3BoB%3E\n",
      "--------------\n",
      "ID: BBa_M1398\n",
      "Original Description: PhaP\n",
      "Description: Ralstonia eutropha phasin (phaS) mRNA, complete cGMP %7D%7BTetR%2Csub%3Etro%3C/TetF %21%23\n",
      "--------------\n",
      "ID: BBa_M1399\n",
      "Original Description: PhaP\n",
      "Description: Ralstonia eutropha phasin coding region re-evaluated. %7D%7Bgenomics%21%7D\n",
      "--------------\n",
      "ID: BBa_M1401\n",
      "Original Description: PhaP\n",
      "Description: Ralstonia eutropha phasin (phaP) mRNA, complete cds, %3A%3Ci%3EBase(c)\n",
      "--------------\n",
      "ID: BBa_M1402\n",
      "Original Description: phaP\n",
      "Description: Ralstonia eutropha phasin (phaP) mRNA, complete cI, RBS%3B%3E%3Ci%3Errb%3A %3EC 3.0 - rrbs\n",
      "--------------\n",
      "ID: BBa_M1409\n",
      "Original Description: ribD\n",
      "Description: ribD gene for synthesizing riboflavin %3B sequence and features assembly compatibility%3A%3Ci%3e%3E rib D gene for syringase riboflavin\n",
      "--------------\n",
      "ID: BBa_M1414\n",
      "Original Description: ribF\n",
      "Description: 10compat%3A riboflavin breaking down gene for breaking down the rbs%3E and features assembly compatibility%3B %3Csub%3D%7B%7C/sub%21%3E%23%3E\n",
      "--------------\n",
      "ID: BBa_M1440\n",
      "Original Description: ribB\n",
      "Description: ribB catalyzes the synthesis of the 4-carbon compound 3,4-dihydroxy-2-propyl-tetrachloroethane\n",
      "--------------\n",
      "ID: BBa_M1526\n",
      "Original Description: sgd1\n",
      "Description: Sgd1 sequence and features assembly Compatibility with rfc [10INCOMPATIBLE WITH RFC] %10Incompatible with RFC%10,\n",
      "--------------\n",
      "ID: BBa_M1527\n",
      "Original Description: sgd\n",
      "Description: 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 112 psts\n",
      "--------------\n",
      "ID: BBa_M1619\n",
      "Original Description: loxr\n",
      "Description: loxr Reverse compliment for lox Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH%3Csub%3Bloxr%3E. coli\n",
      "--------------\n",
      "ID: BBa_M1699\n",
      "Original Description: scrT\n",
      "Description: scrT is a protein which serves as a symporter for sucrose into the cell. %7Brbs%7D\n",
      "--------------\n",
      "ID: BBa_M1839\n",
      "Original Description: gfgf\n",
      "Description: 10COMPATIBLE WITH RFC[10]12, gfg sequence and features assembly compatibility%0D%7B%26%23963%3B12\n",
      "--------------\n",
      "ID: BBa_M1843\n",
      "Original Description: His\n",
      "Description: His His Sequence and Features Assembly (HisS)%3Csub%3E%3A RFC(Sub%3)%3D%3EC5%3E)%3%3C ePulse%3B(sub%)3C/sub%\n",
      "--------------\n",
      "ID: BBa_M1845\n",
      "Original Description: His6\n",
      "Description: His6 sequence and features assembly compatibility%3A 12COMPATIBLE WITH RFC[10]%3Csub%3E.His6%3B sequence and feature assassembly%3D.\n",
      "--------------\n",
      "ID: BBa_M1871\n",
      "Original Description: GFP\n",
      "Description: GFP sequence and features assembly compatibility with RFC[10] 12COMPATIBLE WITH RFC%3A 10%3Csub%3E(sub-units)\n",
      "--------------\n",
      "ID: BBa_M1872\n",
      "Original Description: GFP\n",
      "Description: Temporary GFP ampicilin sequence and features assembly compatibility%3A%3B%3Csub%3E%3D%31%3Ci%33%3Eluciferase and GFP repressors\n",
      "--------------\n",
      "ID: BBa_M1887\n",
      "Original Description: fgf\n",
      "Description: fgf sequence and features assembly compatible with 10INCOMPATIBLE WITH RFC[10,11] %3Csub%3E.R.C.\n",
      "--------------\n",
      "ID: BBa_M1888\n",
      "Original Description: fdf\n",
      "Description: fdf sequence and features assembly compatibleity:10COMPATIBLE WITH RFC[10]12, %21%26%26%12,%26%24966%33%23703%26%23986%3B%2Cited%2\n",
      "--------------\n",
      "ID: BBa_M1989\n",
      "Original Description: aa\n",
      "Description: 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 192 %26%3B%3Ci%3ELEGAL SITE FINISHED!\n",
      "--------------\n",
      "ID: BBa_M1990\n",
      "Original Description: Aaaa\n",
      "Description: Aaaa Sequence and Features Assembly Compatibility%3A 10COMPATIBLE WITH RFC[10], %3B%3E%3C/dbls\n",
