bionode · busyfingers · Nov 28, 2018 · Nov 28, 2018 · Nov 28, 2018 · Nov 28, 2018
diff --git a/docs/docco.css b/docs/docco.css
@@ -21,11 +21,11 @@
 }
 
 @font-face {
-    font-family: 'novecento-bold';
-    src: url('public/fonts/novecento-bold.eot');
-    src: url('public/fonts/novecento-bold.eot?#iefix') format('embedded-opentype'),
-         url('public/fonts/novecento-bold.woff') format('woff'),
-         url('public/fonts/novecento-bold.ttf') format('truetype');
+    font-family: 'roboto-black';
+    src: url('public/fonts/roboto-black.eot');
+    src: url('public/fonts/roboto-black.eot?#iefix') format('embedded-opentype'),
+         url('public/fonts/roboto-black.woff') format('woff'),
+         url('public/fonts/roboto-black.ttf') format('truetype');
     font-weight: normal;
     font-style: normal;
 }
@@ -67,14 +67,17 @@ h1, h2, h3, h4, h5, h6 {
   color: #112233;
   line-height: 1em;
   font-weight: normal;
-  font-family: "novecento-bold";
+  font-family: "roboto-black";
   text-transform: uppercase;
   margin: 30px 0 15px 0;
 }
 
 h1 {
   margin-top: 40px;
 }
+h2 {
+  font-size: 1.26em;
+}
 
 hr {
   border: 0;
@@ -180,9 +183,18 @@ ul.sections > li > div {
   display: block;
 }
 
+#jump_page_wrapper{
+  position: fixed;
+  right: 0;
+  top: 0;
+  bottom: 0;
+}
+
 #jump_page {
   padding: 5px 0 3px;
   margin: 0 0 25px 25px;
+  max-height: 100%;
+  overflow: auto;
 }
 
 #jump_page .source {

diff --git a/docs/fasta-parser.html b/docs/fasta-parser.html
@@ -26,7 +26,7 @@ <h1 id="fasta-parser">fasta-parser</h1>
 <p>Buffer Stream parser from FASTA to JSON.</p>
 <p>doi: <a href="?">?</a>
 author: <a href="http://bmpvieira.com">Bruno Vieira</a>
-email: <a href="&#x6d;&#x61;&#105;&#108;&#116;&#x6f;&#58;&#x6d;&#97;&#105;&#x6c;&#64;&#98;&#x6d;&#112;&#118;&#105;&#x65;&#x69;&#x72;&#x61;&#46;&#x63;&#x6f;&#109;">&#x6d;&#97;&#105;&#x6c;&#64;&#98;&#x6d;&#112;&#118;&#105;&#x65;&#x69;&#x72;&#x61;&#46;&#x63;&#x6f;&#109;</a>
+email: <a href="mailto:&#x6d;&#97;&#x69;&#108;&#64;&#98;&#109;&#x70;&#118;&#x69;&#101;&#x69;&#114;&#97;&#x2e;&#x63;&#x6f;&#x6d;">&#x6d;&#97;&#x69;&#108;&#64;&#98;&#109;&#x70;&#118;&#x69;&#101;&#x69;&#114;&#97;&#x2e;&#x63;&#x6f;&#x6d;</a>
 license: <a href="https://raw.githubusercontent.com/bionode/fasta-parser/master/LICENSE">MIT</a></p>
 </blockquote>
 <hr>
@@ -47,22 +47,28 @@ <h2 id="usage">Usage</h2>
 
 <span class="hljs-keyword">var</span> parser = <span class="hljs-built_in">require</span>(<span class="hljs-string">'fasta-parser'</span>)
 
-<span class="hljs-keyword">var</span> fastaData = <span class="hljs-keyword">new</span> Buffer (<span class="hljs-string">'&gt;sequence1\n\
+<span class="hljs-keyword">var</span> fastaData = Buffer.from (<span class="hljs-string">'&gt;sequence1\n\
 ATGCACGTCACGTCAGTACTCGTCAGTAC\n\
 &gt;sequence2\n\
 CAGTCCTACTGCATGCATGCATGCATGCATCGATGCATGTCGACTGCATGCATGC\n'</span>)
 
