| layout | title | comments | date |
|---|---|---|---|
page |
The Shell |
true |
2014-08-13 09:44:36 -0700 |
Author: Tracy Teal
Original contributors:
Paul Wilson, Milad Fatenejad, Sasha Wood and Radhika Khetani for Software Carpentry (http://http://software-carpentry.org/)
- What is the shell?
- How do you access it?
- How do you use it?
- Getting around the Unix file system
- looking at files
- manipulating files
- automating tasks
- What is it good for?
- Where are resources where I can learn more? (because the shell is awesome)
The shell is a program that presents a command line interface which allows you to control your computer using commands entered with a keyboard instead of controlling graphical user interfaces (GUIs) with a mouse/keyboard combination.
There are many reasons to learn about the shell.
- For most bioinformatics tools, you have to use the shell. There is no graphical interface. If you want to work in metagenomics or genomics you're going to need to use the shell.
- The shell gives you power. The command line gives you the power to do your work more efficiently and more quickly. When you need to do things tens to hundreds of times, knowing how to use the shell is transformative.
- To use remote computers or cloud computing, you need to use the shell.
Unix is user-friendly. It's just very selective about who its friends are.
Today we're going to go through how to access Unix/Linux and some of the basic shell commands.
shell cheat sheets:
- http://fosswire.com/post/2007/08/unixlinux-command-cheat-sheet/
- https://github.com/swcarpentry/boot-camps/blob/master/shell/shell_cheatsheet.md
Explain shell - a web site where you can see what the different components of a shell command are doing.
The shell is already available on Mac and Linux. For Windows, you'll have to download a separate program.
On Mac the shell is available through Terminal
Applications -> Utilities -> Terminal
Go ahead and drag the Terminal application to your Dock for easy access.
For Windows, we're going to be using gitbash.
Download and install gitbash
Open up the program.
Well, you should be set.
We will spend most of our time learning about the basics of the shell by manipulating some experimental data.
Now we're going to download the data for the tutorial. For this you'll need internet access, because you're going to get it off the web.
Open the shell
Enter the command:
git clone https://github.com/tracykteal/tutorials/
This command will grab all of the data needed for this workshop from the internet. (We're not going to talk about git right now, but it's a tool for doing version control.)
Now let's go in to that directory cd tutorial-shell-genomics This stands for 'change directory'
In this directory, there should be some things we just downloaded. Let's check. Type: ls ls stands for 'list' and it lists the contents of a directory.
There's a few directories there, but not too many. Let's go look in the data directory. cd data ls
In there, all mixed up together are files and directories/folders. If we want to
know which is which, we can type:
ls -F
Anything with a "/" after it is a directory.
Things with a "*" after them are programs.
It there's nothing there it's a file.
You can also use the command ls -l to see whether items in a
directory are files or directories. ls -l gives a lot more
information too, such as the size of the file
So, we can see that we have several files, directories and a program. Great!
Most programs take additional arguments that control their exact
behavior. For example, -F and -l are arguments to ls. The ls
program, like many programs, take a lot of arguments. But how do we
know what the options are to particular commands?
Most commonly used shell programs have a manual. You can access the
manual using the man program. Try entering:
man ls
This will open the manual page for ls. Use the space key to go
forward and b to go backwards. When you are done reading, just hit q
to quit.
Programs that are run from the shell can get extremely complicated. To
see an example, open up the manual page for the find program.
No one can possibly learn all of
these arguments, of course. So you will probably find yourself
referring back to the manual page frequently.
As you've already just seen, you can move around in different directories or folders at the command line. Why would you want to do this, rather than just navigating around the normal way.
When you're working with bioinformatics programs, you're working with your data and it's key to be able to have that data in the right place and make sure the program has access to the data. Many of the problems people run in to with command line bioinformatics programs is not having the data in the place the program expects it to be.
Let's practice moving around a bit.
We're going to work in that tutorial-shell-genomics directory we just downloaded.
First let's navigate there using the regular way by clicking on the different folders.
