Merge branch 'master' into nf-test/picard_scatterintervalsbyns

nf-core · Aug 26, 2024 · 33c059d · 33c059d
2 parents b9c06a9 + 3fd7beb
commit 33c059d
Show file tree

Hide file tree

Showing 277 changed files with 5,699 additions and 2,860 deletions.
diff --git a/.github/workflows/test.yml b/.github/workflows/test.yml
@@ -646,6 +646,8 @@ jobs:
 
       - name: Install nf-test
         uses: nf-core/setup-nf-test@v1
+        with:
+          version: ${{ env.NFTEST_VER }}
 
       - name: Setup apptainer
         if: matrix.profile == 'singularity'

diff --git a/.pre-commit-config.yaml b/.pre-commit-config.yaml
@@ -23,7 +23,7 @@ repos:
       - id: renovate-config-validator
   # use ruff for python files
   - repo: https://github.com/astral-sh/ruff-pre-commit
-    rev: v0.6.1
+    rev: v0.6.2
     hooks:
       - id: ruff
         files: \.py$

diff --git a/modules/nf-core/bandage/image/tests/main.nf.test b/modules/nf-core/bandage/image/tests/main.nf.test
@@ -0,0 +1,40 @@
+
+nextflow_process {
+
+    name "Test Process BANDAGE_IMAGE"
+    script "../main.nf"
+    process "BANDAGE_IMAGE"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "bandage"
+    tag "bandage/image"
+
+    test("test-bandage-image") {
+
+        when {
+            process {
+                """
+                input[0] = [
+				    [ id:'B-3106' ], // meta map
+				    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/gfa/assembly.gfa', checkIfExists: true)
+				]
+
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+					file(process.out.png[0][1]).name,
+					file(process.out.svg[0][1]).readLines()[3..7],
+					process.out.versions
+					).match()
+				}
+            )
+        }
+    }
+
+}
diff --git a/modules/nf-core/bandage/image/tests/main.nf.test.snap b/modules/nf-core/bandage/image/tests/main.nf.test.snap
@@ -0,0 +1,22 @@
+{
+    "test-bandage-image": {
+        "content": [
+            "B-3106.png",
+            [
+                " xmlns=\"http://www.w3.org/2000/svg\" xmlns:xlink=\"http://www.w3.org/1999/xlink\"  version=\"1.2\" baseProfile=\"tiny\">",
+                "<title>Qt SVG Document</title>",
+                "<desc>Generated with Qt</desc>",
+                "<defs>",
+                "</defs>"
+            ],
+            [
+                "versions.yml:md5,443fd5f11eb36f013a1863e66d0eea21"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.4"
+        },
+        "timestamp": "2024-08-26T15:18:46.613049"
+    }
+}
diff --git a/modules/nf-core/bbmap/bbnorm/meta.yml b/modules/nf-core/bbmap/bbnorm/meta.yml
@@ -10,7 +10,7 @@ tools:
       homepage: "https://jgi.doe.gov/data-and-tools/bbtools/bb-tools-user-guide/"
       documentation: "https://jgi.doe.gov/data-and-tools/bbtools/bb-tools-user-guide/"
       tool_dev_url: "https://jgi.doe.gov/data-and-tools/software-tools/bbtools/bb-tools-user-guide/bbnorm-guide/"
-      licence: "BBMap - Bushnell B. - sourceforge.net/projects/bbmap/"
+      licence: ["BBMap - Bushnell B. - sourceforge.net/projects/bbmap/"]
 input:
   - meta:
       type: map

