Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

mislabeled isomiR #73

Open
abartlett004 opened this issue Apr 22, 2022 · 0 comments
Open

mislabeled isomiR #73

abartlett004 opened this issue Apr 22, 2022 · 0 comments

Comments

@abartlett004
Copy link

For hsa-let-7f-1-3p with reference sequence CTATACAATCTATTGCCTTCCC, an isomiR with sequence CTATACAATCTATTGCCTTCCT is described in the _rawData.tsv file as having only a T addition and no trimming on the 3' end.

Screen Shot 2022-04-22 at 9 27 54 AM

miRTop used from container as part of nf-core smrnaseq pipeline

data from this project
lpantano added a commit that referenced this issue Apr 22, 2022
@lpantano
#73
4ae80f3
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Assignees
No one assigned
Labels
None yet
Projects
None yet
Milestone
No milestone
Development

No branches or pull requests
1 participant
@abartlett004