Merge pull request #14 from ginkgobioworks/siqi/unify_promoter_names

refactor: add inference framework

ginkgo_ai_client/queries.py

@@ -276,9 +276,11 @@ class PromoterActivityQuery(QueryBase):
     query_name: Optional[str] = None
         The name of the query. It will appear in the API response and can be used to
         handle exceptions.
-    model: str = "borzoi-human-fold0"
-        The model to use for the inference (only one default model is supported for now).
-
+    inference_framework: Literal["promoter-0"] = "promoter-0"
+        The inference framework to use for the inference. Currently only supports 
+    borzoi_model: Literal["human-fold0"] = "human-fold0"
+        The model to use for the inference. Currently only supports the trained 
+        model of "human-fold0".
     Returns
     -------
     PromoterActivityResponse
@@ -291,7 +293,8 @@ class PromoterActivityQuery(QueryBase):
     orf_sequence: str
     tissue_of_interest: Dict[str, List[str]]
     source: str
-    model: str = "borzoi-human-fold0"
+    inference_framework: Literal["promoter-0"] = "promoter-0"
+    borzoi_model: Literal["human-fold0"] = "human-fold0"
     query_name: Optional[str] = None
 
     def to_request_params(self) -> Dict:
@@ -303,7 +306,7 @@ def to_request_params(self) -> Dict:
             "source": self.source,
         }
         return {
-            "model": self.model,
+            "model": f"borzoi-{self.borzoi_model}",
             "text": json.dumps(data),
             "transforms": [{"type": "PROMOTER_ACTIVITY"}],
         }

test/test_models.py

@@ -10,7 +10,7 @@
     DiffusionMaskedQuery,
     BoltzStructurePredictionQuery,
 )
-
+from pydantic_core import ValidationError
 
 @pytest.mark.parametrize(
     "model, sequence, expected_sequence",
@@ -67,6 +67,23 @@ def test_promoter_activity():
     assert "heart" in response.activity_by_tissue
     assert "liver" in response.activity_by_tissue
 
+def test_promoter_activity_fails_with_invalid_framework_name():
+    client = GinkgoAIClient()
+
+    with pytest.raises(ValidationError) as exc_info:
+        query = PromoterActivityQuery(
+            promoter_sequence="tgccagccatctgttgtttgcc",
+            orf_sequence="GTCCCACTGATGAACTGTGCT",
+            source="expression",
+            tissue_of_interest={
+                "heart": ["CNhs10608+", "CNhs10612+"],
+                "liver": ["CNhs10608+", "CNhs10612+"],
+            },
+            inference_framework="promoter-2"  # invalid framework
+        )
+
+    assert "Input should be 'promoter-0' " in str(exc_info.value)
+    assert "type=literal_error" in str(exc_info.value)
 
 @pytest.mark.parametrize(
     "model, sequence",