First we did something like go to the folder of our username. Then we opened 'tutorial-shell-genomics' then 'data'
Let's draw out how that went.
Now let's draw some of the other files and folders we could have clicked on.
This is called a hierarchical file system structure, like an upside down tree with root (/) at the base that looks like this.
That (/) at the base is often also called the 'top' level.
When you are working at your computer or log in to a remote computer, you are on one of the branches of that tree, your home directory (/home/username)
Now let's go do that same navigation at the command line.
Type cd This puts you in your home directory. This folder here.
Now using cd and ls, go in to the 'tutorial-shell-genomics' directory and list its contents.
Let's also check to see where we are. Sometimes when we're wandering around in the file system, it's easy to lose track of where we are and get lost.
If you want to know what directory you're currently in, type pwd This stands for 'print working directory'. The directory you're currently working in.
What if we want to move back up and out of the 'data' directory? Can we just type 'tutorial-shell-genomics'? Try it and see what happens.
To go 'back up a level' we need to use ..
Type cd ..
Now do ls and pwd. See now that we went back up in to the 'tutorial-shell-genomics'
directory. .. just means go back up a level.
Exercise
Now we're going to try a hunt.
Move around in the 'hidden' directory and try to find the file 'youfoundit.txt'
By default, the ls commands lists the contents of the working
directory (i.e. the directory you are in). You can always find the
directory you are in using the pwd command. However, you can also
give ls the names of other directories to view. Navigate to the
home directory if you are not already there.
Type:
cd
Then enter the command:
ls edamame-data
This will list the contents of the edamame-data directory without
you having to navigate there.
The cd command works in a similar way. Try entering:
cd
cd edamame-data/shell/hidden
and you will jump directly to hidden without having to go through
the intermediate directory.
Exercise
Try finding the 'anotherfile.txt' file without changing directories.
Navigate to the home directory. Typing out directory names can waste a lot of time. When you start typing out the name of a directory, then hit the tab key, the shell will try to fill in the rest of the directory name. For example, enter:
cd e<tab>
The shell will fill in the rest of the directory name for
edamame-data. Now go to edamame-data/shell/MiSeq
ls F3D<tab><tab>
When you hit the first tab, nothing happens. The reason is that there
are multiple directories in the home directory which start with
F3D. Thus, the shell does not know which one to fill in. When you hit
tab again, the shell will list the possible choices.
Tab completion can also fill in the names of programs. For example,
enter e<tab><tab>. You will see the name of every program that
starts with an e. One of those is echo. If you enter ec<tab> you
will see that tab completion works.
The cd command takes an argument which is the directory
name. Directories can be specified using either a relative path or a
full path. The directories on the computer are arranged into a
hierarchy. The full path tells you where a directory is in that
hierarchy. Navigate to the home directory. Now, enter the pwd
command and you should see:
/home/username
which is the full name of your home directory. This tells you that you
are in a directory called username, which sits inside a directory called
home which sits inside the very top directory in the hierarchy. The
very top of the hierarchy is a directory called / which is usually
referred to as the root directory. So, to summarize: username is a
directory in home which is a directory in /.
Now enter the following command:
cd /home/username/edamame-data/shell/hidden
This jumps to hidden. Now go back to the home directory (cd). We saw
earlier that the command:
cd edamame-data/shell/hidden
had the same effect - it took us to the hidden directory. But,
instead of specifying the full path
(/home/username/edamame-data/shell), we specified a relative path. In
other words, we specified the path relative to our current
directory. A full path always starts with a /. A relative path does
not.
A relative path is like getting directions from someone on the street. They tell you to "go right at the Stop sign, and then turn left on Main Street". That works great if you're standing there together, but not so well if you're trying to tell someone how to get there from another country. A full path is like GPS coordinates. It tells you exactly where something is no matter where you are right now.
You can usually use either a full path or a relative path depending on what is most convenient. If we are in the home directory, it is more convenient to just enter the relative path since it involves less typing.
Over time, it will become easier for you to keep a mental note of the structure of the directories that you are using and how to quickly navigate amongst them.
