diff --git a/modules/local/gtf2bed/main.nf b/modules/local/gtf2bed/main.nf
index 464d7f819..a2523c9cf 100644
--- a/modules/local/gtf2bed/main.nf
+++ b/modules/local/gtf2bed/main.nf
@@ -28,4 +28,14 @@ process GTF2BED {
         perl: \$(echo \$(perl --version 2>&1) | sed 's/.*v\\(.*\\)) built.*/\\1/')
     END_VERSIONS
     """
+
+    stub:
+    """
+    touch ${gtf.baseName}.bed
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        perl: \$(echo \$(perl --version 2>&1) | sed 's/.*v\\(.*\\)) built.*/\\1/')
+    END_VERSIONS
+    """
 }
diff --git a/modules/local/gtf2bed/tests/main.nf.test b/modules/local/gtf2bed/tests/main.nf.test
index 698714f8b..b640d2053 100644
--- a/modules/local/gtf2bed/tests/main.nf.test
+++ b/modules/local/gtf2bed/tests/main.nf.test
@@ -20,6 +20,25 @@ nextflow_process {
                 { assert snapshot(process.out).match() }
             )
         }
+    }
+
+    test("sarscov2 - bam - stub") {
+
+    options "-stub"
 
+        when {
+            process {
+                """
+                input[0] = file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true)
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
     }
 }
diff --git a/modules/local/gtf2bed/tests/main.nf.test.snap b/modules/local/gtf2bed/tests/main.nf.test.snap
index 277ebdc23..66ec3bf9e 100644
--- a/modules/local/gtf2bed/tests/main.nf.test.snap
+++ b/modules/local/gtf2bed/tests/main.nf.test.snap
@@ -1,4 +1,27 @@
 {
+    "sarscov2 - bam - stub": {
+        "content": [
+            {
+                "0": [
+                    "genome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ],
+                "1": [
+                    "versions.yml:md5,d04d815c224b980b6f3818d4b2fd4fe3"
+                ],
+                "bed": [
+                    "genome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ],
+                "versions": [
+                    "versions.yml:md5,d04d815c224b980b6f3818d4b2fd4fe3"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-06-21T11:46:28.123826"
+    },
     "sarscov2 - bam": {
         "content": [
             {
diff --git a/modules/local/gtf_filter/main.nf b/modules/local/gtf_filter/main.nf
index 39b215712..60eb9a9bd 100644
--- a/modules/local/gtf_filter/main.nf
+++ b/modules/local/gtf_filter/main.nf
@@ -29,4 +29,14 @@ process GTF_FILTER {
         python: \$(python --version | sed 's/Python //g')
     END_VERSIONS
     """
+
+    stub:
+    """
+    touch ${fasta.baseName}.filtered.gtf
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        python: \$(python --version | sed 's/Python //g')
+    END_VERSIONS
+    """
 }
diff --git a/modules/local/gtf_filter/tests/main.nf.test b/modules/local/gtf_filter/tests/main.nf.test
index 31044be1a..324ee6bb9 100644
--- a/modules/local/gtf_filter/tests/main.nf.test
+++ b/modules/local/gtf_filter/tests/main.nf.test
@@ -4,7 +4,7 @@ nextflow_process {
     script "../main.nf"
     process "GTF_FILTER"
 
-    test("Should run without failures") {
+    test("sarscov2 - fasta - gtf") {
 
         when {
             process {
@@ -21,7 +21,26 @@ nextflow_process {
                 { assert snapshot(process.out).match() }
             )
         }
-
     }
 