      "--------------\n",
      "ID: BBa_M1991\n",
      "Original Description: aa\n",
      "Description: 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 112 %26%26%23303%3BPstA%3Ci%3E. coli\n",
      "--------------\n",
      "ID: BBa_M1998\n",
      "Original Description: blah\n",
      "Description: 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 112. http://www.swiss-rcgi.eui.gov.uk/en-GB%3D%3A%3\n",
      "--------------\n",
      "ID: BBa_M300067\n",
      "Original Description: misc\n",
      "Description: 10COMPATIBLE WITH RFC[10]. 12Compatible with RFC(short version of RFC).\n",
      "--------------\n",
      "ID: BBa_M300068\n",
      "Original Description: misc\n",
      "Description: 10COMPATIBLE WITH RFC[10]. 12Compatible with RFC,,. %7D%7Brbs.\n",
      "--------------\n",
      "ID: BBa_M36005\n",
      "Original Description: ASDF\n",
      "Description: ASDF ASD Sequence and Features Assembly Compatibility: 10Compatible with RFC[10]%10%10Csub%10E%10D%10B RFC(+RNaser)%0D(-)%10-(-RNase\n",
      "--------------\n",
      "ID: BBa_M36113\n",
      "Original Description: asdf\n",
      "Description: 10COMPATIBLE WITH RFC[10] 12COM, Description: Asdf sequence and features assembly %26%23963%3B12COMPATIBILITY%3D\n",
      "--------------\n",
      "ID: BBa_M36123\n",
      "Original Description: sdfa\n",
      "Description: sdfa adffafaadg Sequence and Features Assembly Compatibility %3A RBS\n",
      "--------------\n",
      "ID: BBa_M36711\n",
      "Original Description: rubA\n",
      "Description: RubA codes for a protein that supplies reducing electrons to an alkane hydroxylating reaction %3A.\n",
      "--------------\n",
      "ID: BBa_M39008\n",
      "Original Description: NanR\n",
      "Description: This is the repressor for the Nan Operon and is turned off by the presence of sialic acid (SiA).\n",
      "--------------\n",
      "ID: BBa_M39009\n",
      "Original Description: NanT\n",
      "Description: NanT allows the transport of Sialic Acid into the cell. assembly, Compatibility: 10INCOMPAA, %7D\n",
      "--------------\n",
      "ID: BBa_M39013\n",
      "Original Description: LasR\n",
      "Description: LasL is used in quorum sensing in p. aeruginosa. it is a component of pseudomonas sp.\n",
      "--------------\n",
      "ID: BBa_M39015\n",
      "Original Description: HrpR\n",
      "Description: This is one of two proteins (HrpS and HrpR) needed for the hrp repressor enzyme.\n",
      "--------------\n",
      "ID: BBa_M39017\n",
      "Original Description: TetR\n",
      "Description: TetR is the coding region for the repressor. Assembly compatibility: 10INCOM, %7B%7D\n",
      "--------------\n",
      "ID: BBa_M39903\n",
      "Original Description: foo\n",
      "Description: Foo foo Sequence and Features Assembly Compatibility with RFC[10,11] %7D%7B%26%233%7Brcs.ac.uk%3A%21%7D\n",
      "--------------\n",
      "ID: BBa_Q00121\n",
      "Original Description: LacI\n",
      "Description: LacI lacI QPI with B0030 which according to preliminary experiments is a \"medium\" strength Rheo%3A Rheumatol\n",
      "--------------\n",
      "ID: BBa_Q00400\n",
      "Original Description: Tet\n",
      "Description: Tet Tet QPI with B0030 which according to preliminary experiments is a \"strong\" strength RBS, %7B%7D\n",
      "--------------\n",
      "ID: BBa_Q02121\n",
      "Original Description: LacI\n",
      "Description: lacI lacI QPI with B0032 which according to preliminary experiments is a \"medium\" strength RBS%3A%3Ci%3EL.\n",
      "--------------\n",
      "ID: BBa_Q02400\n",
      "Original Description: Tet\n",
      "Description: Tet Tet QPI with B0032 which according to preliminary experiments is a \"medium\" strength RBS %3Ci%3EqPI with Tet-Tet-QPI\n",
      "--------------\n",
      "ID: BBa_T3000\n",
      "Original Description: OK\n",
      "Description: 12COMPATIBLE WITH RFC[10] %10%10Ci%10E%10D%10ECI%10100%101%10EXTREMELY PERFORMED WITH RFP[10%0C)\n",
      "--------------\n",
      "ID: BBa_T4000\n",
      "Original Description: luxC\n",
      "Description: luxC is useful for producing light in bacteria from endogenous substrates. It is the first enzyme in the lux family.\n",
      "--------------\n",
      "ID: BBa_V1001\n",
      "Original Description: DH5a\n",