Short Exercise
Now, list the contents of the /bin directory. Do you see anything familiar in there?
There are some shortcuts which you should know about. Dealing with the
home directory is very common. So, in the shell the tilde character,
""~"", is a shortcut for your home directory. Navigate to the edamame
directory:
cd
cd edamame-data
cd shell
Then enter the command:
ls ~
This prints the contents of your home directory, without you having to
type the full path. The shortcut .. always refers to the directory
above your current directory. Thus:
ls ..
prints the contents of the /home/username/edamame-data. You can chain
these together, so:
ls ../../
prints the contents of /home/username which is your home
directory. Finally, the special directory . always refers to your
current directory. So, ls, ls ., and ls ././././. all do the
same thing, they print the contents of the current directory. This may
seem like a useless shortcut right now, but we'll see when it is
needed in a little while.
To summarize, while you are in the shell directory, the commands
ls ~, ls ~/., ls ../../, and ls /home/username all do exactly the
same thing. These shortcuts are not necessary, they are provided for
your convenience.
We did an experiment and want to look at the bacterial communities of mice in two treatments using 16S sequencing. We have 10 mice in one treatment and 9 in another.each treatment. We also sequenced a Mock community, so we can check the quality of our data. So, we have 20 samples all together and we've done paired-end MiSeq sequencing.
We get our data back from the sequencing center as FASTQ files, and we stick them all in a folder called MiSeq. This data is actually the data we're going to use for several sections of the course, and it's data generated by Pat Schloss.
We want to be able to look at these files and do some things with them.
Navigate to the ~/edamame-data/shell/MiSeq directory. This
directory contains our FASTQ files and some other ones
we'll need for analyses. If we type ls,
we will see that there are a bunch of files with long file names.
Some of the end with .fastq
The * character is a shortcut for "everything". Thus, if
you enter ls *, you will see all of the contents of a given
directory. Now try this command:
ls *fastq
This lists every file that ends with a fastq. This command:
ls /usr/bin/*.sh
Lists every file in /usr/bin that ends in the characters .sh.
We have paired end sequencing, so for every sample we have two files. If we want to just see the list of the files for the forward direction sequencing we can use:
ls *R1*fastq
lists every file in the current directory whose name contains the
number R1, and ends with fastq. There are twenty such files which
we would expect because we have 20 samples.
So how does this actually work? Well...when the shell (bash) sees a
word that contains the * character, it automatically looks for filenames
that match the given pattern. In this case, it identified four such
files. Then, it replaced the *R1*fastq with the list of files, separated
by spaces.
What happens if you do R1*fastq?
Short Exercise
Do each of the following using a single ls command without
navigating to a different directory.
- List all of the files in
/binthat start with the letter 'c - List all of the files in
/binthat contain the letter 'a' - List all of the files in
/binthat end with the letter 'o'
BONUS: List all of the files in '/bin' that contain the letter 'a' or 'c'
You can easily access previous commands. Hit the up arrow. Hit it again. You can step backwards through your command history. The down arrow takes your forwards in the command history.
^-C will cancel the command you are writing, and give you a fresh prompt.
^-R will do a reverse-search through your command history. This is very useful.
You can also review your recent commands with the history command. Just enter:
history
to see a numbered list of recent commands, including this just issues
history command. You can reuse one of these commands directly by
referring to the number of that command.
If your history looked like this:
259 ls *
260 ls /usr/bin/*.sh
261 ls *R1*fastq
then you could repeat command #260 by simply entering:
!260
(that's an exclamation mark).
Short Exercise
- Find the line number in your history for the last exercise (listing files in /bin) and reissue that command.
We now know how to switch directories, run programs, and look at the contents of directories, but how do we look at the contents of files?
The easiest way to examine a file is to just print out all of the
contents using the program cat. Enter the following command:
cat F3D0_S188_L001_R1_001.fastq
This prints out the contents of the F3D0_S188_L001_R1_001.fastq file.
