docs: fix formatting (#2958)

docs/src/content/docs/for-administrators/my-first-loculus.md

@@ -1,39 +1,33 @@
 ---
-title: "Tutorial: My first loculus"
+title: 'Tutorial: My first loculus'
 description: Experimenting with a Loculus interface running in a local mini Kubernetes cluster
 ---
 
-
 This tutorial will guide you through setting up a test instance for Loculus locally, running on a mini Kubernetes cluster. You'll learn how to install dependencies, deploy Loculus, configure a custom organism, and submit sample data. By the end, you'll have a Loculus database running on your machine, providing hands-on experience of how things work (but the setup will not be suitable for production use).
 
-
 :::note[System requirements]
 This tutorial is intended for Linux. It has been tested on a fresh Ubuntu installation running on a DigitalOcean droplet (though you will find it simpler if you are able to run it locally.)
 
 Loculus has considerable resource requirements. We would recommend at least 6 GB of RAM and 6 cores for even this test deployment.
 :::
 
-
 ## Setting up the dependencies
 
-
 For this example we will be deploying Loculus using its [Helm](https://helm.sh/) chart, which is deployed on a Kubernetes cluster. There are many different ways of installing Kubernetes, including on managed Cloud Services, but for these purposes we will run Kubernetes on our own machine, using [k3d](https://k3d.io/), which relies on [Docker](https://www.docker.com/).
 
-####  Docker
+#### Docker
 
 First, if we don't have Docker installed, we need to install it. You should do this by following the instructions on the [Docker website](https://docs.docker.com/get-started/get-docker/).
 
-
-####  K3d
+#### K3d
 
 Next, we need to install [k3d](https://k3d.io/), which is a lightweight wrapper to run [K3s](https://k3s.io/) (a lightweight Kubernetes distribution) in Docker. To install k3d, run the following command:
 
 ```bash
 curl -s https://raw.githubusercontent.com/k3d-io/k3d/main/install.sh | bash
 ```
 
-
-####  kubectl
+#### kubectl
 
 To manage this cluster we will need [kubectl](https://kubernetes.io/docs/reference/kubectl/overview/), which is the Kubernetes command-line tool. You can do this by running the following commands:
 
@@ -44,7 +38,7 @@ sudo mv kubectl /usr/local/bin/
 
 ```
 
-####  Helm
+#### Helm
 
 We deploy Loculus we also need [Helm](https://helm.sh/), which is a package manager for Kubernetes. You can do this by running the following commands:
 
@@ -54,7 +48,6 @@ chmod 700 get_helm.sh
 ./get_helm.sh
 ```
 
-
 ## Our first Loculus instance
 
 Now we need to get the Loculus Helm chart and some helper scripts. You can do this by cloning the Loculus repository:
@@ -64,8 +57,8 @@ git clone https://github.com/loculus-project/loculus.git
 cd loculus
 ```
 
-
 ### Creating a cluster
+
 We have a wrapper script which can help with creating a cluster with the correct ports forwarded and to ensure some useful Helm charts get installed. To create a cluster, run the following command:
 
 ```bash
@@ -82,7 +75,6 @@ Now we can install Loculus using the Helm chart. To do this, run the following c
 helm install loculus ./kubernetes/loculus --set environment=local --set branch=latest --set disableIngest=true --set disableEnaSubmission=true
 ```
 
-
 #### Checking the status
 
 That command may complete relatively quickly, but it may take a few minutes for the Loculus pods to be fully running. You can check the status of the pods by running the following command:
@@ -91,7 +83,7 @@ That command may complete relatively quickly, but it may take a few minutes for
 kubectl get pods
 ```
 
-The limiting factor in the pods starting is typically the `loculus-keycloak` pod. 
+The limiting factor in the pods starting is typically the `loculus-keycloak` pod.
 
 Until it starts, other pods will crash because they need it for authentication.
 
