Quickly filter FASTQ files
Table of Contents
- Feature set
- Features and performance in detail
- Usage
- Cookbook
- Requirements
- Installation
- Examples and tests
- Further testing
- Citation and preprint
- Update changes
- License
Note
This README contains documentation for the latest version of grepq
. If you are working through this documentation and the examples, please ensure that you are using the latest version. You can check the version by running grepq -V
. For installation instructions, see the Installation section.
- very fast and scales to large FASTQ files
- IUPAC ambiguity code support
- support for gzip and zstd compression
- JSON support for pattern file input and
tune
command output, allowing named regex sets, named regex patterns, and named and unnamed variants - use predicates to filter on the header field (= record ID line) using a regex, minimum sequence length, and minimum average quality score (supports Phred+33 and Phred+64)
- does not match false positives
- output matched sequences to one of four formats
- tune your pattern file and enumerate named and unnamed variants with the
tune
command - bucket matching sequences to separate files named after each regexName with the
--bucket
flag, in any of the four output formats - supports inverted matching with the
inverted
command - plays nicely with your unix workflows
- comprehensive help, examples and testing script
- read the preprint at bioRxiv: https://doi.org/10.1101/2025.01.09.632104
1. Very fast and scales to large FASTQ files
tool | mean wall time (s) | S.D. wall time (s) | speedup (× grep) | speedup (× ripgrep) | speedup (× awk) |
---|---|---|---|---|---|
grepq | 0.19 | 0.01 | 1796.76 | 18.62 | 863.52 |
fqgrep | 0.34 | 0.01 | 1017.61 | 10.55 | 489.07 |
ripgrep | 3.57 | 0.01 | 96.49 | 1.00 | 46.37 |
seqkit grep | 2.89 | 0.01 | 119.33 | 1.24 | 57.35 |
grep | 344.26 | 0.55 | 1.00 | 0.01 | 0.48 |
awk | 165.45 | 1.59 | 2.08 | 0.02 | 1.00 |
gawk | 287.66 | 1.68 | 1.20 | 0.01 | 0.58 |
Details
2022 model Mac Studio with 32GB RAM and Apple M1 max chip running macOS 15.0.1. The FASTQ file (SRX26365298.fastq) was 874MB in size and was stored on the internal SSD (APPLE SSD AP0512R). The pattern file contained 30 regex patterns (see `examples/16S-no-iupac.txt` for the patterns used). grepq v1.4.0, fqgrep v.1.02, ripgrep v14.1.1, seqkit grep v.2.9.0, grep 2.6.0-FreeBSD, awk v. 20200816, and gawk v.5.3.1. fqgrep and seqkit grep were run with default settings, ripgrep was run with -B 1 -A 2 --colors 'match:none' --no-line-number, and grep -B 1 -A 2 was run with --color=never. The tools were configured to output matching records in FASTQ format. The wall times, given in seconds, are the mean of 10 runs, and S.D. is the standard deviation of the wall times, also given in seconds.
2. Reads and writes regular or gzip or zstd-compressed FASTQ files
Use the --best
option for best compression, or the --fast
option for faster compression.
tool | mean wall time (s) | S.D. wall time (s) | speedup (× ripgrep) |
---|---|---|---|
grepq | 1.71 | 0.00 | 2.10 |
fqgrep | 1.83 | 0.01 | 1.95 |
ripgrep | 3.58 | 0.01 | 1.00 |
Details
Conditions and versions as above, but the FASTQ file was gzip-compressed. `grepq` was run with the `--read-gzip` option, `ripgrep` with the `-z` option, and `grep` with the `-Z` option. The wall times, given in seconds, are the mean of 10 runs, and S.D. is the standard deviation of the wall times, also given in seconds.
3. Predicates
Predicates can be used to filter on the header field (= record ID line) using a regex, minimum sequence length, and minimum average quality score (supports Phred+33 and Phred+64).
Note
A regex supplied to filter on the header field (= record ID line) is first passed as a string to the regex engine, and then the regex engine is used to match the header field. Regex patterns to match the header field (= record ID line) must comply with the Rust regex library syntax (https://docs.rs/regex/latest/regex/#syntax). If you get an error message, be sure to escape any special characters in the regex pattern.
Predicates are specified in a JSON pattern file. For an example, see 16S-iupac-and-predicates.json
in the examples
directory.
4. Does not match false positives
grepq
will only match regex patterns to the sequence field of a FASTQ record, which is the most common use case. Unlike ripgrep
and grep
, which will match the regex patterns to the entire FASTQ record, which includes the record ID, sequence, separator, and quality fields. This can lead to false positives and slow down the filtering process.
5. Output matched sequences to one of four formats
- sequences only (default)
- sequences and their corresponding record IDs (
-I
option) - FASTA format (
-F
option) - FASTQ format (
-R
option)
Note
Other than when the tune
command is run (see below), a FASTQ record is deemed to match (and hence provided in the output) when any of the regex patterns in the pattern file match the sequence field of the FASTQ record.