      "Description: DH5a F-endA1 glnV44 thi-1 recA1 relA1 Type: Cells%3A %3Ci%3ElacZalpha(weak RBS)\n",
      "--------------\n",
      "ID: BBa_Y1005\n",
      "Original Description: 2u\n",
      "Description: 2u Yeast Origin Replicates many times in a Cell Sequence and Features Assembly, %26%23963%3B%3Csub%3E. coli%3B(weak RBS)\n",
      "--------------\n",
      "ID: BBa_Z52934\n",
      "Original Description: vdh\n",
      "Description: %7Pseudomonas aeruginosa vdh%21%7D%7B%26%27306%3B%7D\n",
      "--------------\n"
     ]
    }
   ],
   "source": [
    "# Generate descriptions\n",
    "for p in for_improvement:\n",
    "#     one_shot = shots[0] + \"\\n\"\n",
    "    \n",
    "#     input_text = one_shot + f\"Type: {p['type']}, Information: {p['info']}\"\n",
    "    input_text = f\"Type: {p['type']}, Information: {p['info']}, Description: \"\n",
    "    \n",
    "    input_ids = tokenizer.encode(input_text + \", Description: \", return_tensors=\"pt\")\n",
    "    output = model.generate(input_ids, max_length=60, num_beams=4, early_stopping=True)\n",
    "    description = tokenizer.decode(output[0], skip_special_tokens=True)\n",
    "\n",
    "    print(f\"ID: {p['id']}\")\n",
    "    print(f\"Original Description: {p['description']}\")\n",
    "    print(f\"Description: {description}\")\n",
    "    print(\"--------------\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "id": "4cb61119",
   "metadata": {
    "papermill": {
     "duration": 0.127558,
     "end_time": "2023-08-06T17:11:15.006517",
     "exception": false,
     "start_time": "2023-08-06T17:11:14.878959",
     "status": "completed"
    },
    "tags": []
   },
   "outputs": [],
   "source": []
  }
 ],
 "metadata": {
  "kernelspec": {
   "display_name": "Python 3",
   "language": "python",
   "name": "python3"
  },
  "language_info": {
   "codemirror_mode": {
    "name": "ipython",
    "version": 3
   },
   "file_extension": ".py",
   "mimetype": "text/x-python",
   "name": "python",
   "nbconvert_exporter": "python",
   "pygments_lexer": "ipython3",
   "version": "3.10.12"
  },
  "papermill": {
   "default_parameters": {},
   "duration": 32377.148145,
   "end_time": "2023-08-06T17:11:19.455822",
   "environment_variables": {},
   "exception": null,
   "input_path": "__notebook__.ipynb",
   "output_path": "__notebook__.ipynb",
   "parameters": {},
   "start_time": "2023-08-06T08:11:42.307677",
   "version": "2.4.0"
  },
  "widgets": {
   "application/vnd.jupyter.widget-state+json": {
    "state": {
     "0b0616c8defe40e89821848bac3cf45c": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "194e8ed3f4234beb8d4948d840224e2e": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "26330c1326304009b4e04e846ff186b3": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "FloatProgressModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "FloatProgressModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "ProgressView",
       "bar_style": "success",
       "description": "",
       "description_tooltip": null,
       "layout": "IPY_MODEL_6e344322bc4a4ad3a5af7541ded2cf1c",
       "max": 1389353.0,
       "min": 0.0,
       "orientation": "horizontal",
       "style": "IPY_MODEL_e48ae791fc7b438e96e17de426e25b94",
       "value": 1389353.0
      }
     },
     "2a8990c330804c77b552c4b8e76e6cca": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "2f13f0059b344db4a4ecee170269904a": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "DescriptionStyleModel",
      "state": {
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "DescriptionStyleModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "StyleView",
       "description_width": ""
      }
     },
     "312b9dde8534481e9c1c3cdb2ef69e7d": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "HBoxModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "HBoxModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "HBoxView",
       "box_style": "",
       "children": [
        "IPY_MODEL_39bac8311496409d8114bbe390546a40",
        "IPY_MODEL_6289edabd7934741a51804b8b3b4a9de",
        "IPY_MODEL_a404d81040ce409192cba7a2ddabd6cb"
       ],
       "layout": "IPY_MODEL_0b0616c8defe40e89821848bac3cf45c"
      }
     },
     "32419ef43190418daff9425c2fb0ede2": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "DescriptionStyleModel",