 <span class="hljs-keyword">var</span> parser = fasta()
-parser.on(<span class="hljs-string">'data'</span>, <span class="hljs-function"><span class="hljs-keyword">function</span><span class="hljs-params">(data)</span> </span>{
+parser.on(<span class="hljs-string">'data'</span>, <span class="hljs-function"><span class="hljs-keyword">function</span>(<span class="hljs-params">data</span>) </span>{
   <span class="hljs-built_in">console</span>.log(<span class="hljs-built_in">JSON</span>.parse(data.toString()))
 })
 parser.write(fastaData)
 parser.end()
 <span class="hljs-comment">//   { id: 'sequence1',</span>
 <span class="hljs-comment">//     seq: 'ATGCACGTCACGTCAGTACTCGTCAGTAC' }</span>
 <span class="hljs-comment">//   { id: 'sequence2',</span>
-<span class="hljs-comment">//     seq: 'CAGTCCTACTGCATGCATGCATGCATGCATCGATGCATGTCGACTGCATGCATGC' }</span>
-</code></pre><p>For a more useful API, check the dependent module:</p>
+<span class="hljs-comment">//     seq: 'CAGTCCTACTGCATGCATGCATGCATGCATCGATGCATGTCGACTGCATGCATGC' }</span></code></pre><p>To include the reverse compliment of the sequences, pass arguments to the parser:</p>
+<pre><code><span class="hljs-keyword">var</span> parser = fasta(<span class="hljs-literal">true</span>) <span class="hljs-comment">// Includes the reverse compliment for DNA sequences</span>
+<span class="hljs-keyword">var</span> parser = fasta(<span class="hljs-literal">true</span>, <span class="hljs-literal">true</span>) <span class="hljs-comment">// Includes the reverse compliment for RNA sequences</span>
+
+Example output:
+<span class="hljs-comment">//   { id: 'sequence1',</span>
+<span class="hljs-comment">//     seq: 'ATGCACGTCACGTCAGTACTCGTCAGTAC',</span>
+<span class="hljs-comment">//     rc: 'TACGTGCAGTGCAGTCATGAGCAGTCATG' }</span></code></pre><p>For a more useful API, check the dependent module:</p>
 <p><a href="http://github.com/bionode/bionode-fasta">bionode-fasta</a></p>
 
             </div>
@@ -71,43 +77,118 @@ <h2 id="usage">Usage</h2>
 <span class="hljs-keyword">var</span> through = <span class="hljs-built_in">require</span>(<span class="hljs-string">'through2'</span>)
 <span class="hljs-keyword">var</span> split = <span class="hljs-built_in">require</span>(<span class="hljs-string">'split'</span>)
 <span class="hljs-keyword">var</span> pumpify = <span class="hljs-built_in">require</span>(<span class="hljs-string">'pumpify'</span>)
+<span class="hljs-keyword">var</span> BufferList = <span class="hljs-built_in">require</span>(<span class="hljs-string">'bl'</span>)
 
-<span class="hljs-built_in">module</span>.exports = <span class="hljs-function"><span class="hljs-keyword">function</span><span class="hljs-params">()</span> </span>{
-  <span class="hljs-keyword">return</span> pumpify(split(), parser())
+<span class="hljs-built_in">module</span>.exports = <span class="hljs-function"><span class="hljs-keyword">function</span> (<span class="hljs-params">includeRevComp, isRna</span>) </span>{
+  includeRevComp = <span class="hljs-keyword">typeof</span> (includeRevComp) === <span class="hljs-string">'boolean'</span> ? includeRevComp : <span class="hljs-literal">false</span>
+  isRna = <span class="hljs-keyword">typeof</span> (isRna) === <span class="hljs-string">'boolean'</span> ? isRna : <span class="hljs-literal">false</span>
+  <span class="hljs-keyword">var</span> bases = includeRevComp ? getBaseComplements(isRna) : <span class="hljs-literal">false</span>
+  <span class="hljs-keyword">return</span> pumpify(split(), parser(bases))
 }
 