6. Tune your pattern file and enumerate named and unnamed variants with the tune
command
Use the tune
command (grepq tune -h
for instructions) in a simple shell script to update the number and order of regex patterns in your pattern file according to their matched frequency, further targeting and speeding up the filtering process.
Specifying the -c
option to the tune
command will output the matched substrings and their frequencies, ranked from highest to lowest.
When the patterns file is given in JSON format, then specifying the -c
, --names
, --json-matches
and --variants
options to the tune
command will output the matched pattern variants and their corresponding counts in JSON format to a file called matches.json
, allowing named regex sets, named regex patterns, and named and unnamed variants. See examples/16S-iupac.json
for an example of a JSON pattern file and examples/matches.json
for an example of the output of the tune
command in JSON format.
# For each matched pattern in a search of no more than 20000 matches of a gzip-compressed FASTQ file, print the pattern and the number of matches to a JSON file called matches.json, and include the top three most frequent variants of each pattern, and their respective counts
grepq --read-gzip 16S-no-iupac.json SRX26365298.fastq.gz tune -n 20000 -c --names --json-matches --variants 3
Abridged output (see examples/matches.json
for the full output):
{
"regexSet": {
"regex": [
{
"regexCount": 2,
"regexName": "Primer contig 06a",
"regexString": "[AG]AAT[AT]G[AG]CGGGG",
"variants": [
{
"count": 1,
"variant": "GAATTGGCGGGG",
"variantName": "06a-v3"
},
{
"count": 1,
"variant": "GAATTGACGGGG",
"variantName": "06a-v1"
}
]
},
// matches for other regular expressions...
],
"regexSetName": "conserved 16S rRNA regions"
}
}
To output all variants of each pattern, use the --all
argument, for example:
# For each matched pattern in a search of no more than 20000 matches of a gzip-compressed FASTQ file, print the pattern and the number of matches to a JSON file called matches.json, and include all variants of each pattern, and their respective counts. Note that the --variants argument is not given when --all is specified.
grepq --read-gzip 16S-no-iupac.json SRX26365298.fastq.gz tune -n 20000 -c --names --json-matches --all
You could then use a tool like jq
to parse the JSON output of the tune
command, for example the following command will sort the output by the number of matches for each regex pattern, and then for each pattern, sort the variants by the number of matches:
jq -r '
.regexSet.regex |
sort_by(-.regexCount)[] |
"\(.regexName): \(.regexCount)\n" +
(
.variants |
sort_by(-.count)[] |
" \(.variantName // "unnamed"): \(.variant): \(.count)"
)
' matches.json
Note
When the count option (-c) is given with the tune
command, grepq
will count the number of FASTQ records containing a sequence that is matched, for each matching regex in the pattern file. If, however, there are multiple occurrences of a given regex within a FASTQ record sequence field, grepq
will count this as one match. To ensure all records are processed, supply a large number to the -n flag given with the tune
command. When the count option (-c) is not given with the tune
command, grepq
provides the total number of matching FASTQ records for the set of regex patterns in the pattern file.
7. Supports inverted matching with the inverted
command
Use the inverted
command to output sequences that do not match any of the regex patterns in your pattern file.
8. Plays nicely with your unix workflows
For example, see tune.sh
in the examples
directory. This simple script will filter a FASTQ file using grepq
, tune the pattern file on a user-specified number of total matches, and then filter the FASTQ file again using the tuned pattern file for a user-specified number of the most frequent regex pattern matches.
Get instructions and examples using grepq -h
, and grepq tune -h
and grepq inverted -h
for more information on the tune
and inverted
commands, respectively.
Note
grepq
can output to several formats, including those that are gzip or zstd compressed. grepq
, however, will only accept a FASTQ file or a compressed (gzip or zstd) FASTQ file as the sequence data file. If you get an error message, check that the input data file is a FASTQ file or a gzip or zstd compressed FASTQ file, and that you have specified the correct file format (--read-gzip or --read-zstd for FASTQ files compressed by gzip and zstd, respectively), and file path. Pattern files must contain one regex pattern per line or be provided in JSON format, and patterns are case-sensitive. You can supply an empty pattern file to count the total number of records in the FASTQ file. The regex patterns for matching FASTQ sequences should only include the DNA sequence characters (A, C, G, T), or IUPAC ambiguity codes (N, R, Y, etc.). See 16S-no-iupac.txt
, 16S-iupac.json
, 16S-no-iupac.json
, and 16S-iupac-and-predicates.json
in the examples
directory for examples of valid pattern files. Regex patterns to match the header field (= record ID line) must comply with the Rust regex library syntax (https://docs.rs/regex/latest/regex/#syntax). If you get an error message, be sure to escape any special characters in the regex pattern.