@@ -114,7 +106,7 @@ Let's create a new configuration.
 Create a new file (for now we will call it `custom_values.yaml` and it can be in your current working directory) with the following content:
 
 ```yaml
-name: "My awesome database"
+name: 'My awesome database'
 ```
 
 Now we can "upgrade" the existing Loculus with this configuration:
@@ -133,12 +125,13 @@ Loculus ships with some default organisms, but you probably want to overwrite th
 
 Let's edit the `custom_values.yaml` file to the following:
 
+<!-- prettier-ignore-start -->
 ```yaml
-name: "Angelovirus DB"
+name: 'Angelovirus DB'
 organisms:
   asterovirus:
     schema:
-      organismName: "Angelovirus"
+      organismName: 'Angelovirus'
       metadata:
         - name: country
           type: string
@@ -156,28 +149,27 @@ organisms:
       - version: 1
         image: ghcr.io/loculus-project/preprocessing-nextclade
         args:
-          - "prepro"
+          - 'prepro'
         configFile:
           log_level: DEBUG
           genes: []
           batch_size: 100
     referenceGenomes:
       nucleotideSequences:
-        - name: "main"
-          sequence: "NNN" # We are not performing alignment here, so this sequence doesn't matter
+        - name: 'main'
+          sequence: 'NNN' # We are not performing alignment here, so this sequence doesn't matter
       genes: []
 createTestAccounts: true
 ```
-
+<!-- prettier-ignore-end -->
 
 Now we can upgrade the Loculus installation again:
 
 ```bash
 helm upgrade loculus ./kubernetes/loculus --set environment=local --set branch=latest --set disableIngest=true --set disableEnaSubmission=true -f custom_values.yaml
 ```
 
-
-Because we have enabled the `createTestAccounts` option, we need to delete the existing keycloak database to ensure that the test users are added. 
+Because we have enabled the `createTestAccounts` option, we need to delete the existing keycloak database to ensure that the test users are added.
 
 First we need to run `kubectl get pods` to get the name of the keycloak pod, which will be something like `loculus-keycloak-database-665b964c6b-gm9t5` (but with the random string at the end being different).
 
@@ -193,10 +185,8 @@ If you struggled with deleting the pod, an alternative approach would be to dele
 
 While that's getting ready, let's create some data to submit.
 
-
 First let's make our sequence file, which we might name `sequences.fasta`:
 
-
 ```txt
 >sample1
 ATGGGATTTTGGCATATATATACGA
@@ -226,7 +216,6 @@ You can then go to `Submit`. You will be prompted to create a submitting group.
 To successfully create a submitting group you will need to be able to access `127.0.0.1` on port `8079` (if you are running this on a remote machine you will need to set up port forwarding for this port too!).
 :::
 
-
 Once you have created a submitting group, you can submit your data. You will need to upload the `sequences.fasta` and `metadata.csv` files. You can then select the organism you created earlier (`Angelovirus`) and submit the data.
 
 You should find that they appear on your Review page and you can choose to release them. If you wait a minute and then refresh the Search page you should find your sequences have appeared! **🎉 We've released the first data for our new database!**
@@ -239,8 +228,6 @@ When you are done with experimenting, you can delete the cluster with the follow
 ./deploy.py cluster --delete
 ```
 
-
-
 :::caution
 
 While the pattern that was described in this tuorial is a good way to get started with Loculus, it is not suitable for production use. For a production deployment, you should use a production focused cluster -- either one from a managed service like Vultr, Digital Ocean, AWS, GCP, Azure, or more -- or a self managed cluster, which you can run using [k3s](https://k3s.io/), which is related to k3d.

docs/src/content/docs/introduction/current-state-and-roadmap.md

@@ -14,4 +14,3 @@ If you are looking for a software to manage sequencing data and would like to kn
 **GenSpectrum** uses Loculus internally to store sequencing data and power its interactive dashboards for analyzing and tracking variants and mutations of viruses. It is currently under development and will be released soon.
 
 If you also host a Loculus instance and would like it to be added to this list, please reach out!
-