Merge pull request #52 from molgenis/feat/fasta

Retrieve embedded reference sequence data

package.json

@@ -1,6 +1,6 @@
 {
   "name": "@molgenis/vip-report-api",
-  "version": "2.0.0",
+  "version": "2.1.0",
   "description": "Report API for Variant Call Format (VCF) Report Templates",
   "main": "dist/index.js",
   "types": "dist/index.d.ts",

src/ApiClient.ts

@@ -33,10 +33,11 @@ interface Data {
 
 interface BinaryData extends BinaryDataNode {
   vcfGz: Buffer;
+  fastaGz: BinaryDataNode;
 }
 
 interface BinaryDataNode {
-  [key: string]: Uint8Array | BinaryDataNode;
+  [key: string]: Buffer | BinaryDataNode;
 }
 
 export class ApiClient implements Api {
@@ -66,6 +67,21 @@ export class ApiClient implements Api {
     return Promise.resolve(this.reportData.binary.vcfGz);
   }
 
+  getFastaGz(contig: string, pos: number): Promise<Buffer | null> {
+    let buffer: Buffer | null = null;
+    for (const [key, value] of Object.entries(this.reportData.binary.fastaGz)) {
+      const pair = key.split(':');
+      if (pair[0] === contig) {
+        const interval = pair[1].split('-');
+        if (pos >= parseInt(interval[0], 10) && pos <= parseInt(interval[1], 10)) {
+          buffer = value as Buffer;
+          break;
+        }
+      }
+    }
+    return Promise.resolve(buffer);
+  }
+
   private get<T extends Resource>(resource: string, params: Params = {}): Promise<PagedItems<T>> {
     return new Promise((resolve, reject) => {
       if (!this.reportData.data[resource]) {

src/ApiData.ts

@@ -33,6 +33,7 @@ export interface Items<T extends Resource> {
 
 export interface EncodedData extends EncodedDataContainer {
   vcfGz: string;
+  fastaGz: EncodedDataContainer;
 }
 
 export interface Resource {

src/__tests__/ApiClient.test.ts

@@ -50,7 +50,15 @@ beforeEach(() => {
       }
     },
     base85: {
-      vcfGz: new Base85().encode(Buffer.from(gzipSync(fs.readFileSync(__dirname + '/trio.vcf'))))
+      vcfGz: new Base85().encode(Buffer.from(gzipSync(fs.readFileSync(__dirname + '/trio.vcf')))),
+      fastaGz: {
+        '1:17350500-17350600': new Base85().encode(
+          Buffer.from(gzipSync(fs.readFileSync(__dirname + '/interval0.fasta')))
+        ),
+        '2:47637200-47637300': new Base85().encode(
+          Buffer.from(gzipSync(fs.readFileSync(__dirname + '/interval1.fasta')))
+        )
+      }
     }
   };
   api = new ApiClient(reportData);
@@ -636,3 +644,20 @@ test('getVcfGz', async () => {
   // null check, because size check differs between local machine and Travis
   expect(vcfGz).not.toBe(null);
 });
+
+test('getFastaGz', async () => {
+  const fastaGz = await api.getFastaGz('1', 17350550);
+  // null check, because size check differs between local machine and Travis
+  expect(fastaGz).not.toBe(null);
+});
+
+test('getFastaGz - unknown interval', async () => {
+  const fastaGz = await api.getFastaGz('1', 17350450);
+  // null check, because size check differs between local machine and Travis
+  expect(fastaGz).toBe(null);
+});
+
+test('getFastaGz - existing interval in other contig', async () => {
+  const fastaGz = await api.getFastaGz('1', 47637250);
+  expect(fastaGz).toBe(null);
+});

src/__tests__/interval0.fasta

@@ -0,0 +1,2 @@
+>1:17350500-17350600
+CTCCGTTCCACCAGTAGCTGGGGCAGCTGGTGCTACAGCAGGCACAGAGAATGCACTCGTAGAGCCCGTCCTGTATGGGGAGAAAAGAGAGGCAGGAGCTT

src/__tests__/interval1.fasta

@@ -0,0 +1,2 @@
+>2:47637200-47637300
+TTGTTAAATTTTTAAAATTTTATTTTTACTTAGGCTTCTCCTGGCAATCTCTCTCAGTTTGAAGACATTCTCTTTGGTAACAATGATATGTCAGCTTCCAT