      "state": {
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "DescriptionStyleModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "StyleView",
       "description_width": ""
      }
     },
     "34283512144245c48af435b2e51ec2e2": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "HBoxModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "HBoxModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "HBoxView",
       "box_style": "",
       "children": [
        "IPY_MODEL_75a35bdce2664a08ba93a729107999fc",
        "IPY_MODEL_793b455eda5249e996d81ff3d8bcbe19",
        "IPY_MODEL_a68d9e2d45714c3b8af898df1bdc8d11"
       ],
       "layout": "IPY_MODEL_c9a4ecf2c5b74d52a104ffef64747ab0"
      }
     },
     "349d011907a74c82a9048d79a16bc243": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "HTMLModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "HTMLModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "HTMLView",
       "description": "",
       "description_tooltip": null,
       "layout": "IPY_MODEL_68533f622dfd47daa2e4e69842a165de",
       "placeholder": "​",
       "style": "IPY_MODEL_2f13f0059b344db4a4ecee170269904a",
       "value": " 1.39M/1.39M [00:00&lt;00:00, 3.45MB/s]"
      }
     },
     "3879b14246014346ab82771aff2cf4d0": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "HTMLModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "HTMLModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "HTMLView",
       "description": "",
       "description_tooltip": null,
       "layout": "IPY_MODEL_95d162cabcd249aeaf7d396b98ce9837",
       "placeholder": "​",
       "style": "IPY_MODEL_a9b748c6774b4a2db57a94a8ef2cdba2",
       "value": "Downloading (…)ve/main/spiece.model: 100%"
      }
     },
     "39bac8311496409d8114bbe390546a40": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "HTMLModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "HTMLModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "HTMLView",
       "description": "",
       "description_tooltip": null,
       "layout": "IPY_MODEL_4e21ef9db8174c42a32f04b5e778dfb6",
       "placeholder": "​",
       "style": "IPY_MODEL_ba311ee31ba1457a8cae3e602a60f219",
       "value": "Downloading model.safetensors: 100%"
      }
     },
     "40a10c73d50c48709705c892c1160458": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "ProgressStyleModel",
      "state": {
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "ProgressStyleModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "StyleView",
       "bar_color": null,
       "description_width": ""
      }
     },
     "40a19dd6685042c9b04470121f67c61a": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "FloatProgressModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "FloatProgressModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "ProgressView",
       "bar_style": "success",
       "description": "",
       "description_tooltip": null,
       "layout": "IPY_MODEL_7992ea419a9844459b63897e2ba0e763",
       "max": 791656.0,
       "min": 0.0,
       "orientation": "horizontal",
       "style": "IPY_MODEL_bdd5afcf008f4efa8dda5b873b82c83c",
       "value": 791656.0
      }
     },
     "4e21ef9db8174c42a32f04b5e778dfb6": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "519849ea9c9247b69a24dddfe26faf63": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "529b7da786554bee879f776671f286a2": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "DescriptionStyleModel",
      "state": {
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "DescriptionStyleModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "StyleView",
       "description_width": ""
      }
     },
     "58a227ff672d4e2f87a3001614e798e3": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "5bd9ede4451540e68e511cfc40cc4c15": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "HTMLModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "HTMLModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "HTMLView",
       "description": "",
       "description_tooltip": null,
       "layout": "IPY_MODEL_6e17009f018c4d059176357ab1eb6ed2",
       "placeholder": "​",
       "style": "IPY_MODEL_32419ef43190418daff9425c2fb0ede2",
       "value": "Downloading (…)/main/tokenizer.json: 100%"
      }
     },