-<span class="hljs-function"><span class="hljs-keyword">function</span> <span class="hljs-title">parser</span><span class="hljs-params">()</span> </span>{
+<span class="hljs-function"><span class="hljs-keyword">function</span> <span class="hljs-title">parser</span> (<span class="hljs-params">bases</span>) </span>{
   <span class="hljs-keyword">var</span> cacheBuf
-  <span class="hljs-keyword">var</span> cacheBufLen = <span class="hljs-number">8</span>
-  <span class="hljs-keyword">var</span> openID = <span class="hljs-keyword">new</span> Buffer(<span class="hljs-string">'{"id":"'</span>)
-  <span class="hljs-keyword">var</span> closeIDOpenSeq = <span class="hljs-keyword">new</span> Buffer(<span class="hljs-string">'","seq":"'</span>)
-  <span class="hljs-keyword">var</span> closeSeq = <span class="hljs-keyword">new</span> Buffer(<span class="hljs-string">'"}\n'</span>)
+  <span class="hljs-keyword">var</span> openID = Buffer.from(<span class="hljs-string">'{"id":"'</span>)
+  <span class="hljs-keyword">var</span> closeIDOpenSeq = Buffer.from(<span class="hljs-string">'","seq":"'</span>)
+  <span class="hljs-keyword">var</span> closeSeqOpenRevComp = Buffer.from(<span class="hljs-string">'","rc":"'</span>)
+  <span class="hljs-keyword">var</span> closeSeq = Buffer.from(<span class="hljs-string">'"}\n'</span>)
   <span class="hljs-keyword">var</span> stream = through(transform, flush)
 
   <span class="hljs-keyword">return</span> stream
 
-  <span class="hljs-function"><span class="hljs-keyword">function</span> <span class="hljs-title">transform</span><span class="hljs-params">(buf, enc, next)</span> </span>{
+  <span class="hljs-function"><span class="hljs-keyword">function</span> <span class="hljs-title">transform</span> (<span class="hljs-params">buf, enc, next</span>) </span>{
     <span class="hljs-keyword">if</span> (buf[<span class="hljs-number">0</span>] === <span class="hljs-number">62</span>) { <span class="hljs-comment">// If line starts with '&gt;', this is an ID</span>
       <span class="hljs-keyword">if</span> (cacheBuf) { <span class="hljs-comment">// If a previous object is in cache, push it</span>
-        cacheBuf = Buffer.concat([cacheBuf, closeSeq], cacheBufLen+<span class="hljs-number">3</span>)
-        <span class="hljs-keyword">this</span>.push(cacheBuf)
+        cacheBuf.append(closeSeq)
+        <span class="hljs-keyword">this</span>.push(cacheBuf.slice())
       }
       <span class="hljs-keyword">var</span> id = buf.toString().slice(<span class="hljs-number">1</span>).trim().replace(<span class="hljs-regexp">/"/g</span>, <span class="hljs-string">'\\"'</span>)
-      cacheBufLen = id.length + <span class="hljs-number">16</span>
-      cacheBuf = Buffer.concat([openID, <span class="hljs-keyword">new</span> Buffer(id), closeIDOpenSeq], cacheBufLen)
-    }
-    <span class="hljs-keyword">else</span> {
-      cacheBufLen += buf.length
-      cacheBuf = Buffer.concat([cacheBuf, buf], cacheBufLen)
+      cacheBuf = <span class="hljs-keyword">new</span> BufferList()
+      cacheBuf.append(openID)
+      cacheBuf.append(id)
+      cacheBuf.append(closeIDOpenSeq)
+    } <span class="hljs-keyword">else</span> {
+      <span class="hljs-keyword">if</span> (buf.length === <span class="hljs-number">0</span>) {</pre></div></div>
+
+        </li>
+
+
+        <li id="section-3">
+            <div class="annotation">
+
+              <div class="pilwrap ">
+                <a class="pilcrow" href="#section-3">&#182;</a>
+              </div>
+              <p>Ignore empty</p>
+
+            </div>
+
+            <div class="content"><div class='highlight'><pre>      } <span class="hljs-keyword">else</span> <span class="hljs-keyword">if</span> (!cacheBuf) {
+        <span class="hljs-keyword">this</span>.emit(<span class="hljs-string">'error'</span>, {<span class="hljs-attr">msg</span>: <span class="hljs-string">'Failed fasta parsing'</span>, <span class="hljs-attr">buf</span>: buf})
+      } <span class="hljs-keyword">else</span> {
+        cacheBuf.append(buf)
+        <span class="hljs-keyword">if</span> (bases) { <span class="hljs-comment">// If bases is thruthy then it contains a string with reference bases</span>
+          cacheBuf.append(closeSeqOpenRevComp)
+          cacheBuf.append(getReverseCompliment(buf))
+        }
+      }
     }
     next()
   }
 
