added CRISPR-sciATAC

Teichlab · Mar 21, 2024 · a76e9ba · a76e9ba
1 parent adf45d3
commit a76e9ba
Show file tree

Hide file tree

Showing 9 changed files with 244 additions and 2 deletions.
diff --git a/README.md b/README.md
@@ -74,6 +74,7 @@ Click the following links to view the methods. Notes:
 
   - [10x Chromium Single Cell Multiome ATAC + Gene Expression](https://teichlab.github.io/scg_lib_structs/methods_html/10xChromium_multiome.html)
   - [scNOMe-seq/scCOOL-seq](https://teichlab.github.io/scg_lib_structs/methods_html/scNOMe_scCOOL.html)
+  - [CRISPR-sciATAC](https://teichlab.github.io/scg_lib_structs/methods_html/CRISPR-sciATAC.html)
   - [scDam&T-seq](https://teichlab.github.io/scg_lib_structs/methods_html/scDamT-seq.html)
   - [ISSAAC-seq](https://teichlab.github.io/scg_lib_structs/methods_html/ISSAAC-seq.html)
   - [SHARE-seq](https://teichlab.github.io/scg_lib_structs/methods_html/SHARE-seq.html)
@@ -150,7 +151,6 @@ Click the following links to view the methods. Notes:
   - [scRCAT-seq](https://www.nature.com/articles/s41467-020-18976-7)
   - [Phospho-seq](https://www.biorxiv.org/content/10.1101/2023.03.27.534442v1.full)
   - [RamDA-seq](https://www.nature.com/articles/s41467-018-02866-0)
-  - [CRISPR-sciATAC](https://www.nature.com/articles/s41587-021-00902-x)
   - [SIMPLE-seq](https://www.nature.com/articles/s41587-024-02148-9)
   - [scTAPS](https://www.biorxiv.org/content/10.1101/2024.02.12.579864v1)
 

diff --git a/data/CRISPR-sciATAC/41587_2021_902_MOESM1_ESM.pdf b/data/CRISPR-sciATAC/41587_2021_902_MOESM1_ESM.pdf
diff --git a/data/CRISPR-sciATAC/41587_2021_902_MOESM4_ESM.xlsx b/data/CRISPR-sciATAC/41587_2021_902_MOESM4_ESM.xlsx
diff --git a/data/CRISPR-sciATAC/addgene-plasmid-86708-sequence-317051-Map.png b/data/CRISPR-sciATAC/addgene-plasmid-86708-sequence-317051-Map.png
diff --git a/data/CRISPR-sciATAC/barcoded_TnY.svg b/data/CRISPR-sciATAC/barcoded_TnY.svg
diff --git a/data/txci-ATAC-seq/Tn5ME-B_barcode.xlsx b/data/txci-ATAC-seq/Tn5ME-B_barcode.xlsx
diff --git a/methods_html/CRISPR-sciATAC.html b/methods_html/CRISPR-sciATAC.html
diff --git a/methods_html/Spear-ATAC.html b/methods_html/Spear-ATAC.html
@@ -265,7 +265,7 @@ <h2>sgRNA Library sequencing:</h2>
 
 <p><info>Note that even though the regular Nextera Read 1 primer in the sequencing kit can be used to sequence the 10-bp sgRNA barcode which would provide the identity of the sgRNA, it is still recommended to use <b> oMCB1672</b> to sequence the <cbc>sgRNA-Spacer</cbc>.</info></p>
 
-<h3>(1) Add oMCB1672 primer to get the first read (bottom strand as template, this is the <cbc>sgRNA-Spacer</cbc>:</h3>
+<h3>(1) Add oMCB1672 primer to get the first read (bottom strand as template, this is the <cbc>sgRNA-Spacer</cbc>):</h3>
 <pre>
 <align class="long">
                                                                                                                                  5'- <hairp>GCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC</hairp>------------>

diff --git a/methods_html/txci-ATAC-seq.html b/methods_html/txci-ATAC-seq.html
@@ -19,6 +19,7 @@ <h2>Adapter and primer sequences:</h2>
 <p>10x Genomics Beads-oligo: |--5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5><cbc>[16-bp GEM barcode]</cbc><s5>TCGTCGGCAGCGTC</s5> -3'</p>
 <p>Tn5ME-A: 5'- <s5>TCGTCGGCAGCGTC</s5><me>AGATGTGTATAAGAGACAG</me> -3'</p>
 <p>Tn5ME-B: 5'- <s7>CGTGTGCTCTTCCGATCT</s7><cbc>[8-bp Tn5 barcode]</cbc><me>AGATGTGTATAAGAGACAG</me> -3'</p>
+<p><b>*</b> The barcode sequence on the 96w plate layout can be found from <a href="../data/txci-ATAC-seq/Tn5ME-B_barcode.xlsx" target="_blank">this file</a>.</p>
 <p>Tn5MErev: 5'-/phos/ <me>CTGTCTCTTATACACATCT</me> -3'</p>
 <p>Nextera Tn5 binding site (19-bp Mosaic End (ME)): 5'- <me>AGATGTGTATAAGAGACAG</me> -3'</p>
 <p>Nextera S5xx primer entry point (s5): 5'- <s5>TCGTCGGCAGCGTC</s5> -3'</p>