     "5cb6d7f3d3724ee6afcac0b8a2db364f": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "HTMLModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "HTMLModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "HTMLView",
       "description": "",
       "description_tooltip": null,
       "layout": "IPY_MODEL_de8dfc9bad16430c8aae4406cdb4fc57",
       "placeholder": "​",
       "style": "IPY_MODEL_6e583f5126bf47968f1146dd73566856",
       "value": " 792k/792k [00:00&lt;00:00, 2.44MB/s]"
      }
     },
     "60a6f9e22bab459582d73eb0e1084554": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "ProgressStyleModel",
      "state": {
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "ProgressStyleModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "StyleView",
       "bar_color": null,
       "description_width": ""
      }
     },
     "6289edabd7934741a51804b8b3b4a9de": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "FloatProgressModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "FloatProgressModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "ProgressView",
       "bar_style": "success",
       "description": "",
       "description_tooltip": null,
       "layout": "IPY_MODEL_2a8990c330804c77b552c4b8e76e6cca",
       "max": 2950736730.0,
       "min": 0.0,
       "orientation": "horizontal",
       "style": "IPY_MODEL_40a10c73d50c48709705c892c1160458",
       "value": 2950736730.0
      }
     },
     "68533f622dfd47daa2e4e69842a165de": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "6e17009f018c4d059176357ab1eb6ed2": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "6e344322bc4a4ad3a5af7541ded2cf1c": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "6e583f5126bf47968f1146dd73566856": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "DescriptionStyleModel",
      "state": {
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "DescriptionStyleModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "StyleView",
       "description_width": ""
      }
     },
     "71546c452e9a4ddd8c9544a0c5ebf468": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "ProgressStyleModel",
      "state": {
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "ProgressStyleModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "StyleView",
       "bar_color": null,
       "description_width": ""
      }
     },
     "72a1d8ebc7cb46c281053f201740f44b": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "DescriptionStyleModel",
      "state": {
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "DescriptionStyleModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "StyleView",
       "description_width": ""
      }
     },
     "753b96bf469740689165880e45adc9f1": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "DescriptionStyleModel",
      "state": {
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "DescriptionStyleModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "StyleView",
       "description_width": ""
      }
     },
     "75a35bdce2664a08ba93a729107999fc": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "HTMLModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "HTMLModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "HTMLView",
       "description": "",
       "description_tooltip": null,
       "layout": "IPY_MODEL_ddf578778c00427b9947c53aa279558d",
       "placeholder": "​",
       "style": "IPY_MODEL_d0d3a12308a341cc99dcb4d64ff9973c",
       "value": "Downloading (…)neration_config.json: 100%"
      }
     },
     "75f01545da3147af94f3c4b21a196d45": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "793b455eda5249e996d81ff3d8bcbe19": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "FloatProgressModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "FloatProgressModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "ProgressView",
       "bar_style": "success",
       "description": "",
       "description_tooltip": null,
       "layout": "IPY_MODEL_7a71c75ebc2341c4a10fa165bfec8fb4",
       "max": 147.0,
       "min": 0.0,
       "orientation": "horizontal",
       "style": "IPY_MODEL_60a6f9e22bab459582d73eb0e1084554",
       "value": 147.0
      }
     },