-  <span class="hljs-function"><span class="hljs-keyword">function</span> <span class="hljs-title">flush</span><span class="hljs-params">()</span> </span>{
-    cacheBuf = Buffer.concat([cacheBuf, closeSeq], cacheBufLen+<span class="hljs-number">3</span>)
-    <span class="hljs-keyword">this</span>.push(cacheBuf)
+  <span class="hljs-function"><span class="hljs-keyword">function</span> <span class="hljs-title">flush</span> (<span class="hljs-params"></span>) </span>{
+    <span class="hljs-keyword">if</span> (cacheBuf) {
+      cacheBuf.append(closeSeq)
+      <span class="hljs-keyword">this</span>.push(cacheBuf.slice())
+    }
     <span class="hljs-keyword">this</span>.push(<span class="hljs-literal">null</span>)
   }
+
+  <span class="hljs-function"><span class="hljs-keyword">function</span> <span class="hljs-title">getReverseCompliment</span> (<span class="hljs-params">buf</span>) </span>{
+    <span class="hljs-keyword">var</span> seq = buf.toString()
+    <span class="hljs-keyword">var</span> complement = Buffer.alloc(seq.length)
+    <span class="hljs-keyword">for</span> (<span class="hljs-keyword">var</span> i = <span class="hljs-number">0</span>; i &lt; seq.length; i++) {
+      <span class="hljs-keyword">var</span> baseIndex = bases.indexOf(seq[i])
+      <span class="hljs-keyword">if</span> (baseIndex &gt; <span class="hljs-number">-1</span>) {</pre></div></div>
+
+        </li>
+
+
+        <li id="section-4">
+            <div class="annotation">
+
+              <div class="pilwrap ">
+                <a class="pilcrow" href="#section-4">&#182;</a>
+              </div>
+              <p>If the base was found in the base reference, pick the base 4 positions to the right, which is the complementary base</p>
+
+            </div>
+
+            <div class="content"><div class='highlight'><pre>        complement.write(bases[bases.indexOf(seq[i]) + <span class="hljs-number">4</span>], i)
+      } <span class="hljs-keyword">else</span> {</pre></div></div>
+
+        </li>
+
+
+        <li id="section-5">
+            <div class="annotation">
+
+              <div class="pilwrap ">
+                <a class="pilcrow" href="#section-5">&#182;</a>
+              </div>
+              <p>If no match was found (e.g. if specifying that a DNA sequence is RNA), set the complimentary base to 0</p>
+
+            </div>
+
+            <div class="content"><div class='highlight'><pre>        complement.write(<span class="hljs-string">'0'</span>, i)
+      }
+    }
+    <span class="hljs-keyword">return</span> complement
+  }
+}
+
+<span class="hljs-function"><span class="hljs-keyword">function</span> <span class="hljs-title">getBaseComplements</span> (<span class="hljs-params">isRna</span>) </span>{
+  <span class="hljs-keyword">return</span> isRna ? <span class="hljs-string">'AGCUUCGA'</span> : <span class="hljs-string">'ATGCTACG'</span>
 }</pre></div></div>
 
         </li>

diff --git a/docs/public/fonts/roboto-black.eot b/docs/public/fonts/roboto-black.eot
diff --git a/docs/public/fonts/roboto-black.ttf b/docs/public/fonts/roboto-black.ttf
diff --git a/docs/public/fonts/roboto-black.woff b/docs/public/fonts/roboto-black.woff
diff --git a/fasta-parser.min.js b/fasta-parser.min.js
diff --git a/lib/fasta-parser.js b/lib/fasta-parser.js
@@ -30,6 +30,16 @@
 //     //   { id: 'sequence2',
 //     //     seq: 'CAGTCCTACTGCATGCATGCATGCATGCATCGATGCATGTCGACTGCATGCATGC' }
 //
+// To include the reverse complement of the sequences, pass arguments to the parser:
+//
+//     var parser = fasta(true) // Includes the reverse complement for DNA sequences
+//     var parser = fasta(true, true) // Includes the reverse complement for RNA sequences
+//
+//     Example output:
+//     //   { id: 'sequence1',
+//     //     seq: 'ATGCACGTCACGTCAGTACTCGTCAGTAC',
+//     //     rc: 'TACGTGCAGTGCAGTCATGAGCAGTCATG' }
+//
 // For a more useful API, check the dependent module:
 //
 // [bionode-fasta](http://github.com/bionode/bionode-fasta)
@@ -39,14 +49,18 @@ var split = require('split')
 var pumpify = require('pumpify')
 var BufferList = require('bl')
 
