A Python script for extracting & assembling selected segments of a Minia contig tree.
The Minia de-novo assembler produces a FASTA file of contigs where each contig's header line indicates which contigs are adjacent on the 5' and 3' ends.
This tool provides an easy way to isolate a section of the graph around a specific target (or targets) without needing to convert the file to a GFA.
Usage: python3 contigtree.py <contigs.fa> <depth> <targets>
A suitable depth is 2-4. The contig sequences are printed to stdout in FASTA format while the tree is printed to stderr. Contigtree uses python3 core modules only and mmaps the contigs.fa file from disk to minimize RAM usage.
Example:
$ python3 ~/contigtree/contigtree.py minia.contigs.fa 4 963205
===================== Tree forwards from 963205 to depth 4 =====================
|->963205
|->273719
|->5513749
|->1163354(r)
|->10050961
|->10472585
|->7751509(r)
|->1328540(r)
|->2098886(r)
|->6629975(r)
|->7219254(r)
|->3776338(r)
===================== Tree reverse from 963205 to depth 4 ======================
|->963205(r)
|->6629975
|->963339(r)
|->6629975
|->963339(r)
|->2098886
|->2098886
|->1328540
|->7751509
|->8441592
============================== Unique contigs: 17 ==============================
>963205_len_3680
TCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTG
ATTATGATCCTCTAGATCAGATCTGCGAAGATACGGCCACGGGTGCTCTTGATCCTGTGGCT...
An (r) next to the contig name indicates it is in reverse-complement orientation.