Orpheum which used to be called sencha is a Python package for directly translating RNA-seq reads into coding protein sequence.
- Free software: MIT license
- Documentation: https://czbiohub.github.io/orpheum
The package can be installed from PyPI using pip
here:
pip install orpheum
To install this code and play around with the code locally, clone this github repository and use pip
to install:
git clone https://github.com/czbiohub/orpheum.git
cd orpheum
# The "." means "install *this*, the folder where I am now"
pip install .
A reference proteome must be supplied as the first argument.
orpheum translate reference-proteome.fa.gz *.fastq.gz > coding_peptides.fasta
The "coding score" of each read is calculated by translating each read in six
frames, then is calculatating the
Jaccard index between any of the
six translated frames of the read and the peptide database. The final coding
score is the maximum Jaccard index across all reading frames. If you'd like to
see the coding scores for all reads, use the --csv
flag or --parquet
flag.
csv:
orpheum translate --csv coding_scores.csv reference-proteome.fa.gz *.fastq.gz > coding_peptides.fasta
parquet:
orpheum translate --parquet coding_scores.parquet reference-proteome.fa.gz *.fastq.gz > coding_peptides.fasta
By default, only the coding peptides are output. If you'd like to also output
the underlying nucleotide sequence, then use the flag --coding-nucleotide-fasta
orpheum translate --coding-nucleotide-fasta coding_nucleotides.fasta reference-proteome.fa.gz *.fastq.gz > coding_peptides.fasta
To see the sequence of reads which were deemed non-coding, use the flag
--noncoding-nucleotide-fasta
.
orpheum translate --noncoding-nucleotide-fasta noncoding_nucleotides.fasta reference-proteome.fa.gz *.fastq.gz > coding_peptides.fasta
To see the sequence of reads found to have too low complexity of nucleotide
sequence to evaluate, use the flag --low-complexity-nucleotide-fasta
. Low
complexity is determined by the same method as the read trimmer
fastp in which we calculate what
percentage of the sequence has consecutive runs of the same base,
or mathematically, how often seq[i] = seq[i+1]
. The default threshold is
0.3
. As an example, the sequence CCCCCCCCCACCACCACCCCCCCCACCCCCCCCCCCCCCCCCCCCCCCCCCACCCCCCCACACACCCCCAACACCC
would be considered low complexity. While this sequence has many nucleotide
k-mers, it is likely a result of a sequencing error and we ignore it.
orpheum translate --low-complexity-nucleotide-fasta low_complexity_nucleotides.fasta reference-proteome.fa.gz *.fastq.gz > coding_peptides.fasta
Even if the nucleotide sequence may pass the complexity filter, the peptide
sequence may still be low complexity. As an example, all translated frames of
the sequence
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
would be considered low complexity, as it translates to either
QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ
(5'3' Frame 1),
SSSSSSSSSSSSSSSSSSSSSSSSSSSSS
(5'3' Frame 2),
AAAAAAAAAAAAAAAAAAAAAAAAAAAAA
(5'3' Frame 3 and 3'5' Frame 3),
LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL
(3'5' Frame 1),
or CCCCCCCCCCCCCCCCCCCCCCCCCCCCC
(3'5' Frame 2). As these sequences have few
k-mers and are difficult to assess for how "coding" they are, we ignore them.
Unlike for nucleotides where we look at runs of consecutive bases, we require
the translated peptide to contain greater than (L - k + 1)/2
k-mers, where
L
is the length of the sequence and k
is the k-mer size. To save the
sequence of low-complexity peptides to a fasta, use the flag
--low-complexity-peptides-fasta
.
orpheum translate --low-complexity-peptides-fasta low_complexity_peptides.fasta reference-proteome.fa.gz *.fastq.gz > coding_peptides.fasta