- Compile examples

- Solved memory-greedy (not released) bug on edit/indel --score-only
vgteam · Feb 18, 2022 · 1d20bef · 1d20bef
1 parent 796b24c
commit 1d20bef
Show file tree

Hide file tree

Showing 12 changed files with 56 additions and 26 deletions.
diff --git a/Makefile b/Makefile
@@ -26,8 +26,10 @@ SUBDIRS=alignment \
         system \
         utils \
         wavefront
-TOOLS=tools/align_benchmark \
-      tools/generate_dataset         
+TOOLS=tools/generate_dataset \
+      tools/align_benchmark \
+      tools/examples
+
 
 release: CC_FLAGS+=-O3 -march=native -flto
 release: build
@@ -59,6 +61,7 @@ lib_wfa: $(SUBDIRS)
 clean:
 	rm -rf $(FOLDER_BIN) $(FOLDER_BUILD) $(FOLDER_LIB)
 	$(MAKE) --directory=tools/align_benchmark clean
+	$(MAKE) --directory=tools/examples clean
 
 ###############################################################################
 # Subdir rule

diff --git a/tools/align_benchmark/benchmark/benchmark_utils.c b/tools/align_benchmark/benchmark/benchmark_utils.c
@@ -118,9 +118,9 @@ void benchmark_print_output_full(
   fprintf(stream,"%d\t",align_input->pattern_length); // Pattern length
   fprintf(stream,"%d\t",align_input->text_length); // Text length
   fprintf(stream,"%d\t",score); // Alignment score
-  cigar_print(stream,cigar,true); fprintf(stream,"\t"); // CIGAR
   fprintf(stream,"%s\t",align_input->pattern); // Pattern sequence
-  fprintf(stream,"%s\n",align_input->text); // Text sequence
+  fprintf(stream,"%s\t",align_input->text); // Text sequence
+  cigar_print(stream,cigar,true); fprintf(stream,"\n"); // CIGAR
 }
 /*
  * Stats

diff --git a/tools/examples/Makefile b/tools/examples/Makefile
@@ -0,0 +1,43 @@
+###############################################################################
+# Definitions
+###############################################################################
+FOLDER_WFA=../..
+FOLDER_LIB=../../lib
+FOLDER_BIN=bin
+
+###############################################################################
+# Rules
+###############################################################################
+LIB_WFA=$(FOLDER_LIB)/libwfa.a
+EXAMPLES_C=wfa_adapt \
+           wfa_basic \
+           wfa_repetead
+EXAMPLES_CPP=wfa_bindings \
+             wfa_lambda
+
+all: setup
+all: $(EXAMPLES_C) $(EXAMPLES_CPP) 
+
+$(EXAMPLES_C): *.c $(LIB_WFA)
+	$(CC) $(CC_FLAGS) -L$(FOLDER_LIB) -I$(FOLDER_WFA) wfa_basic.c -o wfa_basic -lwfa -lm
+	$(CC) $(CC_FLAGS) -L$(FOLDER_LIB) -I$(FOLDER_WFA) wfa_adapt.c -o wfa_adapt -lwfa -lm
+	$(CC) $(CC_FLAGS) -L$(FOLDER_LIB) -I$(FOLDER_WFA) wfa_repeated.c -o wfa_repeated -lwfa -lm
+
+$(EXAMPLES_CPP): *.cpp $(LIB_WFA)
+	$(CPP) $(CC_FLAGS) -L$(FOLDER_LIB) -I$(FOLDER_WFA) wfa_bindings.cpp -o wfa_bindings -lwfacpp
+	$(CPP) $(CC_FLAGS) -L$(FOLDER_LIB) -I$(FOLDER_WFA) wfa_lambda.cpp -o wfa_lambda -lwfacpp
+
+setup:
+	@mkdir -p $(FOLDER_BIN)
+
+clean: 
+	rm -rf $(FOLDER_BIN)
+
+###############################################################################
+# Subdir rule
+###############################################################################
+export
+$(SUBDIRS):
+	$(MAKE) --directory=$@ all
+
+.PHONY: $(SUBDIRS)
diff --git a/tools/examples/compile.examples.sh b/tools/examples/compile.examples.sh
diff --git a/tools/examples/wfa_adapt b/tools/examples/wfa_adapt
diff --git a/tools/examples/wfa_basic b/tools/examples/wfa_basic
diff --git a/tools/examples/wfa_bindings b/tools/examples/wfa_bindings
diff --git a/tools/examples/wfa_bindings.cpp b/tools/examples/wfa_bindings.cpp
@@ -42,7 +42,7 @@ int main(int argc,char* argv[]) {
   string text    = "TCTATACTGCGCGTTTGGAGAAATAAAATAGT";
 
   // Create a WFAligner
-  WFAlignerGapAffine aligner(4,6,2);
+  WFAlignerGapAffine aligner(4,6,2,WFAligner::Alignment,WFAligner::MemoryHigh);
   // Align
   aligner.alignEnd2End(pattern,text);
   cout << "WFA-Alignment returns score " << aligner.getAlignmentScore() << endl;

diff --git a/tools/examples/wfa_lambda b/tools/examples/wfa_lambda
diff --git a/tools/examples/wfa_lambda.cpp b/tools/examples/wfa_lambda.cpp
@@ -55,10 +55,10 @@ int match_function(
 
 int main(int argc,char* argv[]) {
   // Create a WFAligner
-  WFAlignerGapAffine aligner(1,0,1);
+  WFAlignerGapAffine aligner(1,0,1,WFAligner::Alignment,WFAligner::MemoryHigh);
   aligner.setMatchFunct(match_function,NULL);
   // Align
-  aligner.alignEnd2End(patternLength,textLength);
+  aligner.alignEnd2EndLambda(patternLength,textLength);
   cout << "WFA-Alignment returns score " << aligner.getAlignmentScore() << endl;
 
   // Print CIGAR

diff --git a/tools/examples/wfa_repeated b/tools/examples/wfa_repeated
diff --git a/wavefront/wavefront_compute_edit.c b/wavefront/wavefront_compute_edit.c
@@ -232,6 +232,9 @@ void wavefront_compute_edit(
   if (wf_components->memory_modular) { // Modular wavefront
     score_prev = score_prev % wf_components->max_score_scope;
     score_curr = score_curr % wf_components->max_score_scope;
+    if (wf_components->mwavefronts[score_curr]) { // Free
+      wavefront_slab_free(wf_aligner->wavefront_slab,wf_components->mwavefronts[score_curr]);
+    }
   }
   // Fetch previous wavefront, compute limits & initialize
   wavefront_t* const wf_prev = wf_components->mwavefronts[score_prev];