diff --git a/modules/nf-core/bbmap/bbnorm/tests/main.nf.test b/modules/nf-core/bbmap/bbnorm/tests/main.nf.test
@@ -0,0 +1,128 @@
+
+nextflow_process {
+
+    name "Test Process BBMAP_BBNORM"
+    script "../main.nf"
+    process "BBMAP_BBNORM"
+    config "./nextflow.config"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "bbmap"
+    tag "bbmap/bbnorm"
+
+    test("test-bbmap-bbnorm-se") {
+
+        when {
+            process {
+                """
+                input[0] = [
+				    [ id:'test', single_end:true ], // meta map
+				    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
+				]
+
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+					path(process.out.fastq[0][1]).linesGzip,
+					file(process.out.log[0][1]).name,
+					process.out.versions
+					).match()
+				}
+            )
+        }
+    }
+
+    test("test-bbmap-bbnorm-pe") {
+
+        when {
+            process {
+                """
+                input[0] = [
+				    [ id:'test', single_end:false ], // meta map
+				    [
+				        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+				        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+				    ]
+                ]
+
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+					process.out.fastq[0][1].collect { path(it).linesGzip[0..1] },
+					file(process.out.log[0][1]).name,
+					process.out.versions
+					).match()
+				}
+            )
+        }
+    }
+
+    test("test-bbmap-bbnorm-interleaved") {
+
+        when {
+            process {
+                """
+                input[0] = [
+				    [ id:'test', single_end:true ],
+				    [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ]
+				]
+
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+					path(process.out.fastq[0][1]).linesGzip[3..7],
+					file(process.out.log[0][1]).name,
+					process.out.versions
+					).match()
+				}
+            )
+        }
+    }
+
+    test("test-bbmap-bbnorm-multiple-input") {
+
+        when {
+            process {
+                """
+                input[0] = [
+				    [id:'test', single_end:true ],
+				    [
+				        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+				        file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+				    ]
+                ]
+
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+					path(process.out.fastq[0][1]).linesGzip[3..7],
+					file(process.out.log[0][1]).name,
+					process.out.versions
+					).match()
+				}
+            )
+        }
+    }
+
+}
diff --git a/modules/nf-core/bbmap/bbnorm/tests/main.nf.test.snap b/modules/nf-core/bbmap/bbnorm/tests/main.nf.test.snap
@@ -0,0 +1,81 @@
+{
+    "test-bbmap-bbnorm-interleaved": {
+        "content": [
+            [
+                "A/AA//EEAEA/E/AEEEE6EE/EEEA/6AEEEEEEEEE6EEEAEAEE//A/EEEEEE//E/E/A//E/E/<<EE</E/E",
+                "@ERR5069949.2161340 NS500628:121:HK3MMAFX2:2:21107:15810:18317/2",
+                "GGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTT",
+                "+",
+                "AA6AAAE6/EA/<E/E/<//EE///EAEAEEEE////6EEE//EEE/EAEEE/AEA/EA<EA</AEEE/EE/AEAE</E//A"
+            ],
+            "test.bbnorm.log",
+            [
+                "versions.yml:md5,90b331a3702d052d61e0a14189e3fc01"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.4"
+        },
+        "timestamp": "2024-08-26T14:56:27.169474"
+    },
+    "test-bbmap-bbnorm-multiple-input": {
+        "content": [
+            [
+                "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE<EEAAAEEEEEEEEEAAAAEAEEEAEEEEEE<AAAA",
+                "@ERR5069949.1331889 NS500628:121:HK3MMAFX2:3:11605:17658:18222/1",
+                "GTCTACAAGCTGGTAATGCAACAGAAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGATGCTGCTAAAGCTTACAAAGATTATCTAGCTAGTGGGGGACAACCAATCACTAATTGTG",
+                "+",
+                "A/AAAEEEEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEEEEAEEEEEEEEEEEEEEE/EEEEE<AEAEEEEE/EAEAEEE/AEEEEEEEEEEEEEEEEEEEEAE/EEEEEEEEEEEEEEEEEEEEEEEA<EE"
+            ],
+            "test.bbnorm.log",
+            [
+                "versions.yml:md5,90b331a3702d052d61e0a14189e3fc01"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.4"
+        },
+        "timestamp": "2024-08-26T14:56:35.01159"
+    },
+    "test-bbmap-bbnorm-pe": {
+        "content": [
+            [
+                [
+                    "@ERR5069949.2161340 NS500628:121:HK3MMAFX2:2:21107:15810:18317/1",
+                    "AACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGT"
+                ],
+                [
+                    "@ERR5069949.2161340 NS500628:121:HK3MMAFX2:2:21107:15810:18317/2",
+                    "GGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTT"
+                ]
+            ],
+            "test.bbnorm.log",
+            [
+                "versions.yml:md5,90b331a3702d052d61e0a14189e3fc01"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.4"
+        },
+        "timestamp": "2024-08-26T14:59:24.68372"
+    },
+    "test-bbmap-bbnorm-se": {
+        "content": [
+            [
+
+            ],
+            "test.bbnorm.log",
+            [
+                "versions.yml:md5,90b331a3702d052d61e0a14189e3fc01"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.4"
+        },
+        "timestamp": "2024-08-26T14:59:16.676091"
+    }
+}
diff --git a/modules/nf-core/bbmap/bbnorm/tests/nextflow.config b/modules/nf-core/bbmap/bbnorm/tests/nextflow.config
@@ -0,0 +1,3 @@
+process {
+    ext.args   = 'target=100 min=5'
+}
diff --git a/modules/nf-core/bbmap/index/meta.yml b/modules/nf-core/bbmap/index/meta.yml
@@ -12,7 +12,7 @@ tools:
       licence: ["UC-LBL license (see package)"]
 input:
   - fasta:
-      type: fasta
+      type: file
       description: fasta formatted file with nucleotide sequences
       pattern: "*.{fna,fa,fasta}"
 output:

diff --git a/modules/nf-core/bbmap/index/tests/main.nf.test b/modules/nf-core/bbmap/index/tests/main.nf.test
@@ -0,0 +1,53 @@
+import groovy.io.FileType
+
+nextflow_process {
+
+    name "Test Process BBMAP_INDEX"
+    script "../main.nf"
+    process "BBMAP_INDEX"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "bbmap"
+    tag "bbmap/index"
+
+    test("test-bbmap-index") {
+
+        when {
+            process {
+                """
+                input[0] = file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
+
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                {
+                    def all_files = []
+
+                    file(process.out.index[0]).eachFileRecurse (FileType.FILES) { file ->
+                        all_files << file
+                    }
+
+                    def all_file_names = all_files.collect { it.name }.toSorted()
+
+                    def stable_file_names = [
+                        'chr1_index_k13_c15_b1.block'
+                    ]
+
+                    def stable_files = all_files.findAll { it.name in stable_file_names }.toSorted()
+
+                    assert snapshot(
+                        all_file_names,
+                        stable_files,
+                        process.out.versions[0]
+                    ).match()
+                }
+            )
+        }
+    }
+
+}
diff --git a/modules/nf-core/bbmap/index/tests/main.nf.test.snap b/modules/nf-core/bbmap/index/tests/main.nf.test.snap
@@ -0,0 +1,23 @@
+{
+    "test-bbmap-index": {
+        "content": [
+            [
+                "chr1.chrom.gz",
+                "chr1_index_k13_c15_b1.block",
+                "chr1_index_k13_c15_b1.block2.gz",
+                "info.txt",
+                "scaffolds.txt.gz",
+                "summary.txt"
+            ],
+            [
+                "chr1_index_k13_c15_b1.block:md5,9f0d9a7413c1d2c16cc24555b2381163"
+            ],
+            "versions.yml:md5,00db75f2ebfcae6002a29c49a476dda1"
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.4"
+        },
+        "timestamp": "2024-08-26T14:41:14.388643"
+    }
+}