Short Exercises
-
Print out the contents of the
~/edamame-data/shell/MiSeq/stability.filesfile. What does this file contain? -
Without changing directories, (you should still be in
edamame-data), use one short command to print the contents of all of the files in the/home/username/edamame-data/shell/MiSeqdirectory.
Make sure we're in the right place for the next set of the lessons. We
want to be in the shell directory. Check if you're there with pwd
and if not navigate there. One way to do that would be
cd ~/edamame-data/shell/MiSeq
cat is a terrific program, but when the file is really big, it can
be annoying to use. The program, less, is useful for this
case. Enter the following command:
less F3D0_S188_L001_R1_001.fastq
less opens the file, and lets you navigate through it. The commands
are identical to the man program.
Some commands in less
| key | action |
|---|---|
| "space" | to go forward |
| "b" | to go backwarsd |
| "g" | to go to the beginning |
| "G" | to go to the end |
| "q" | to quit |
less also gives you a way of searching through files. Just hit the
"/" key to begin a search. Enter the name of the word you would like
to search for and hit enter. It will jump to the next location where
that word is found. Try searching the dictionary.txt file for the
word "cat". If you hit "/" then "enter", less will just repeat
the previous search. less searches from the current location and
works its way forward. If you are at the end of the file and search
for the word "cat", less will not find it. You need to go to the
beginning of the file and search.
For instance, let's search for the sequence 1101:14341 in our file.
You can see that we go right to that sequence and can see
what it looks like.
Remember, the man program actually uses less internally and
therefore uses the same commands, so you can search documentation
using "/" as well!
There's another way that we can look at files, and in this case, just look at part of them. This can be particularly useful if we just want to see the beginning or end of the file, or see how it's formatted.
The commands are head and tail and they just let you look at
the beginning and end of a file respectively.
head F3D0_S188_L001_R1_001.fastq tail F3D0_S188_L001_R1_001.fastq
The -n option to either of these commands can be used to print the
first or last n lines of a file. To print the first/last line of the
file use:
head -n 1 F3D0_S188_L001_R1_001.fastq tail -n 1 F3D0_S188_L001_R1_001.fastq
We showed a little how to search within a file using less. We can also
search within files without even opening them, using grep. Grep is a command-line
utility for searching plain-text data sets for lines matching a string or regular expression.
Let's give it a try!
Let's search for that sequence 1101:14341 in the F3D0_S188_L001_R1_001.fastq file.
grep 1101:14341 F3D0_S188_L001_R1_001.fastq
We get back the whole line that had '1101:14341' in it. What if we wanted all four lines, the whole part of that FASTQ sequence, back instead.
grep -A 3 1101:14341 F3D0_S188_L001_R1_001.fastq
The -A flag stands for "after match" so it's returning the line that
matches plus the three after it. The -B flag returns that number of lines
before the match.
** Exercise **
Search for the sequence 'TTATCCGGATTTATTGGGTTTAAAGGGT' in the
F3D0_S188_L001_R1_001.fastq file and in the output have the
sequence name and the sequence. e.g.
@M00967:43:000000000-A3JHG:1:2114:11799:28499 1:N:0:188
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGCAG
Search for that sequence in all the FASTQ files.
We're excited we have all these sequences that we care about that we just got from the FASTQ files. That is a really important motif that is going to help us answer our important question. But all those sequences just went whizzing by with grep. How can we capture them?
We can do that with something called "redirection". The idea is that we're redirecting the output to the terminal (all the stuff that went whizzing by) to something else. In this case, we want to print it to a file, so that we can look at it later.
The redirection command for putting something in a file is >
Let's try it out and put all the sequences that contain 'TTATCCGGATTTATTGGGTTTAAAGGGT' from all the files in to another file called 'good-data.txt'
grep -B 2 TTATCCGGATTTATTGGGTTTAAAGGGT * > good-data.txt
The prompt should sit there a little bit, and then it should look like nothing
happened. But type ls. You should have a new file called good-data.txt. Take
a look at it and see if it has what you think it should.
There's one more useful redirection command that we're going to show, and that's
called the pipe command, and it is |. It's probably not a key on
your keyboard you use very much. What | does is take the output that
scrolling by on the terminal and then can run it through another command.