-module.exports = function () {
-  return pumpify(split(), parser())
+module.exports = function (includeRevComp, isRna) {
+  includeRevComp = typeof (includeRevComp) === 'boolean' ? includeRevComp : false
+  isRna = typeof (isRna) === 'boolean' ? isRna : false
+  var bases = includeRevComp ? getBaseComplements(isRna) : false
+  return pumpify(split(), parser(bases))
 }
 
-function parser () {
+function parser (bases) {
   var cacheBuf
   var openID = Buffer.from('{"id":"')
   var closeIDOpenSeq = Buffer.from('","seq":"')
+  var closeSeqOpenRevComp = Buffer.from('","rc":"')
   var closeSeq = Buffer.from('"}\n')
   var stream = through(transform, flush)
 
@@ -70,6 +84,10 @@ function parser () {
         this.emit('error', {msg: 'Failed fasta parsing', buf: buf})
       } else {
         cacheBuf.append(buf)
+        if (bases) { // If bases is thruthy then it contains a string with reference bases
+          cacheBuf.append(closeSeqOpenRevComp)
+          cacheBuf.append(getReverseComplement(buf))
+        }
       }
     }
     next()
@@ -82,4 +100,24 @@ function parser () {
     }
     this.push(null)
   }
+
+  function getReverseComplement (buf) {
+    var seq = buf.toString()
+    var complement = Buffer.alloc(seq.length)
+    for (var i = 0; i < seq.length; i++) {
+      var baseIndex = bases.indexOf(seq[i])
+      if (baseIndex > -1) {
+        // If the base was found in the base reference, pick the base 4 positions to the right, which is the complementary base
+        complement.write(bases[bases.indexOf(seq[i]) + 4], i)
+      } else {
+        // If no match was found (e.g. if specifying that a DNA sequence is RNA), set the complementary base to 0
+        complement.write('0', i)
+      }
+    }
+    return complement
+  }
+}
+
+function getBaseComplements (isRna) {
+  return isRna ? 'AGCUUCGA' : 'ATGCTACG'
 }
diff --git a/test/fasta-parser.js b/test/fasta-parser.js
@@ -19,6 +19,12 @@ TCAAAGATTCGGAATGCTGTCTGGAGGGTGAATCTAACGGTGCGTATCTCGATTGCTCAGTCGCTTTTCGTACTGCGCGA
 AGTTCGTACCGCTCATTCACTTGGTTCCGAAGCCTGTCCTGATATATGAATCCAAACTAGAGCGGGGCTCTTGACATTTGG\n\
 AGTTGTAAATATCTAATACTCCAATCGG\n`)
 
+var fastaDataShortDNA = Buffer.from(`>contig1\n\
+TCACCAACTACGA\n`)
+
+var fastaDataShortRNA = Buffer.from(`>contig1\n\
+AGCUUCAAC\n`)
+
 test('Should parse a FASTA Buffer to a JSON Buffer', function (t) {
   t.plan(1)
   var result = []
@@ -29,3 +35,42 @@ test('Should parse a FASTA Buffer to a JSON Buffer', function (t) {
   parser.write(fastaData)
   parser.end()
 })
+
+test('Should include reverse complement if specified', function (t) {
+  t.plan(1)
+  var result = []
+  var parser = fasta(true)
+  parser
+  .on('data', function (data) { result.push(JSON.parse(data.toString())) })
+  .on('end', function () {
+    t.deepEqual(result[0].rc, 'AGTGGTTGATGCT')
+  })
+  parser.write(fastaDataShortDNA)
+  parser.end()
+})
+
+test('Should handle reverse complement of RNA sequences', function (t) {
+  t.plan(1)
+  var result = []
+  var parser = fasta(true, true)
+  parser
+  .on('data', function (data) { result.push(JSON.parse(data.toString())) })
+  .on('end', function () {
+    t.deepEqual(result[0].rc, 'UCGAAGUUG')
+  })
+  parser.write(fastaDataShortRNA)
+  parser.end()
+})
+
+test('Should replace invalid bases with 0', function (t) {
+  t.plan(1)
+  var result = []
+  var parser = fasta(true, true)
+  parser
+  .on('data', function (data) { result.push(JSON.parse(data.toString())) })
+  .on('end', function () {
+    t.deepEqual(result[0].rc, '0GUGGUUG0UGCU')
+  })
+  parser.write(fastaDataShortDNA)
+  parser.end()
+})