uflow

USEARCH based workflow. See dadaist2 for an Open Source workflow.

Instructions

1. Generate a singularity container using the definition from deps
2. Download Dadaist2 databases and use that directory as --dbdir
3. Run the workflow selecting or creating a profile:

nextflow run uflow/ --input DIR --outdir OUT -profile bact

Parameters:

• --outdir output directory
• --dir path to the input directory
• --pattern expansion to get the read pairs (default = "_R{1,2}.fastq.gz")
• --dbdir path to the database directory (hint: put it in the profile)
• --db actual database (file in the dbdir) to be used
• --its enable ITS processing
• --its_region ITS region (default = "ITS1")
• --forward sequence of the forward primer (default = "CTTGGTCATTTAGAGGAAGTAA")
• --reverse sequence of the reverse primer (default = "GCTGCGTTCTTCATCGATGC")