When it was all whizzing by before, we wished we could just slow it down and
look at it, like we can with less. Well it turns out that we can! We pipe
the grep command through less
grep TTATCCGGATTTATTGGGTTTAAAGGGT * | less
Now we can use the arrows to scroll up and down and use q to get out.
We can also do something tricky and use the command wc. wc stands for
word count. It counts the number of lines or characters. So, we can use
it to count the number of lines we're getting back from our grep command.
And that will magically tell us how many sequences we're finding. We're
grep TTATCCGGATTTATTGGGTTTAAAGGGT * | wc
That tells us the number of lines, words and characters in the file. If we
just want the number of lines, we can use the -l flag for lines.
grep TTATCCGGATTTATTGGGTTTAAAGGGT * | wc -l
Redirecting is not super intuitive, but it's really powerful for stringing together these different commands, so you can do whatever you need to do.
The philosophy behind these command line programs is that none of them
really do anything all that impressive. BUT when you start chaining
them together, you can do some really powerful things really
efficiently. If you want to be proficient at using the shell, you must
learn to become proficient with the pipe and redirection operators:
|, >, >>.
Now we can move around in the file structure, look at files, search files, redirect. But what if we want to do normal things like copy files or move them around or get rid of them. Sure we could do most of these things without the command line, but what fun would that be?! Besides it's often faster to do it at the command line, or you'll be on a remote server like Amazon where you won't have another option.
The stability.files file is one that tells us what sample name goes with what sequences. This is a really important file, so we want to make a copy so we don't lose it.
Lets copy the file using the cp command. The cp
command backs up the file. Navigate to the data directory and enter:
cp stability.files stability.files_backup
Now stability.files_backup has been created as a copy of stability.files.
Let's make a backup directory where we can put this file.
The mkdir command is used to make a directory. Just enter mkdir
followed by a space, then the directory name.
mkdir backup
We can now move our backed up file in to this directory. We can
move files around using the command mv. Enter this command:
mv stability.files_backup backup/
This moves stability.files_backup into the directory backup/ or
the full path would be ~/edamame-data/shell/MiSeq/backup
The mv command is also how you rename files. Since this file is so
important, let's rename it:
mv stability.files stability.files_IMPORTANT
Now the file name has been changed to stability.files_IMPORTANT. Let's delete the backup file now:
rm backup/stability.files_backup
The rm file removes the file. Be careful with this command. It doesn't
just nicely put the files in the Trash. They're really gone.
Short Exercise
Do the following:
- Rename the
stability.files_IMPORTANTfile tostability.files. - Create a directory in the
MiSeqdirectory callednew - Then, copy the
stability.filesfile intonew
By default, rm, will NOT delete directories. You can tell rm to
delete a directory using the -r option. Let's delete that new directory
we just made. Enter the following command:
rm -r new
We've been able to do a lot of work with files that already exist, but what if we want to write our own files. Obviously, we're not going to type in a FASTA file, but you'll see as we go through other tutorials, there are a lot of reasons we'll want to write a file, or edit an existing file.
To write in files, we're going to use the program nano. We're going to create
a file that contains the favorite grep command so you can remember it for later. We'll name this file
'awesome.sh'.
nano awesome.sh
Now you have something that looks like
Type in your command, so it looks like
Now we want to save the file and exit. At the bottom of nano, you see the "^X Exit". That
means that we use Ctrl-X to exit. Type Ctrl-X. It will ask if you want to save it. Type y for yes.
Then it asks if you want that file name. Hit 'Enter'.
Now you've written a file. You can take a look at it with less or cat, or open it up again and edit it.
Exercise
Open 'awesome.sh' and add "echo AWESOME!" after the grep command and save the file.
We're going to come back and use this file in just a bit.
Commands like ls, rm, echo, and cd are just ordinary programs
on the computer. A program is just a file that you can execute. The
program which tells you the location of a particular program. For
example:
which ls
Will return "/bin/ls". Thus, we can see that ls is a program that
sits inside of the /bin directory. Now enter:
which find
You will see that find is a program that sits inside of the
/usr/bin directory.