+    test("sarscov2 - fasta - gtf - stub") {
+
+    options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gtf', checkIfExists: true)
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+    }
 }
diff --git a/modules/local/gtf_filter/tests/main.nf.test.snap b/modules/local/gtf_filter/tests/main.nf.test.snap
index b763c249c..d22a4fa5b 100644
--- a/modules/local/gtf_filter/tests/main.nf.test.snap
+++ b/modules/local/gtf_filter/tests/main.nf.test.snap
@@ -1,5 +1,5 @@
 {
-    "Should run without failures": {
+    "sarscov2 - fasta - gtf": {
         "content": [
             {
                 "0": [
@@ -18,8 +18,31 @@
         ],
         "meta": {
             "nf-test": "0.8.4",
-            "nextflow": "23.10.1"
+            "nextflow": "24.04.2"
         },
-        "timestamp": "2024-03-06T15:52:37.977802"
+        "timestamp": "2024-06-21T11:47:56.314297"
+    },
+    "sarscov2 - fasta - gtf - stub": {
+        "content": [
+            {
+                "0": [
+                    "genome.filtered.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ],
+                "1": [
+                    "versions.yml:md5,4adf55ec05d247fd6d253459bd80856f"
+                ],
+                "genome_gtf": [
+                    "genome.filtered.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ],
+                "versions": [
+                    "versions.yml:md5,4adf55ec05d247fd6d253459bd80856f"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-06-21T11:48:19.085835"
     }
 }
\ No newline at end of file
diff --git a/modules/local/multiqc_custom_biotype/main.nf b/modules/local/multiqc_custom_biotype/main.nf
index d102f67d9..a4b923c3e 100644
--- a/modules/local/multiqc_custom_biotype/main.nf
+++ b/modules/local/multiqc_custom_biotype/main.nf
@@ -33,4 +33,16 @@ process MULTIQC_CUSTOM_BIOTYPE {
         python: \$(python --version | sed 's/Python //g')
     END_VERSIONS
     """
+
+    stub:
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    """
+    touch ${prefix}.biotype_counts_mqc.tsv
+    touch ${prefix}.biotype_counts_rrna_mqc.tsv
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        python: \$(python --version | sed 's/Python //g')
+    END_VERSIONS
+    """
 }
diff --git a/modules/local/multiqc_custom_biotype/tests/main.nf.test b/modules/local/multiqc_custom_biotype/tests/main.nf.test
index 216f73336..bd6cde6bc 100644
--- a/modules/local/multiqc_custom_biotype/tests/main.nf.test
+++ b/modules/local/multiqc_custom_biotype/tests/main.nf.test
@@ -26,7 +26,31 @@ nextflow_process {
                 { assert snapshot(process.out).match()}
             )
         }
-
     }
 
+    test("test sarscov2 count data - stub") {
+
+    options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = Channel.of(
+                    [
+                        [ id: 'test' ],
+                        file(params.pipelines_testdata_base_path + 'multiqc_custom_biotype/test.featureCounts.txt', checkIfExists: true)
+                    ]
+                )
+                input[1] = file(params.pipelines_testdata_base_path + 'multiqc_custom_biotype/biotypes_header.txt', checkIfExists: true)
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success},
+                { assert snapshot(process.out).match()}
+            )
+        }
+    }
 }
diff --git a/modules/local/multiqc_custom_biotype/tests/main.nf.test.snap b/modules/local/multiqc_custom_biotype/tests/main.nf.test.snap
index ae559097b..ff9420015 100644
--- a/modules/local/multiqc_custom_biotype/tests/main.nf.test.snap
+++ b/modules/local/multiqc_custom_biotype/tests/main.nf.test.snap
@@ -37,5 +37,44 @@
             "nextflow": "24.01.0"
         },
         "timestamp": "2024-03-08T09:38:04.260609"
+    },
+    "test sarscov2 count data - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        [
+                            "test.biotype_counts_mqc.tsv:md5,d41d8cd98f00b204e9800998ecf8427e",
+                            "test.biotype_counts_rrna_mqc.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+                        ]
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,575b3b4c8a8a6e508c8ceeca41331b6b"
+                ],
+                "tsv": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        [
+                            "test.biotype_counts_mqc.tsv:md5,d41d8cd98f00b204e9800998ecf8427e",
+                            "test.biotype_counts_rrna_mqc.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+                        ]
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,575b3b4c8a8a6e508c8ceeca41331b6b"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-06-21T11:50:15.104113"
     }
 }
\ No newline at end of file
diff --git a/modules/local/preprocess_transcripts_fasta_gencode/main.nf b/modules/local/preprocess_transcripts_fasta_gencode/main.nf
index 9d530b77d..2722e66c7 100644
--- a/modules/local/preprocess_transcripts_fasta_gencode/main.nf
+++ b/modules/local/preprocess_transcripts_fasta_gencode/main.nf
@@ -28,4 +28,16 @@ process PREPROCESS_TRANSCRIPTS_FASTA_GENCODE {
         sed: \$(echo \$(sed --version 2>&1) | sed 's/^.*GNU sed) //; s/ .*\$//')
     END_VERSIONS
     """
+
+    stub:
+    def gzipped = fasta.toString().endsWith('.gz')
+    def outfile = gzipped ? file(fasta.baseName).baseName : fasta.baseName
+    """
+    touch ${outfile}.fixed.fa
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        sed: \$(echo \$(sed --version 2>&1) | sed 's/^.*GNU sed) //; s/ .*\$//')
+    END_VERSIONS
+    """
 }
diff --git a/modules/local/preprocess_transcripts_fasta_gencode/tests/main.nf.test b/modules/local/preprocess_transcripts_fasta_gencode/tests/main.nf.test
index 9585f8ae7..b07b4c001 100644
--- a/modules/local/preprocess_transcripts_fasta_gencode/tests/main.nf.test
+++ b/modules/local/preprocess_transcripts_fasta_gencode/tests/main.nf.test
@@ -28,7 +28,33 @@ nextflow_process {
                 { assert snapshot(process.out).match() }
             )
         }
-
     }
 