     "7992ea419a9844459b63897e2ba0e763": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "7a71c75ebc2341c4a10fa165bfec8fb4": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "7dcb11c789354033aaba288284c85f69": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "HBoxModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "HBoxModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "HBoxView",
       "box_style": "",
       "children": [
        "IPY_MODEL_5bd9ede4451540e68e511cfc40cc4c15",
        "IPY_MODEL_26330c1326304009b4e04e846ff186b3",
        "IPY_MODEL_349d011907a74c82a9048d79a16bc243"
       ],
       "layout": "IPY_MODEL_f88bde0105ad4fdd968a37c69a3fdd2c"
      }
     },
     "8f74fb662c7a44d181fcd1c7695e8183": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "916dce075b07412a9247b2b880214f38": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "92e7cc6d4d184c4cb2fa27a0bc85d630": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "HTMLModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "HTMLModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "HTMLView",
       "description": "",
       "description_tooltip": null,
       "layout": "IPY_MODEL_58a227ff672d4e2f87a3001614e798e3",
       "placeholder": "​",
       "style": "IPY_MODEL_753b96bf469740689165880e45adc9f1",
       "value": " 1.21k/1.21k [00:00&lt;00:00, 74.3kB/s]"
      }
     },
     "9367ed2738fc40708ee4117469cac504": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "HBoxModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "HBoxModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "HBoxView",
       "box_style": "",
       "children": [
        "IPY_MODEL_3879b14246014346ab82771aff2cf4d0",
        "IPY_MODEL_40a19dd6685042c9b04470121f67c61a",
        "IPY_MODEL_5cb6d7f3d3724ee6afcac0b8a2db364f"
       ],
       "layout": "IPY_MODEL_8f74fb662c7a44d181fcd1c7695e8183"
      }
     },
     "95d162cabcd249aeaf7d396b98ce9837": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "a404d81040ce409192cba7a2ddabd6cb": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "HTMLModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "HTMLModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "HTMLView",
       "description": "",
       "description_tooltip": null,
       "layout": "IPY_MODEL_519849ea9c9247b69a24dddfe26faf63",
       "placeholder": "​",
       "style": "IPY_MODEL_72a1d8ebc7cb46c281053f201740f44b",
       "value": " 2.95G/2.95G [00:06&lt;00:00, 464MB/s]"
      }
     },
     "a68d9e2d45714c3b8af898df1bdc8d11": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "HTMLModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "HTMLModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "HTMLView",
       "description": "",
       "description_tooltip": null,
       "layout": "IPY_MODEL_75f01545da3147af94f3c4b21a196d45",
       "placeholder": "​",
       "style": "IPY_MODEL_529b7da786554bee879f776671f286a2",
       "value": " 147/147 [00:00&lt;00:00, 12.8kB/s]"
      }
     },
     "a9b748c6774b4a2db57a94a8ef2cdba2": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "DescriptionStyleModel",
      "state": {
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "DescriptionStyleModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "StyleView",
       "description_width": ""
      }
     },
     "b855fa6b960c4d489828dba4e50b93a4": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "HTMLModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "HTMLModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "HTMLView",
       "description": "",
       "description_tooltip": null,
       "layout": "IPY_MODEL_916dce075b07412a9247b2b880214f38",
       "placeholder": "​",
       "style": "IPY_MODEL_e3c945593b624f66aac17c9b565fa8b4",
       "value": "Downloading (…)lve/main/config.json: 100%"
      }
     },
     "ba311ee31ba1457a8cae3e602a60f219": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "DescriptionStyleModel",
      "state": {
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "DescriptionStyleModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "StyleView",
       "description_width": ""
      }
     },
     "bdd5afcf008f4efa8dda5b873b82c83c": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "ProgressStyleModel",
      "state": {
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "ProgressStyleModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "StyleView",
       "bar_color": null,
       "description_width": ""
      }
     },
     "c9a4ecf2c5b74d52a104ffef64747ab0": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "d0d3a12308a341cc99dcb4d64ff9973c": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "DescriptionStyleModel",
      "state": {
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "DescriptionStyleModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "StyleView",
       "description_width": ""
      }
     },
     "d27b23416c25497194703e64f75f901c": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "d5f60ea6638640ddb2c8c5e0c71491fb": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "FloatProgressModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "FloatProgressModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "ProgressView",
       "bar_style": "success",
       "description": "",
       "description_tooltip": null,
       "layout": "IPY_MODEL_194e8ed3f4234beb8d4948d840224e2e",
       "max": 1209.0,
       "min": 0.0,
       "orientation": "horizontal",
       "style": "IPY_MODEL_71546c452e9a4ddd8c9544a0c5ebf468",
       "value": 1209.0
      }
     },
     "ddf578778c00427b9947c53aa279558d": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "de8dfc9bad16430c8aae4406cdb4fc57": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     },
     "e3c945593b624f66aac17c9b565fa8b4": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "DescriptionStyleModel",
      "state": {
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "DescriptionStyleModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "StyleView",
       "description_width": ""
      }
     },
     "e48ae791fc7b438e96e17de426e25b94": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "ProgressStyleModel",
      "state": {
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "ProgressStyleModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "StyleView",
       "bar_color": null,
       "description_width": ""
      }
     },
     "e5b3b138f19c49f484a93929ee2ea1d2": {
      "model_module": "@jupyter-widgets/controls",
      "model_module_version": "1.5.0",
      "model_name": "HBoxModel",
      "state": {
       "_dom_classes": [],
       "_model_module": "@jupyter-widgets/controls",
       "_model_module_version": "1.5.0",
       "_model_name": "HBoxModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/controls",
       "_view_module_version": "1.5.0",
       "_view_name": "HBoxView",
       "box_style": "",
       "children": [
        "IPY_MODEL_b855fa6b960c4d489828dba4e50b93a4",
        "IPY_MODEL_d5f60ea6638640ddb2c8c5e0c71491fb",
        "IPY_MODEL_92e7cc6d4d184c4cb2fa27a0bc85d630"
       ],
       "layout": "IPY_MODEL_d27b23416c25497194703e64f75f901c"
      }
     },
     "f88bde0105ad4fdd968a37c69a3fdd2c": {
      "model_module": "@jupyter-widgets/base",
      "model_module_version": "1.2.0",
      "model_name": "LayoutModel",
      "state": {
       "_model_module": "@jupyter-widgets/base",
       "_model_module_version": "1.2.0",
       "_model_name": "LayoutModel",
       "_view_count": null,
       "_view_module": "@jupyter-widgets/base",
       "_view_module_version": "1.2.0",
       "_view_name": "LayoutView",
       "align_content": null,
       "align_items": null,
       "align_self": null,
       "border": null,
       "bottom": null,
       "display": null,
       "flex": null,
       "flex_flow": null,
       "grid_area": null,
       "grid_auto_columns": null,
       "grid_auto_flow": null,
       "grid_auto_rows": null,
       "grid_column": null,
       "grid_gap": null,
       "grid_row": null,
       "grid_template_areas": null,
       "grid_template_columns": null,
       "grid_template_rows": null,
       "height": null,
       "justify_content": null,
       "justify_items": null,
       "left": null,
       "margin": null,
       "max_height": null,
       "max_width": null,
       "min_height": null,
       "min_width": null,
       "object_fit": null,
       "object_position": null,
       "order": null,
       "overflow": null,
       "overflow_x": null,
       "overflow_y": null,
       "padding": null,
       "right": null,
       "top": null,
       "visibility": null,
       "width": null
      }
     }
    },
    "version_major": 2,
    "version_minor": 0
   }
  }
 },
 "nbformat": 4,
 "nbformat_minor": 5
}