So ... when we enter a program name, like ls, and hit enter, how
does the shell know where to look for that program? How does it know
to run /bin/ls when we enter ls. The answer is that when we enter
a program name and hit enter, there are a few standard places that the
shell automatically looks. If it can't find the program in any of
those places, it will print an error saying "command not found". Enter
the command:
echo $PATH
This will print out the value of the PATH environment variable. More
on environment variables later. Notice that a list of directories,
separated by colon characters, is listed. These are the places the
shell looks for programs to run. If your program is not in this list,
then an error is printed. The shell ONLY checks in the places listed
in the PATH environment variable.
Navigate to the shell directory and list the contents. You will
notice that there is a program (executable file) called hello.sh in
this directory. Now, try to run the program by entering:
hello.sh
You should get an error saying that hello.sh cannot be found. That is
because the directory /home/username/edamame-data/shell is not in the
PATH. You can run the hello.sh program by entering:
./hello.sh
Remember that . is a shortcut for the current working
directory. This tells the shell to run the hello.sh program which is
located right here. So, you can run any program by entering the path
to that program. You can run hello.sh equally well by specifying:
/home/username/edamame-data/shell/hello.sh
Or by entering:
~/edamame-data/shell/hello.sh
When there are no / characters, the shell assumes you want to look
in one of the default places for the program.
We know how to write files and run scripts, so I bet you can guess where this is headed. We're going to run our own script!
Go in to the 'MiSeq' directory where we created 'awesome.sh' before. Remember we wrote our favorite grep command in there. Since we like it so much, we might want to run it again, or even all the time. Instead of writing it out every time, we can just run it as a script.
It's a command, so we should just be able to run it. Give it try.
./awesome.sh
Alas, we get -bash: ./awesome.sh: Permission denied. This is because we haven't told
the computer that it's a program. To do that we have to make it 'executable'. We do this
by changing its mode. The command for that is chmod - change mode. We're going to change the mode
of this file, so that it's executable and the computer knows it's OK to run it as a program.
chmod +x awesome.sh
Now let's try running it again
./awesome.sh
Now you should have seen some output, and of course, it's AWESOME! Congratulations, you just created your first shell script! You're set to rule the world.
The find program can be used to find files based on arbitrary
criteria. Navigate to the data directory and enter the following
command:
find . -print
This prints the name of every file or directory, recursively, starting from the current directory. Let's exclude all of the directories:
find . -type f -print
This tells find to locate only files. Now try these commands:
find . -type f -name "*1*"
find . -type f -name "*1*" -or -name "*2*" -print
find . -type f -name "*1*" -and -name "*2*" -print
The find command can acquire a list of files and perform some
operation on each file. Try this command out:
find . -type f -exec grep Volume {} \;
This command finds every file starting from .. Then it searches each
file for a line which contains the word "Volume". The {} refers to
the name of each file. The trailing \; is used to terminate the
command. This command is slow, because it is calling a new instance
of grep for each item the find returns.
A faster way to do this is to use the xargs command:
find . -type f -print | xargs grep Volume
find generates a list of all the files we are interested in,
then we pipe them to xargs. xargs takes the items given to it
and passes them as arguments to grep. xargs generally only creates
a single instance of grep (or whatever program it is running).
- Software Carpentry tutorial - The Unix shell
- The shell handout - Command Reference
- explainshell.com
- http://tldp.org/HOWTO/Bash-Prog-Intro-HOWTO.html
- man bash
- Google - if you don't know how to do something, try Googling it. Other people have probably had the same question.
- Learn by doing. There's no real other way to learn this than by trying it out. Write your next paper in nano (really emacs or vi), open pdfs from the command line, automate something you don't really need to automate.
backtick, xargs: Example find all files with certain text
alias -> rm -i
variables -> use a path example
.bashrc
du
ln
ssh and scp
Regular Expressions
Permissions
Chaining commands together