+    test("gencode fasta - stub") {
+
+    options "-stub"
+
+        when {
+            process {
+                """
+                def fileContents = [
+                    '>chr22|removeme',
+                    'ACTCAAGATAATGATGAGTAAAGAATATATTTCTAACAACAAAAAGGAAATTTGATAGTA'
+                ]
+                def gencodeFasta = file("${workDir}/gencodeFasta.fasta")
+                gencodeFasta.withWriter{ out ->
+                    fileContents.each {out.println it}
+                }
+                input[0] = gencodeFasta
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+    }
 }
diff --git a/modules/local/preprocess_transcripts_fasta_gencode/tests/main.nf.test.snap b/modules/local/preprocess_transcripts_fasta_gencode/tests/main.nf.test.snap
index 8c0580686..eaef85b1b 100644
--- a/modules/local/preprocess_transcripts_fasta_gencode/tests/main.nf.test.snap
+++ b/modules/local/preprocess_transcripts_fasta_gencode/tests/main.nf.test.snap
@@ -21,5 +21,28 @@
             "nextflow": "23.10.1"
         },
         "timestamp": "2024-03-06T16:16:36.494744"
+    },
+    "gencode fasta - stub": {
+        "content": [
+            {
+                "0": [
+                    "gencodeFasta.fixed.fa:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ],
+                "1": [
+                    "versions.yml:md5,e2c7f636c472887a914b128d1444737e"
+                ],
+                "fasta": [
+                    "gencodeFasta.fixed.fa:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ],
+                "versions": [
+                    "versions.yml:md5,e2c7f636c472887a914b128d1444737e"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-06-21T11:54:20.291494"
     }
 }
\ No newline at end of file
diff --git a/modules/local/rsem_merge_counts/main.nf b/modules/local/rsem_merge_counts/main.nf
index b21ca4aa4..c220e31de 100644
--- a/modules/local/rsem_merge_counts/main.nf
+++ b/modules/local/rsem_merge_counts/main.nf
@@ -52,4 +52,17 @@ process RSEM_MERGE_COUNTS {
         sed: \$(echo \$(sed --version 2>&1) | sed 's/^.*GNU sed) //; s/ .*\$//')
     END_VERSIONS
     """
+
+    stub:
+    """
+    touch rsem.merged.gene_counts.tsv
+    touch rsem.merged.gene_tpm.tsv
+    touch rsem.merged.transcript_counts.tsv
+    touch rsem.merged.transcript_tpm.tsv
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        sed: \$(echo \$(sed --version 2>&1) | sed 's/^.*GNU sed) //; s/ .*\$//')
+    END_VERSIONS
+    """
 }
diff --git a/modules/local/rsem_merge_counts/tests/main.nf.test b/modules/local/rsem_merge_counts/tests/main.nf.test
index 9bb1caeb2..61008082a 100644
--- a/modules/local/rsem_merge_counts/tests/main.nf.test
+++ b/modules/local/rsem_merge_counts/tests/main.nf.test
@@ -24,10 +24,39 @@ nextflow_process {
         }
 
         then {
-            assert process.success
-            assert snapshot(process.out).match()
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
         }
-
     }
 