Whilst grepq
can accept pattern files in plain text format (one regex pattern per line), it is recommended to use JSON format for more complex pattern files since JSON pattern files can contain named regex sets, named regex patterns, and named and unnamed variants. JSON can be a little verbose, so you may want to prepare you pattern file in YAML format (for example, see 16S-iupac.yaml
in the examples
directory) and then convert it to JSON using a tool like yq
. For example, to convert a YAML pattern file to JSON, use the following command:
yq eval '. | tojson' pattern-file.yaml > pattern-file.json
grepq
will validate the JSON pattern file before processing it, and will provide an error message if the JSON pattern file is not valid. However, if you wish to validate the JSON pattern file before running grepq
, you can use a tool such as ajv
and grepq
's JSON schema file (grepq-schema.json
, located in the examples
directory), for example:
ajv --strict=false -s grepq-schema.json -d pattern-file.json
grepq
has been tested on Linux (x86-64) and macOS (ARM64). It might work on other platforms, but it has not been tested.- Ensure that Rust is installed on your system (https://www.rust-lang.org/tools/install)
- If the build fails, make sure you have the latest version of the Rust compiler by running
rustup update
- To run the
test.sh
andcookbook.sh
scripts in theexamples
directory, you will needyq
(v4.44.6 or later),gunzip
and version 4 or later ofbash
.
-
From crates.io (easiest method, but will not install the
examples
directory)cargo install grepq
-
From source (will install the
examples
directory)- Clone the repository and
cd
into thegrepq
directory - Run
cargo build --release
- Relative to the cloned parent directory, the executable will be located in
./target/release
- Make sure the executable is in your
PATH
or use the full path to the executable
- Clone the repository and
Get instructions and examples using grepq -h
, grepq tune -h
and grepq inverted -h
for more information on the tune
and inverted
commands, respectively. See the examples
directory for examples of pattern files and FASTQ files.
File sizes of outfiles to verify grepq
is working correctly, using the regex file 16S-no-iupac.txt
and the small fastq file small.fastq
, both located in the examples
directory:
grepq ./examples/16S-no-iupac.txt ./examples/small.fastq > outfile.txt
15953
grepq ./examples/16S-no-iupac.txt ./examples/small.fastq inverted > outfile.txt
736547
grepq -I ./examples/16S-no-iupac.txt ./examples/small.fastq > outfile.txt
19515
grepq -I ./examples/16S-no-iupac.txt ./examples/small.fastq inverted > outfile.txt
901271
grepq -R ./examples/16S-no-iupac.txt ./examples/small.fastq > outfile.txt
35574
grepq -R ./examples/16S-no-iupac.txt ./examples/small.fastq inverted > outfile.txt
1642712
For the curious-minded, note that the regex patterns in 16S-no-iupac.txt
, 16S-iupac.json
, 16S-no-iupac.json
, and 16S-iupac-and-predicates.json
are from Table 3 of Martinez-Porchas, Marcel, et al. "How conserved are the conserved 16S-rRNA regions?." PeerJ 5 (2017): e3036.
For more examples, see the examples
directory and the cookbook, available also as a shell script in the examples
directory.
Test script
You may also run the test script (test.sh
) in the examples
directory to more fully test grepq
. From the examples directory
, run the following command:
./test.sh commands-1.yaml; ./test.sh commands-2.yaml; ./test.sh commands-3.yaml; ./test.sh commands-4.yaml
If all tests pass, there will be no orange (warning) text in the output, and no test will report a failure. A summary of the number of passing and failing tests will be displayed at the end of the output. All tests should pass.
Example of failing test output:
test-7 failedexpected: 54 counts
got: 53 counts
command was: ../target/release/grepq -c 16S-no-iupac.txt small.fastq
Further, you can run the cookbook.sh
script in the examples
directory to test the cookbook examples, and you can use predate
(https://crates.io/crates/predate) if you prefer a Rust application to a shell script.
SARS-CoV-2 example
Count of the top five most frequently matched patterns found in SRX26602697.fastq using the pattern file SARS-CoV-2.txt (this pattern file contains 64 sequences of length 60 from Table II of this preprint):
time grepq SARS-CoV-2.txt SRX26602697.fastq tune -n 10000 -c | head -5
GTATGGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTTGTATGATGTGT: 1595
CGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAATTGGCAAAGA: 693
TCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAA: 356
GCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTCT: 332
CCGTAGCTGGTGTCTCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTAT: 209
________________________________________________________
Executed in 218.80 millis fish external
usr time 188.97 millis 0.09 millis 188.88 millis
sys time 31.47 millis 4.98 millis 26.49 millis
Obtain SRX26602697.fastq
from the SRA using fastq-dump --accession SRX26602697
.
grepq
can be tested using tools that generate synthetic FASTQ files, such as spikeq
(https://crates.io/crates/spikeq)
You can verify that grepq
has found the regex patterns by using tools such as grep
and ripgrep
, using their ability to color-match the regex patterns (this feature is not available in grepq
as that would make the code more complicated; code maintainability is an objective of this project). Recall, however, that grep
and ripgrep
will match the regex patterns to the entire FASTQ record, which includes the record ID, sequence, separator, and quality fields, occasionally leading to false positives.
If you use grepq
in your research, please cite as follows:
Crosbie, N.D. (2025). grepq: A Rust application that quickly filters FASTQ files by matching sequences to a set of regular expressions. bioRxiv, doi: https://doi.org/10.1101/2025.01.09.632104
see CHANGELOG
MIT