A python wrapper for wavefront alignment using WFA2-lib
To download from pypi:
pip install pywfa
From conda:
conda install -c bioconda pywfa
Build from source:
git clone https://github.com/kcleal/pywfa cd pywfa pip install .
Alignment of pattern and text strings can be performed by accessing WFA2-lib functions directly:
from pywfa import WavefrontAligner pattern = "TCTTTACTCGCGCGTTGGAGAAATACAATAGT" text = "TCTATACTGCGCGTTTGGAGAAATAAAATAGT" a = WavefrontAligner(pattern) score = a.wavefront_align(text) assert a.status == 0 # alignment was successful assert a.cigarstring == "3M1X4M1D7M1I9M1X6M" assert a.score == -24 a.cigartuples >>> [(0, 3), (8, 1), (0, 4), (2, 1), (0, 7), (1, 1), (0, 9), (8, 1), (0, 6)] a.cigar_print_pretty()
>>> ALIGNMENT 3M1X4M1D7M1I9M1X6M
ALIGNMENT.COMPACT 1X1D1I1X
PATTERN TCTTTACTCGCGCGTT-GGAGAAATACAATAGT
||| |||| ||||||| ||||||||| ||||||
TEXT TCTATACT-GCGCGTTTGGAGAAATAAAATAGT
The output of cigar_pretty_print can be directed to a file, rather than stdout using:
a.cigar_print_pretty("file.txt")
To obtain a python str of this print out, access the results object (see below).
Cigartuples follow the convention:
| Operation | Code |
|---|---|
| M | 0 |
| I | 1 |
| D | 2 |
| N | 3 |
| S | 4 |
| H | 5 |
| = | 7 |
| X | 8 |
| B | 9 |
For convenience, a results object can be obtained by calling the WavefrontAligner with a pattern and text:
pattern = "TCTTTACTCGCGCGTTGGAGAAATACAATAGT"
text = "TCTATACTGCGCGTTTGGAGAAATAAAATAGT"
a = WavefrontAligner(pattern)
result = a(text) # alignment result
result.__dict__
>>> {'pattern_length': 32, 'text_length': 32, 'pattern_start': 0, 'pattern_end': 32, 'text_start': 0, 'text_end': 32, 'cigartuples': [(0, 3), (8, 1), (0, 4), (2, 1), (0, 7), (1, 1), (0, 9), (8, 1), (0, 6)], 'score': -24, 'pattern': 'TCTTTACTCGCGCGTTGGAGAAATACAATAGT', 'text': 'TCTATACTGCGCGTTTGGAGAAATAAAATAGT', 'status': 0}
# Alignment can also be called with a pattern like this:
a(text, pattern)
# obtain a string in the same format as cigar_print_pretty
a.pretty
>>> 3M1X4M1D7M1I9M1X6M ALIGNMENT
1X1D1I1X ALIGNMENT.COMPACT
PATTERN TCTTTACTCGCGCGTT-GGAGAAATACAATAGT
|||*|||| ||||||| |||||||||*||||||
TEXT TCTATACT-GCGCGTTTGGAGAAATAAAATAGT
To configure the WaveFrontAligner, options can be provided during initialization:
from pywfa import WavefrontAligner
a = WavefrontAligner(scope="score",
distance="affine2p",
span="end-to-end",
heuristic="adaptive")
Supported distance metrics are "affine" (default) and "affine2p". Scope can be "full" (default) or "score". Span can be "ends-free" (default) or "end-to-end". Heuristic can be None (default), "adaptive" or "X-drop".
When using heuristic functions it is recommended to check the status attribute:
pattern = "AAAAACCTTTTTAAAAAA" text = "GGCCAAAAACCAAAAAA" a = WavefrontAligner(heuristic="adaptive") a(pattern, text) a.status >>> 0 # successful alignment, -1 indicates the alignment was stopped due to the heuristic
The WavefrontAligner will be initialized with the following default options:
| Parameter | Default value |
|---|---|
| pattern | None |
| distance | "affine" |
| match | 0 |
| gap_opening | 6 |
| gep_extension | 2 |
| gap_opening2 | 24 |
| gap_extension2 | 1 |
| scope | "full" |
| span | "ends-free" |
| pattern_begin_free | 0 |
| pattern_end_free | 0 |
| text_begin_free | 0 |
| text_end_free | 0 |
| heuristic | None |
| min_wavefront_length | 10 |
| max_distance_threshold | 50 |
| steps_between_cutoffs | 1 |
| xdrop | 20 |
If desired the cigar can be modified so the end operation is either a soft-clip or a match, this makes the alignment cigar resemble those produced by bwa, for example:
pattern = "AAAAACCTTTTTAAAAAA" text = "GGCCAAAAACCAAAAAA" a = WavefrontAligner(pattern) res = a(text, clip_cigar=False) print(cigartuples_to_str(res.cigartuples)) >>> 4I7M5D6M res(text, clip_cigar=True) print(cigartuples_to_str(res.cigartuples)) >>> 4S7M5D6M
An experimental feature is to trim short matches at the end of alignments. This results in alignments that approximate local alignments:
pattern = "AAAAAAAAAAAACCTTTTAAAAAAGAAAAAAA" text = "ACCCCCCCCCCCAAAAACCAAAAAAAAAAAAA" a = WavefrontAligner(pattern) # The unmodified cigar may have short matches at the end: res = a(text, clip_cigar=False) res.cigartuples >>> [(0, 1), (1, 5), (8, 6), (0, 7), (2, 5), (0, 5), (8, 1), (0, 7)] res.aligned_text >>> ACCCCCCCCCCCAAAAACCAAAAAAAAAAAAA res.text_start, res.text_end >>> 0, 32 # The minimum allowed block of matches can be set at e.g. 5 bp, which will trim off short matches res = a(text, clip_cigar=True, min_aligned_bases_left=5, min_aligned_bases_right=5) res.cigartuples >>> [(4, 12), (0, 7), (2, 5), (0, 5), (8, 1), (0, 7)] res.aligned_text >>> AAAAACCAAAAAAAAAAAAA res.text_start, res.text_end >>> 12, 32 # Mismatch operations X can also be elided, note this occurs after the clip_cigar stage res = a(text, clip_cigar=True, min_aligned_bases_left=5, min_aligned_bases_right=5, elide_mismatches=True) res.cigartuples >>> [(4, 12), (0, 7), (2, 5), (0, 13)] res.aligned_text >>> AAAAACCAAAAAAAAAAAAA
Notes: The alignment score is not modified currently by trimming the cigar, however the pattern_start, pattern_end, test_start and text_end are modified when the cigar is modified.