+    test("stub") {
+
+    options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = Channel.of([
+                    file(params.pipelines_testdata_base_path + "rsem_merge_counts/genes/RAP1_IAA_30M_REP1.genes.results", checkIfExists: true),
+                    file(params.pipelines_testdata_base_path + "rsem_merge_counts/genes/RAP1_UNINDUCED_REP1.genes.results", checkIfExists: true),
+                    file(params.pipelines_testdata_base_path + "rsem_merge_counts/genes/RAP1_UNINDUCED_REP2.genes.results", checkIfExists: true)
+                ]).collect()
+                input[1] = Channel.of([
+                    file(params.pipelines_testdata_base_path + "rsem_merge_counts/isoforms/RAP1_IAA_30M_REP1.isoforms.results", checkIfExists: true),
+                    file(params.pipelines_testdata_base_path + "rsem_merge_counts/isoforms/RAP1_UNINDUCED_REP1.isoforms.results", checkIfExists: true),
+                    file(params.pipelines_testdata_base_path + "rsem_merge_counts/isoforms/RAP1_UNINDUCED_REP2.isoforms.results", checkIfExists: true)
+                ]).collect()
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+    }
 }
diff --git a/modules/local/rsem_merge_counts/tests/main.nf.test.snap b/modules/local/rsem_merge_counts/tests/main.nf.test.snap
index 800263c1a..1715d1279 100644
--- a/modules/local/rsem_merge_counts/tests/main.nf.test.snap
+++ b/modules/local/rsem_merge_counts/tests/main.nf.test.snap
@@ -1,4 +1,45 @@
 {
+    "stub": {
+        "content": [
+            {
+                "0": [
+                    "rsem.merged.gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ],
+                "1": [
+                    "rsem.merged.gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ],
+                "2": [
+                    "rsem.merged.transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ],
+                "3": [
+                    "rsem.merged.transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ],
+                "4": [
+                    "versions.yml:md5,48ca3e12c91829af8019462b3f6aa29c"
+                ],
+                "counts_gene": [
+                    "rsem.merged.gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ],
+                "counts_transcript": [
+                    "rsem.merged.transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ],
+                "tpm_gene": [
+                    "rsem.merged.gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ],
+                "tpm_transcript": [
+                    "rsem.merged.transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+                ],
+                "versions": [
+                    "versions.yml:md5,48ca3e12c91829af8019462b3f6aa29c"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.2"
+        },
+        "timestamp": "2024-06-21T11:55:29.45389"
+    },
     "Should run without failures": {
         "content": [
             {
diff --git a/modules/local/star_genomegenerate_igenomes/main.nf b/modules/local/star_genomegenerate_igenomes/main.nf
index 7b5115a6c..e36e04179 100644
--- a/modules/local/star_genomegenerate_igenomes/main.nf
+++ b/modules/local/star_genomegenerate_igenomes/main.nf
@@ -66,4 +66,53 @@ process STAR_GENOMEGENERATE_IGENOMES {
         END_VERSIONS
         """
     }
-}
+
+    stub:
+    if (gtf) {
+        """
+        mkdir star
+        touch star/Genome
+        touch star/Log.out
+        touch star/SA
+        touch star/SAindex
+        touch star/chrLength.txt
+        touch star/chrName.txt
+        touch star/chrNameLength.txt
+        touch star/chrStart.txt
+        touch star/exonGeTrInfo.tab
+        touch star/exonInfo.tab
+        touch star/geneInfo.tab
+        touch star/genomeParameters.txt
+        touch star/sjdbInfo.txt
+        touch star/sjdbList.fromGTF.out.tab
+        touch star/sjdbList.out.tab
+        touch star/transcriptInfo.tab
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            star: \$(STAR --version | sed -e "s/STAR_//g")
+            samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
+            gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//')
+        END_VERSIONS
+        """
+    } else {
+        """
+        mkdir star
+        touch star/Genome
+        touch star/Log.out
+        touch star/SA
+        touch star/SAindex
+        touch star/chrLength.txt
+        touch star/chrName.txt
+        touch star/chrNameLength.txt
+        touch star/chrStart.txt
+        touch star/genomeParameters.txt
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            star: \$(STAR --version | sed -e "s/STAR_//g")
+            samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
+            gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//')
+        END_VERSIONS
+        """
+    }}