You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
For hsa-let-7f-1-3p with reference sequence CTATACAATCTATTGCCTTCCC, an isomiR with sequence CTATACAATCTATTGCCTTCCT is described in the _rawData.tsv file as having only a T addition and no trimming on the 3' end.
For hsa-let-7f-1-3p with reference sequence CTATACAATCTATTGCCTTCCC, an isomiR with sequence CTATACAATCTATTGCCTTCCT is described in the
_rawData.tsv
file as having only a T addition and no trimming on the 3' end.miRTop used from container as part of nf-core smrnaseq pipeline
data from this project
The text was updated successfully, but these errors were encountered: